From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
RED CELLS
Iron chelation and regulation of the cell cycle: 2 mechanisms
of posttranscriptional regulation of the universal cyclin-dependent
kinase inhibitor p21CIP1/WAF1 by iron depletion
Dong Fu1,2 and Des R. Richardson1,2
1Iron
Metabolism and Chelation Program, Department of Pathology, University of Sydney, and 2Children’s Cancer Institute Australia, Randwick,
Sydney, Australia
Iron (Fe) plays a critical role in proliferation, and Fe deficiency results in G1/S
arrest and apoptosis. However, the precise
role of Fe in cell-cycle control remains unclear. We observed that Fe depletion increased the mRNA of the universal cyclindependent kinase inhibitor, p21CIP1/WAF1,
while its protein level was not elevated.
This observation is unique to the G1/S
arrest seen after Fe deprivation, as increased p21CIP1/WAF1 mRNA and protein
are usually found when arrest is induced
by other stimuli. In this study, we exam-
ined the posttranscriptional regulation of
p21CIP1/WAF1 after Fe depletion and demonstrated that its down-regulation was due
to 2 mechanisms: (1) inhibited translocation of p21CIP1/WAF1 mRNA from the nucleus
to cytosolic translational machinery; and
(2) induction of ubiquitin-independent proteasomal degradation. Iron chelation significantly (P < .01) decreased p21CIP1/WAF1
protein half-life from 61 (ⴞ 4 minutes;
n ⴝ 3) to 28 (ⴞ 9 minutes, n ⴝ 3). Proteasomal inhibitors rescued the chelatormediated decrease in p21CIP1/WAF1 protein,
while lysosomotropic agents were not
effective. In Fe-replete cells, p21CIP1/WAF1
was degraded in an ubiquitin-dependent
manner, while after Fe depletion, ubiquitinindependent proteasomal degradation
occurred. These results are important
for considering the mechanism of Fe
depletion–mediated cell-cycle arrest and
apoptosis and the efficacy of chelators as
antitumor agents. (Blood. 2007;110:
752-761)
© 2007 by The American Society of Hematology
Introduction
Iron (Fe) is critical for many processes, such as DNA synthesis and
energy production.1,2 Tumor cells require more Fe for DNA
synthesis than normal cells, which is probably related to their rapid
proliferation.3,4 This is supported by the fact that tumor cells,
compared with their normal counterparts, have significantly higher
expression of transferrin receptor 1 (TfR1), a molecule involved in
Fe uptake from the Fe-transport protein, transferrin.3
Many studies have demonstrated that Fe chelators have inhibitory effects on growth of tumor cells.2,5 Chelators, such as
desferrioxamine (DFO), show effective anticancer activity.6-8 However, use of DFO is limited by its poor membrane permeability and
short half-life.9 Currently, Fe chelators that show much greater
antiproliferative activity than DFO are in development and include
thiosemicarbazones5,10-13 and tachpyridine.14,15
There are multiple mechanisms involved in the antitumor
activity of Fe chelators.9,15 Fe depletion results in inhibition of the
Fe-containing enzyme, ribonucleotide reductase, which is critical
for DNA synthesis.9 Treatment of cells with Fe chelators downregulates Bcl-2 levels, up-regulates the proapoptotic protein Bax,
and significantly increases caspase-3, caspase-8, and caspase-9.11,16
Consequently, these concerted effects induce apoptosis.11 Previous
studies demonstrated that Fe depletion also alters expression of
many molecules that cause cell-cycle arrest.9,17-26
Cyclins and cyclin-dependent kinases (cdks) form active cyclincdk complexes to phosphorylate the retinoblastoma protein (pRb),27
which regulates G1/S progression. Iron chelators down-regulate
both cyclin D1 and cdk2 expression.20,21,23 Consequently, phosphorylated pRb decreases after Fe chelation, which may contribute to
G1/S arrest.21,28
Cell-cycle regulation is achieved by sequential activation and
inactivation of cdks.27,29,30 Cdk inhibitors are involved in inactivating cdks and include the WAF1/CIP/KIP family. A key member of
this group of molecules is the cyclin-dependent kinase inhibitor
p21CIP1/WAF1, which acts to prevent G1/S transition.31-33 Cell-cycle
progression through the G1 phase into S is a major checkpoint for
proliferating cells and is under multiple levels of control by
p21CIP1/WAF1 and other regulators.27,29
Interestingly, p21CIP1/WAF1 has both positive and negative effects
on G1 progression.29 In fact, assembly and activation of cyclincdk complexes requires basal levels of p21CIP1/WAF1.34 However,
overexpression and induction of p21CIP1/WAF1 dominantly inhibits
the activity of cdks, especially the cyclin E/cdk2 complex, resulting in cell-cycle arrest.33 Paradoxically, p21CIP1/WAF1 can function as an assembly factor for cyclin D/cdk complexes.34 Thus,
p21CIP1/WAF1 also has positive effects on G1 phase progression.34
In fact, p21CIP1/WAF1 can stabilize and mediate nuclear accumulation of cyclin D–cdk4 or cyclin D–cdk6 complexes, which are
important for G1/S progression.35 Finally, p21CIP1/WAF1 also has
an antiapoptotic function, and its down-regulation leads to
apoptosis in tumor cells.36,37
Previous studies have shown that Fe chelators induce a G1/S
arrest and up-regulate p21CIP1/WAF1 mRNA in a p53-independent
Submitted March 2, 2007; accepted April 9, 2007. Prepublished online as Blood
First Edition paper, April 11, 2007; DOI 10.1182/blood-2007-03-076737.
The publication costs of this article were defrayed in part by page charge
payment. Therefore, and solely to indicate this fact, this article is hereby
marked ‘‘advertisement’’ in accordance with 18 USC section 1734.
An Inside Blood analysis of this article appears at the front of this issue.
© 2007 by The American Society of Hematology
752
BLOOD, 15 JULY 2007 䡠 VOLUME 110, NUMBER 2
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
BLOOD, 15 JULY 2007 䡠 VOLUME 110, NUMBER 2
IRON CHELATION AND p21CIP1/WAF1 EXPRESSION
753
manner.21,22,24 Furthermore, transcriptional and posttranscriptional
mechanisms were shown to be involved in the up-regulation of
p21CIP1/WAF1 mRNA after Fe chelation.17 In addition, p21CIP1/WAF1
mRNA expression was markedly increased after Fe depletion
with chelators, while paradoxically, its protein level remained
similar to the control or decreased.18 This has not been observed
with other Fe-regulated molecules, and the mechanism(s) involved remain unclear.
The current investigation focuses on the posttranscriptional
mechanisms involved in the decrease in p21CIP1/WAF1 protein after
Fe chelation, as it could play roles in the G1/S arrest and apoptosis
observed. Our studies demonstrate that the decrease in p21CIP1/WAF1
protein upon Fe depletion was due to a decrease in nuclear
translocation of p21CIP1/WAF1 mRNA to the cytosol and the induction of an ubiquitin-independent pathway of proteasomal degradation. The results are important for understanding the G1/S arrest and
apoptosis observed after Fe depletion and the mechanism of Fe
chelator–mediated antitumor activity.
antibody concentrations. Quantitation of results was performed using
Biorad Quantity One software (Hercules, CA). To ensure equal loading of
proteins, membranes were probed with anti-␤-actin antibody. Immunoprecipitation was achieved using standard methods.20,43 The antibodies were
from Santa Cruz Biotechnology (Santa Cruz, CA) or Sigma-Aldrich.
Materials and methods
Results
Reagents
p21CIP1/WAF1 mRNA and protein levels after Fe chelation
DFO was obtained from Novartis (Basel, Switzerland), and 311 was
synthesized and characterized as described.38 All chemicals were from
Sigma-Aldrich (St Louis, MO). The pCS2⫹p21WT and pCS2⫹p21-K6R
plasmids were gifts from Dr B. Clurman (Fred Hutchinson Cancer Research
Center, Seattle, WA).39
Many previous investigations have clearly shown that Fe chelators such
as DFO and 31138 induce marked Fe depletion by causing increased Fe
efflux from cells and inhibition of Fe uptake from transferrin.17,24,44,45 In
addition, 311 is a far more effective Fe chelator than DFO due to its
greater lipophilicity, enabling ready access to intracellular Fe pools.24,44-46
This results in a marked increase in expression of genes such as TfR1
and Ndrg-1 that are regulated by Fe.19,24,46
In initial studies, MCF-7 cells were incubated for 24 hours with
concentrations of DFO (250 ␮M) and 311 (25 ␮M) that have been
shown to induce cellular Fe depletion.18-20 These studies demonstrated that p21CIP1/WAF1 mRNA levels were significantly elevated in
DFO- or 311-treated cells compared with cells grown in control
medium (6 and 5.6 times higher, respectively; Figure 1A). However, Western blot results indicated that p21CIP1/WAF1 protein was
significantly decreased after Fe chelation (9 and 8 times lower than
control, respectively; Figure 1B). As a positive control, a low Act D
concentration (5 nM) was implemented as a DNA-damaging
agent to induce p21CIP1/WAF1 expression,47 and this increased both
p21CIP1/WAF1 mRNA and protein levels (Figure 1A-B). The paradoxical increase in p21CIP1/WAF1 mRNA and decrease in protein expression after Fe depletion was found in various cell types (data not
shown), indicating a general effect rather than being cell-type
specific. Collectively, the effect of Fe chelation on p21CIP1/WAF1
expression appeared different to the DNA-damaging agent, Act D,
and was in good agreement with our previous studies.18,21,24
Cell culture
A31N-ts20 cells40 were from Dr H. Ozer (University of Medicine and
Dentistry, New Jersey (UMDNJ)-New Jersey Medical School, Newark, NJ).
All other cells were from the American Type Culture Collection (Manassas,
VA) and were cultured as described.19 Cells were incubated with chelators
in the presence of medium containing 10% fetal calf serum (FCS).
RNA isolation and semiquantitative RT-PCR
RNA was isolated using TRIzol (Invitrogen, Melbourne, Australia).
Reverse transcription–polymerase chain reaction (RT-PCR) was performed via standard methods10 using the primers in Table 1. RT-PCR
was shown to be semiquantitative by a protocol that demonstrated it was
in the log-phase of amplification. Expression of ␤-actin was used as an
RNA-loading control.
In situ RT-PCR
MCF-7 cells were grown on chambered culture slides (Lab-TekII
Chamber slide; Nalgene Nunc, Rochester, NY). Cells were treated with
Act D (5 nM), DFO (250 ␮M), or 311 (25 ␮M) for 24 hours. In situ
RT-PCR was performed by established methods41,42 using the primers
for p21CIP1/WAF (Table 1).
Western analysis and immunoprecipitation
Western analysis was performed as described.19,21 Lysate protein concentrations were assayed using the Pierce BCA Protein Assay (Rockford, IL).
Optimization of antibody conditions were performed using a range of
Transient transfections and treatments
The pCS2⫹p21WT and pCS2⫹p21-K6R plasmids with human wild-type
and mutant p21CIP1/WAF1 inserts were transiently transfected into mouse
NIH3T3 cells using Lipofectin (Invitrogen). At 24 hours after transfection,
cells were treated with 311, MG132, or 311 and MG132 for 24 hours. Total
protein was extracted, and human p21CIP1/WAF1 protein was analyzed by
Western blot using antihuman p21CIP1/WAF1 (Zymed, Melbourne, Australia),
which does not detect endogenous mouse p21CIP1/WAF1.
Statistics
Experimental data were compared using the Student t test. Results were
considered statistically significant when P was less than .05.
Changes to p21CIP1/WAF1 mRNA and protein expression after
incubation with chelators was time and dose dependent
Our previous studies examining the effect of Fe chelation on
p21CIP1/WAF1expression were performed after 24 or 30 hours.18,21 To
examine the kinetics involved in the expression of p21CIP1/WAF1,
Table 1. Primers for amplification of human p21CIPI/WAF1 and ␤-actin
Pair
no.
Primer
name
Genotype/
accession no.
1
p21CIP1/WAF1
U03106
2
␤-actin
NM_001101
Oligonucleotides (5ⴕ to 3ⴕ)
Forward
Reverse
Product size,
bp
CTCAGAGGAGGCGCCATGTC
GAGTGGTAGAAATCTGTCATGCTGG
473
CCCGCCGCCAGCTCACCATGG
AAGGTCTCAAACATGATCTGGGTC
397
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
754
FU and RICHARDSON
BLOOD, 15 JULY 2007 䡠 VOLUME 110, NUMBER 2
Figure 1. Iron chelation paradoxically up-regulates p21CIP1/WAF1 mRNA levels and down-regulates protein expression. MCF-7 cells were incubated with 311 (25 ␮M),
DFO (250 ␮M), or Act D (5 nM) for 24 hours at 37°C. Total mRNA and protein were then extracted, and RT-PCR and Western blotting were conducted to detect p21CIP1/WAF1
mRNA and protein levels, respectively. ␤-actin was used as a loading control. (A) Effect of DFO, 311, and Act D on p21CIP1/WAF1 mRNA levels (***P ⬍ .001 relative to the control;
n ⫽ 3). (B) Effect of 311 and DFO on p21CIP1/WAF1 protein levels (***P ⬍ .001 relative to the control; n ⫽ 3). Error bars are mean ⫾ SD (standard deviation). (C) p21CIP1/WAF1
mRNA and (D) p21CIP1/WAF1 protein expression as a function of incubation time with 311 (25 ␮M) at 37°C. (E) Effect of 311 and DFO concentration on p21CIP1/WAF1 mRNA and
protein expression after an incubation of 24 hours at 37°C. Results are typical of 3 independent experiments.
MCF-7 cells were incubated with 311 (25 ␮M) for 2 to 24 hours,
and then p21CIP1/WAF1 mRNA (Figure 1C) and protein (Figure
1D) were assessed. In these experiments, 311 was used in
preference to DFO due to its much more rapid permeation of
cells to chelate and deplete Fe pools.24,44 Relative to the
control, p21CIP1/WAF1 mRNA started to increase after an 8-hour
incubation with 311 and was more than 4 times greater in the
presence of the chelator after 24 hours (Figure 1C). In contrast,
p21CIP1/WAF1 protein levels started to decrease after a 12-hour
incubation with 311 relative to the control (Figure 1D). The
p21CIP1/WAF1 protein levels decreased to nearly undetectable
levels after an 18- or 24-hour incubation with 311 (Figure 1D).
These results suggested that the effects of 311 on p21CIP1/WAF1
mRNA and protein levels in MCF-7 cells were time dependent
and paradoxic. Moreover, because the increase in mRNA
expression occurred well before the decrease in protein levels, it
appeared these 2 events were not closely coupled.
Further studies examined the effect on p21CIP1/WAF1 expression
of incubating MCF-7 cells with increasing concentrations of 311
(0.2-25 ␮M) or DFO (5-250 ␮M) for 24 hours at 37°C. The effect
of chelators on p21CIP1/WAF1 mRNA and protein levels were dose
dependent (Figure 1E). Notably, 311 was more potent than DFO,
with low concentrations of 311 (1 ␮M) causing significant changes
in p21CIP1/WAF1 mRNA and protein, while DFO required much
higher concentrations (50 ␮M) to induce similar effects.
Reconstitution of p21CIP1/WAF1 protein levels after Fe chelation
by Fe supplementation
To assess if Fe chelator–mediated down-regulation of p21CIP1/WAF1
protein was definitely due to cellular Fe depletion, we examined the
effect of Fe reconstitution by incubating cells with ferric ammonium citrate (FAC).19,20 In these studies, after preincubation for
24 hours with or without 311 (25 ␮M), MCF-7 cells were then
reincubated for up to a further 24 hours with or without FAC
(100 ␮g/mL; [Fe] ⫽ 280 ␮M; Figure 2). The results showed that
p21CIP1/WAF1 protein levels remained relatively constant when cells
were incubated in control medium for 24 hours and then reincubated with the same medium for another 24 hours (Figure 2; row i).
When cells were incubated in control medium for 24 hours and
then reincubated with FAC for up to 24 hours (Figure 2; row ii),
there was little change in p21CIP1/WAF1 protein expression. This
suggested that FAC alone did not affect basal p21CIP1/WAF1 protein
expression in Fe-replete cells. In contrast, when cells were
incubated with 311 for 24 hours to induce Fe depletion and then
reincubated with this chelator for up to 24 hours (Figure 2; row iii),
p21CIP1/WAF1 was not detectable. However, when cells were treated
with 311 for 24 hours and then reincubated for up to 24 hours with
FAC (100 ␮g/mL), there was a gradual increase in p21CIP1/WAF1
protein from 8 hours to 24 hours (Figure 2; row iv). This indicated
that addition of Fe after incubation with 311 resulted in restoration
of p21CIP1/WAF1. These results suggested that p21CIP1/WAF1 protein
expression was regulated by Fe levels.
Fe depletion decreases nuclear export of p21CIP1/WAF1 mRNA
to the cytosol
Considering p21CIP1/WAF1 mRNA expression was increased after Fe
chelation while its protein level was decreased, this suggested that
nuclear p21CIP1/WAF1 mRNA was not being efficiently transported to
the cytosol for translation. This was examined by in situ RT-PCR
(Figure 3). MCF-7 cells were treated with control medium (Con),
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
BLOOD, 15 JULY 2007 䡠 VOLUME 110, NUMBER 2
IRON CHELATION AND p21CIP1/WAF1 EXPRESSION
755
Therefore, the possible role of Fe depletion in the degradation of
p21CIP1/WAF1 was then studied.
Turnover studies using cycloheximide: iron depletion induces
the degradation of p21CIP1/WAF1
The effect of Fe chelation on p21CIP1/WAF1 protein degradation was
examined using the protein synthesis inhibitor cycloheximide
(CHX; 10 ␮g/mL) via standard methodology20,48 (Figure 4).
MCF-7 cells were preincubated with or without 311 (25 ␮M) for
12 hours and then reincubated with or without CHX in the presence
or absence of 311 (25 ␮M) for up to 480 minutes (Figure 4).
Compared with Fe-replete control cells (Figure 4A, row i and 4B),
the degradation of p21CIP1/WAF1 protein was accelerated after
incubation with 311, there being a marked decrease after 480 minutes of reincubation (Figure 4A, row ii, and B). When Fe-replete
control cells were reincubated with CHX, there was a decrease in
p21CIP1/WAF1 protein expression that was totally ablated after
240 minutes (Figure 4A, row iii, and B), with a protein half-life of
61 minutes (⫾ 4 minutes, n ⫽ 3). This estimation of p21CIP1/WAF1
half-life is similar to previous reports in Fe-replete cells.49,50
However, after preincubation of cells with 311 and then reincubation with 311 and CHX, there was a more rapid decrease in
Figure 2. Reconstitution of p21CIP1/WAF1 protein expression after Fe chelation
with the Fe supplement FAC. MCF-7 cells were preincubated with control medium
(Con) or 311 (25 ␮⌴) for 24 hours at 37°C. Medium was then removed, and the cells
were reincubated with either control medium (Con), FAC (100 ␮g/mL), 311 (25 ␮⌴),
or 311 (25 ␮⌴) and FAC (100 ␮g/mL) for 0, 4, 8, 20, and 24 hours at 37°C. Cells were
then harvested, total protein was extracted, and Western blot was performed to
measure p21CIP1/WAF1 protein expression. Results are typical of 3 independent
experiments.
Act D (5 nM), DFO (250 ␮M), or 311 (25 ␮M) for 24 hours, and
the cellular localization of p21CIP1/WAF1 mRNA was then analyzed
(observed as a dark green/brown stain within cells; see arrow in
Figure 3). These results demonstrated that compared with Fereplete control cells, where little dark green/brown staining occurred (Figure 3A), there was a marked increase in staining of
p21CIP1/WAF1 mRNA in cells treated with Act D, DFO, or 311
(Figure 3B-D). These data confirm the RT-PCR results in Figure
1A, C, and E. Examining p21CIP1/WAF1 mRNA distribution between
the nucleus and cytosol, in Fe-replete control cells, 69% (⫾ 7%,
cell number: n ⫽ 300) of p21CIP1/WAF1 mRNA was located in the
cytoplasm, while 31%(⫾ 7%, n ⫽ 300) was in the nucleus
(Figure 3A). As a positive control, a low Act D concentration
(5 nM) was used to induce DNA damage, which transcriptionally up-regulates p21CIP1/WAF1 mRNA.19,47 In this case, increased
p21CIP1/WAF1 mRNA was mainly located within the cytosol, with
only 21% (⫾ 9%, n ⫽ 300) in the nucleus (Figure 3B). In
comparison to Fe-replete cells, after Fe depletion, the proportion
of p21CIP1/WAF1 mRNA localized in the nucleus was significantly
(P ⬍ .001) increased to 58% (⫾ 7%, n ⫽ 300) and 54% (⫾ 5%,
n ⫽ 300) for DFO- and 311-treated cells, respectively (Figure
3C-D). Hence, export of p21CIP1/WAF1 mRNA from the nucleus
for translation was inhibited after Fe chelation, which may, in
part, account for decreased p21CIP1/WAF1 protein levels. However,
because p21CIP1/WAF1 mRNA was still identified within the
cytosol after Fe depletion, this mechanism alone could not
account for the decreased p21CIP1/WAF1 protein expression.
Figure 3. In situ RT-PCR for localization of p21CIP1/WAF1 mRNA demonstrates
that its nuclear translocation to the cytosol is partially inhibited after Fe
chelation with DFO or 311. MCF-7 cells were grown on slides and incubated with
control medium (Con), 311 (25 ␮⌴), DFO (250 ␮⌴), or Act D (5 nM) for 24 hours at
37°C. Cells were then fixed, and in situ RT-PCR was performed. Visual assessment
of 300 cells was performed to examine cytosolic or nuclear localization of p21CIP1/WAF1
mRNA (dark green/brown stain), and the percentages were calculated (***P ⬍ .001
relative to the control). (A) Con; (B) Act D–treated cells; (C) 311-treated cells; and
(D) DFO-treated cells. (E) Estimation of the nuclear and cytosolic localization of
p21CIP1/WAF1 mRNA by cell counts (n ⫽ 300). Results are presented as means ⫾ SD.
Images in panels A-D were taken by Olympus microscope BX51 with UPLFLN 40⫻
objective (0.75 numeric aperture) and attached DP30BW digital camera (Olympus,
Tokyo, Japan). Images were analyzed using NIH Image J program (Bethesda, MD).
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
756
FU and RICHARDSON
Figure 4. Iron chelation decreases p21CIP1/WAF1 protein half-life. MCF-7 cells were
preincubated with either control medium or medium containing 311 (25 ␮M) for 12 hours at
37°C and then reincubated for 20 to 480 minutes at 37°C with either control media alone
(Con), 311 (25 ␮M), the protein synthesis inhibitor, cycloheximide (CHX; 10 ␮g/mL), or
CHX (10 ␮g/mL) and 311 (25 ␮M). Cells were harvested and Western blot analysis was
performed. (A) Western blot analysis. (B) Densitometric analysis of the results in panel A.
Results are representative of 3 experiments.
p21CIP1/WAF1 protein levels (Figure 4A, row iv, and B) than in the
presence of CHX alone (Figure 4A, row iii, and B). In fact, in the
presence of 311 and CHX, there was a significant (P ⬍ .01)
decrease in the half-life of p21CIP1/WAF1 protein to 28 minutes
(⫾ 9 minutes, n ⫽ 3), indicating Fe depletion induced p21CIP1/WAF1
protein degradation.
The degradation of p21CIP1/WAF1 protein after Fe depletion is
mainly proteasome dependent
Considering that previous studies have suggested that p21CIP1/WAF1 is
degraded by the proteasome by a variety of stimuli,39,51-53 and to assess
BLOOD, 15 JULY 2007 䡠 VOLUME 110, NUMBER 2
the process of degradation after Fe chelation, experiments were performed using the proteasomal inhibitor, MG-13254-56 (Figure 5). Incubation of MCF-7 cells with control medium for up to 24 hours had no
appreciable effect on p21CIP1/WAF1 protein (Figure 5A), while 311
(25 ␮M) markedly decreased its level only after an 18-hour incubation
(Figure 5B). In contrast, CHX alone (Figure 5C) or CHX and 311
(Figure 5D) decreased p21CIP1/WAF1 protein expression after 4 hours and
1 hour, respectively. Incubation of cells with medium containing
MG132 (20 ␮M)54-56 alone or MG132 and 311 increased p21CIP1/WAF1
protein after 1 hour (Figure 5E-F). Furthermore, addition of MG132 to
311 totally prevented the decrease in p21CIP1/WAF1 protein observed with
311 alone (Figure 5B), and in fact led to accumulation of the protein.
This indicated that p21CIP1/WAF1 degradation was via a proteasomedependent mechanism after Fe depletion. Comparing p21CIP1/WAF1 levels
in Figure 5E and 5F, it is clear that in the presence of 311 and MG132
(Figure 5F), the accumulation of p21CIP1/WAF1 was less than that found
with MG132 alone (Figure 5E). This suggested that the chelator also
decreased p21CIP1/WAF1 protein expression via a proteasome-independent
pathway. Potentially, this could be explained by the effect of the chelator
at decreasing export of p21CIP1/WAF1 mRNA from the nucleus to the
cytosol (Figure 3).
When control cells were incubated with MG132 and CHX to
inhibit proteasomal degradation and protein synthesis, respectively,
there was no appreciable change in protein expression with time
(Figure 5G). This demonstrated these CHX and MG132 concentrations appropriately inhibited protein synthesis and proteasomal
degradation, as the protein level was relatively constant up to
24 hours (Figure 5G). Similar observations were found when cells
were incubated with MG132 and CHX in the presence of 311
(Figure 5H). Overall, the results in Figure 5 with MG132 suggested
the proteasome played a major role in p21CIP1/WAF1 degradation
under Fe-replete and -depleted conditions. Furthermore, experiments with another proteasomal inhibitor, namely lactacystin
(10 and 20 ␮M),54-56 led to similar results found with MG132 (data
not shown), confirming the role of the proteasome in p21CIP1/WAF1
protein degradation.
It could be suggested that the decreased p21CIP1/WAF1 protein
expression after incubation with the chelator could be mediated by
a direct increase in proteasomal activity. However, our previous
studies20 performed under similar experimental conditions demonstrated no alteration in 20S or 26S proteasomal activity after Fe
Figure 5. p21CIP1/WAF1 degradation is via the proteasomal pathway. (A-H) The effect of 311 on p21CIP1/WAF1 expression in MCF-7 cells in the presence or absence of the
proteasomal inhibitor MG132 and the protein synthesis inhibitor cycloheximide (CHX). MCF-7 cells were incubated for 0.5 to 24 hours at 37°C with: (A) control medium (Con);
(B) 311 (25 ␮M); (C) CHX (10 ␮g/mL); (D) 311 (25 ␮M) and CHX (10 ␮g/mL); (E) MG132 (20 ␮M); (F) 311 (25 ␮M) and MG132 (20 ␮M); (G) MG132 (20 ␮M) and CHX
(10 ␮g/mL); or (H) 311 (25 ␮M), MG132 (20 ␮M), and CHX (10 ␮g/mL). (I) Densitometric analysis of the results in panels A-H. Cells were harvested and Western blot analysis
was performed. Results shown are from a representative experiment of 3 performed.
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
BLOOD, 15 JULY 2007 䡠 VOLUME 110, NUMBER 2
depletion. Hence, while the proteasome was involved in degradation of p21CIP1/WAF1 after Fe chelation, this was not mediated by an
alteration in the rate of its proteolytic activity.
Levels of p21CIP1/WAF1 in Fe-replete cells are increased by
lysosomotropic agents, but these compounds cannot prevent
the chelator-induced decrease in p21CIP1/WAF1
The lysosome can degrade soluble proteins via chaperone-mediated
autophagy.57,58 To investigate the possible role of a lysosomal mechanism in p21CIP1/WAF1 degradation, the well-characterized lysosomotropic
agents chloroquine (250 ␮M), NH4Cl (15 mM), and CH3NH2
(15 mM)59-61 were incubated with Fe-replete MCF-7 cells for 24 hours.
The results showed that p21CIP1/WAF1 protein levels increased after
incubation with all these agents, with chloroquine being most effective
(Figure 6A). However, in contrast to the ability of MG132 to prevent the
chelator-mediated decrease in p21CIP1/WAF1 (Figures 5F, 6B), when the
lysosomotropic agents were added with the chelator they could not
rescue the decrease in p21CIP1/WAF1 (Figure 6A-B). It is notable that
when chloroquine (250 ␮M) and MG132 (20 ␮M) were compared in
the same experiment (Figure 6B), the increase in p21CIP1/WAF1 protein
expression using chloroquine was considerably less than with MG132.
Collectively, these results suggested p21CIP1/WAF1 can be degraded by
both pathways in Fe-replete cells, but that the proteasome is
dominant. In addition, chelator-induced p21CIP1/WAF1 degradation
was lysosome independent.
Polyubiquitination of p21CIP1/WAF1 is decreased in 311-treated
cells during inhibition of proteasomal activity
Proteasomal degradation of p21CIP1/WAF1 under other conditions has
been reported to occur by both ubiquitin-dependent and -independent
mechanisms.39,51-53 To investigate how Fe depletion induces proteasomemediated degradation, we examined the effect of chelation on
p21CIP1/WAF1 polyubiquitination. In these studies, p21CIP1/WAF1 protein was immunoprecipitated with anti-p21CIP1/WAF1, and the complex
was collected, washed, and separated using SDS-PAGE.20,43 Western
analysis was then performed using anti-p21CIP1/WAF1 or antiubiquitin
(Figure 7A). Cells were incubated for 8 or 24 hours with medium alone
or medium containing 311 (25 ␮M) in the presence or absence of
MG132 (20 ␮M). These time points were chosen because there was
Figure 6. Expression of p21CIP1/WAF1 protein is increased by lysosomotropic
agents in Fe-replete cells, while chelator-induced down-regulation of p21CIP1/
WAF1 can only be effectively rescued by proteasomal inhibitors. (A) MCF-7 cells
were incubated for 24 hours at 37°C with either control medium (Con), chloroquine
(250 ␮M), NH4Cl (15 mM), CH3NH2 (15 mM), 311 (25 ␮M), or the combination of 311
(25 ␮M) with chloroquine (250 ␮M), NH4Cl (15 mM), or CH3NH2 (15 mM). (B) MCF-7
cells were incubated for 24 hours at 37°C with either control medium (Con),
chloroquine (250 ␮M), MG132 (20 ␮M), 311 (25 ␮M), or 311 (25 ␮M) combined with
either chloroquine (250 ␮M) or MG132 (20 ␮M). Cells were harvested and Western
blot was performed. Results are representative from 3 experiments formed.
IRON CHELATION AND p21CIP1/WAF1 EXPRESSION
757
little effect of 311 on p21CIP1/WAF1 protein expression at 8 hours, while a
pronounced decrease occurred after 24 hours (Figure 1D).
Immunoprecipitation and Western blotting with anti-p21CIP1/WAF1
demonstrated that compared with the control after 8 hours, there was
little effect on p21CIP1/WAF1 expression of incubating cells with 311
(Figure 7A). However, Fe chelation caused near ablation of p21CIP1/WAF1
compared with the control after 24 hours (Figure 7A). Incubation with
MG132 alone or MG132 and 311 increased p21CIP1/WAF1 relative to the
control at 8 and 24 hours. However, after 24 hours, there was a decrease
in p21CIP1/WAF1 expression in the presence of 311 and MG132 relative to
MG132 alone (Figure 7A), in agreement with Figure 5E and 5F.
Western blotting with antiubiquitin antibody demonstrated that
p21CIP1/WAF1 polyubiquitination resulted in high Mr [molecular
weight] species between 60 and 200 kDa (Figure 7A), in agreement
with previous work.39 These latter bands were above the immunoglobulin G heavy chain at 50 kDa (data not shown). Incubation
with 311 alone caused no significant change in p21CIP1/WAF1
ubiquitination compared with the control at 8 hours over 3 experiments. After 24 hours of incubation with 311, there was no increase
in p21CIP1/WAF1 ubiquitination relative to the control, despite
complete ablation of p21CIP1/WAF1 (Figure 7A). However, compared
with the controls, there was an increase in p21CIP1/WAF1 polyubiquitination in the presence of MG132 after an 8-hour and 24-hour
incubation, due to the ability of this agent to inhibit p21CIP1/WAF1
degradation by the proteasome. Hence, under Fe-replete control
conditions, p21CIP1/WAF1 was ubiquitinated before proteasomal
degradation.
In the presence of 311 and MG132, there was a decrease in
p21CIP1/WAF1 ubiquitination in comparison to MG132 alone after an
8- and 24-hour incubation (Figure 7A). Decreased p21CIP1/WAF1
ubiquitination mediated by Fe depletion would not favor proteasomal degradation via the ubiquitin pathway and could not explain
the decreased p21CIP1/WAF1 after chelation. Considering this, further
studies examined the role of ubiquitin-independent proteasomal
degradation of p21CIP1/WAF1 after Fe depletion.
Iron depletion–induced degradation of p21CIP1/WAF1 via the
proteasome is independent of ubiquitination
To determine the role of ubiquitin-independent p21CIP1/WAF1 protein
degradation after Fe chelation, we used the A31N-ts20 cell line that
has a temperature-sensitive E1-ubiquitin–activating enzyme.40,62
The E1 enzyme is inactivated at 39°C, preventing ubiquitindependent proteasomal degradation, but is active at 32°C.40 Cells
were grown for 24 hours at 32°C or 39°C before the experiment to
ensure maximum activation or inactivation of E1, respectively. The
media was then removed and the cells incubated for 24 hours at
either temperature with control media or 311 (25 ␮M).
The results showed that in Fe-replete control cells, p21CIP1/WAF1
protein was markedly increased when grown at 39°C compared
with 32°C, again demonstrating p21CIP1/WAF1 protein degradation
was via a ubiquitin-dependent proteasomal pathway when cells
were Fe replete (Figure 7B). At 32°C, p21CIP1/WAF1 was not detected
in cells incubated with control medium or 311, demonstrating the
efficacy of the ubiquitin-dependent mechanism at degrading the
protein at this temperature.
Incubation with 311 down-regulated p21CIP1/WAF1 protein levels
when A31N-ts20 cells were grown at 39°C, where ubiquitindependent proteasomal degradation was prevented (Figure 7B).
This observation indicated that the effect of Fe depletion on
p21CIP1/WAF1 protein expression was at least partially ubiquitinindependent (Figure 7B).
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
758
BLOOD, 15 JULY 2007 䡠 VOLUME 110, NUMBER 2
FU and RICHARDSON
Figure 7. Role of ubiquitination in degradation of p21CIP1/WAF1 after Fe chelation. (A-C) Iron chelators decrease p21CIP1/WAF1 polyubiquitination when proteasomal activity is
inhibited. (D) A simplified schematic illustration showing the multiple molecular effectors involved in G1/S arrest of the cell cycle, inhibition of proliferation, metastasis
suppression, and induction of apoptosis. MCF-7 cells were incubated with control media (Con) or media containing 311 (25 ␮M) in the presence or absence of MG132 (20 ␮M)
for 8 or 24 hours. Immunoprecipitation was performed using anti-p21CIP1/WAF1 antibody. Complexes were then separated by SDS-PAGE and probed with anti-p21CIP1/WAF1 or
antiubiquitin antibody using Western analysis. (B) Iron chelators induce ubiquitin-independent degradation of p21CIP1/WAF1 in A31N-ts20 cells. A31N-ts20 cells were used, as
they have a temperature-sensitive E1 ubiquitin–activating enzyme that is active at 32°C, but which inactivates at 39°C, preventing ubiquitin-dependent proteasomal
degradation.40,62 Cells were grown at 32°C or 39°C for 24 hours before the experiment. The media was then removed, and the cells were incubated for 24 hours at either
temperature with control media, or media containing 311 (25 ␮M), and Western analysis was performed. (C) Iron chelators induce ubiquitin-independent degradation of p21CIP1/WAF1
in p21-K6R–transfected cells. Mouse fibroblast NIH3T3 cells were transiently transfected with pCS2⫹p21WT or pCS2⫹p21-K6R plasmids, which contain wild-type (p21-WT) or mutant
forms for human p21CIP1/WAF1, respectively. At 24 hours after transfection, cells were incubated for 24 hours with either control medium, 311 (25 ␮M), MG132 (20 ␮M), or the combination of
311 (25 ␮M) and MG132 (20 ␮M). Western blotting was performed using antihuman p21CIP1/WAF1 antibody, which only detects the transfected wild-type and mutant human p21CIP1/WAF1.
Results are a representative experiment from 3 performed. (D) Multiple molecular effectors involved in G1/S arrest, inhibition of proliferation, apoptosis, and metastasis suppression are
modulated in response to Fe deprivation. These responses include down-regulation of p21CIP1/WAF1 protein,18,21 down-regulation of cyclin D1 protein,20,21,23 decreased activity of
ribonucleotide reductase,63,64 increased p53 protein expression,17,25 increased expression of the metastasis suppressor protein Ndrg-1,19 and the up-regulation of the apoptosis-inducing
protein NIP3.65 Both NIP3 and Ndrg-1 are targets of the hypoxia inducible factor-1␣ (HIF-1␣) transcription factor.19,65 Other HIF-1␣ targets are probably also involved in the Fe
depletion–induced inhibition of proliferation and induction of apoptosis.30
To further assess the role of a ubiquitin-independent process in
the proteasomal degradation of p21CIP1/WAF1, we examined a widely
implemented model39,51,66 consisting of murine NIH3T3 cells
transiently transfected with either: (1) a mutant form of human
p21CIP1/WAF1 (p21-K6R) where the potential ubiquitin-conjugation
sites consisting of 6 lysine residues were mutated to arginine; or
(2) human wild-type p21CIP1/WAF1 (p21-WT), which can be ubiquitinated39 (Figure 7C).
Western analysis results using antihuman p21CIP1/WAF1 antibody
and murine NIH3T3 cells transfected with p21-WT demonstrated
that endogenous mouse p21CIP1/WAF1 could not be detected (Figure
7C). Indeed, only transfected human p21CIP1/WAF1 could be observed under these conditions. It was clear in cells transfected with
p21-WT that after a 24-hour incubation with 311 (25 ␮M), there
was a marked decrease in p21CIP1/WAF1 expression compared with
cells incubated with control medium (Figure 7C). Incubation of
these cells with MG132 alone led to a pronounced increase in
p21CIP1/WAF1 protein at 21 kDa and also the appearance of 2 higher
Mr bands at 38 and 44 kDa, consistent with the ubiquitinated
protein.39 Incubation of p21-WT transfected cells with 311 and
MG132 also led to a pronounced increase in p21CIP1/WAF1 and its
ubiquitinated products, although the intensity of these bands were
less than in the presence of MG132 alone. Hence, as shown in
Figure 7A, incubation with 311 and MG132 compared with 311
alone decreased the expression of p21CIP1/WAF1 and its ubiquitinated
forms. These data may suggest decreased p21CIP1/WAF1 ubiquitina-
tion during Fe depletion. However, this would not explain the
increased degradation of p21CIP1/WAF1 if the ubiquitin-mediated
pathway were involved. Alternatively, these observations are
consistent with a ubiquitin-independent process of p21CIP1/WAF1
degradation by the proteasome.
Considering these 2 possibilities, when 311 was incubated with
cells transfected with p21-K6R that cannot be ubiquitinated,39 there
was a decrease in p21CIP1/WAF1 relative to the untreated control,
indicating chelator treatment led to ubiquitin-independent degradation of p21CIP1/WAF1 (Figure 7C). Using these cells, incubation with
MG-132 led to a marked increase in p21CIP1/WAF1, but unlike cells
transfected with p21-WT, there was no evidence of high-Mr
ubiquitinated products. These results confirm that p21-K6R could
not be ubiquitinated, in agreement with previous studies.39 Incubation of p21-K6R–transfected cells with 311 and MG132 reduced
p21CIP1/WAF1 expression relative to MG132 alone, demonstrating
induction of ubiquitin-independent proteasomal degradation after
Fe depletion (Figure 7C).
Discussion
Despite the fact that Fe depletion induces a G1/S arrest20 and
apoptosis,67 it is surprising that little is known concerning the
role of Fe in cell-cycle regulation. Furthermore, it has become
clear that some Fe chelators show promising anticancer activity,
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
BLOOD, 15 JULY 2007 䡠 VOLUME 110, NUMBER 2
inducing cell-cycle arrest and apoptosis.2,5 However, the mechanisms involved in these effects remain uncertain and important
to investigate. The cdk inhibitor p21CIP1/WAF1 plays a key role in
regulating the cell cycle and inducing apoptosis36,68 and the
alteration of its expression after chelation could play important
roles in these processes.
For the first time, this study examines in detail the posttranscriptional regulation of p21CIP1/WAF1 after Fe depletion and has
demonstrated that its down-regulation is due to 2 mechanisms,
namely (1) inhibited translocation of p21CIP1/WAF1 mRNA from
the nucleus to the translational machinery in the cytosol, and
(2) the induction of a ubiquitin-independent mechanism of
proteasomal degradation. Considering these processes, the translocation of p21CIP1/WAF1 mRNA from the nucleus involves many
factors and proteins, such as the small GTPase Ran, which is
involved in regulating RNA nuclear export.69 At present, the
exact pathway Fe depletion affects to modulate p21CIP1/WAF1
mRNA export remains unknown. However, it is relevant to note
that the effect of Fe chelation on reducing p21CIP1/WAF1 mRNA
export does not appear to be a general response, as the mRNA
expression of other genes (eg, TfR1, Ndrg-1, and VEGF-1) are
increased under these conditions, leading to increased
translation.9,19,20
It was clear from in situ RT-PCR studies that while there was
decreased nuclear translocation of p21CIP1/WAF1 mRNA to the
cytosol comparing control and 311-treated cells (from 69% to
46%), this could not totally account for the decrease in p21CIP1/WAF1
expression. Indeed, a proteasome-mediated process was the major
mechanism involved in the reduction of p21CIP1/WAF1 protein after
Fe chelation. We suggest this because the Fe depletion–mediated
decrease in p21CIP1/WAF1 expression could be effectively rescued by
proteasomal inhibitors (Figures 5, 6B). Proteasomal-mediated
degradation of p21CIP1/WAF1 has been reported to occur via ubiquitindependent or -independent pathways, depending on the conditions.39,51-53 In this investigation, we showed that p21CIP1/WAF1
protein degradation after Fe depletion was via a ubiquitinindependent process, while in Fe-replete cells, a ubiquitindependent mechanism was responsible.
The induction of a ubiquitin-independent mechanism of proteasomal degradation was suggested by immunoprecipitation, where
p21CIP1/WAF1 ubiquitination was reduced in cells incubated with 311
and MG132 relative to cells incubated with MG132 alone
(Figure 7A). The implementation of 2 other models confirmed
this observation. First, using A31N-ts20 cells, 311 decreased
p21CIP1/WAF1 protein even when the ubiquitin-dependent pathway
was inhibited at 39°C (Figure 7B). Second, Fe depletion via 311
was able to down-regulate mutant p21CIP1/WAF1 (p21-K6R)
protein, which cannot not bind ubiquitin for degradation.39
Taken together, these results indicate chelator-mediated downregulation of p21CIP1/WAF1 was by the proteasome via a ubiquitinindependent process. This ubiquitin-independent pathway of
p21CIP1/WAF1 degradation may be mediated by NAD(P)H:quinoneoxidoreductase-170,71 or antizyme,72 which are responsible for
degradation of other proteins by this process.
Examination of Fe chelator–mediated down-regulation of
p21CIP1/WAF1 is important, as apart from being a cdk inhibitor31-33
and positive regulator of G1 phase progression,34,35 this molecule also has antiapoptotic activity.36,68 Considering the role of
p21CIP1/WAF1 in promoting G1 progression, this is due to its
ability to stabilize cyclin D1–cdk complexes.34 Since Fe chela-
IRON CHELATION AND p21CIP1/WAF1 EXPRESSION
759
tion decreases expression of both cyclin D120 and p21CIP1/WAF1,
this will prevent the formation of such complexes and promote
G1/S arrest. Regarding the additional role of p21CIP1/WAF1 in
apoptosis, it is known that high p21CIP1/WAF1 expression in some
cancers may provide a growth advantage capable of subverting
apoptosis induced by DNA-damaging chemotherapeutics.36 In
fact, by decreasing p21CIP1/WAF1 expression using antisense
oligonucleotides, cancer cell apoptosis can be induced.37,73
Hence, p21CIP1/WAF1 has been proposed as a target for developing
novel anticancer agents.36 Since Fe chelators effectively inhibit
p21CIP1/WAF1 expression, this is important for understanding their
marked antitumor activity10 and the ability to induce apoptosis.44,67 However, the effect of chelators at inhibiting cancer
proliferation and inducing apoptosis is probably due to effects
on multiple molecular targets (Figure 7D).9 These include, but
are not limited to, inhibition of the rate-limiting step of DNA
synthesis, ribonucleotide reductase,63,64 the capacity of Fe
depletion to decrease cyclin D1 expression,20 and the upregulation of the growth and metastasis suppressor Ndrg-1.19 In
fact, the existence of multiple targets of chelators that play key
roles in proliferation and inducing apoptosis may explain their
pronounced activity and ability to overcome resistance to
antitumor agents.10
It is of interest that up-regulation of p21CIP1/WAF1 mRNA but
down-regulation of its protein after Fe depletion are different to
the effects on its expression during cell-cycle arrest in response
to other conditions. For instance, previous studies showed that
p21CIP1/WAF1 mRNA and protein were up-regulated during cellcycle arrest,74-77 suggesting increased expression at the transcriptional and posttranscriptional levels. Moreover, in the current
study, G1/S arrest induced by FCS starvation caused downregulation of both p21CIP1/WAF1 mRNA and protein levels in
MCF-7 cells (data not shown). Collectively, these observations
indicate that the paradoxic chelator-mediated up-regulation of
p21CIP1/WAF1 mRNA and down-regulation of p21CIP1/WAF1 protein
is distinctive to Fe depletion. The mechanism responsible for the
transcriptional up-regulation of p21CIP1/WAF1 remains unclear
and beyond the scope of this study, although the existence of
redox-sensitive regulatory regions (eg, hypoxia-response element and AP2 and Sp1 DNA-binding sites) within its promoter
provides clues for further investigation.17
It is well known that cyclin D1 plays an important role in
G1/S progression78 and, like p21CIP1/WAF1, we have shown that it
was down-regulated after Fe chelation by the proteasome via a
ubiquitin-independent process.20 Thus, one could speculate that
Fe depletion may induce a ubiquitin-independent mechanism of
proteasomal degradation, leading to breakdown of select proteins signaling arrest and apoptosis.21 Why a ubiquitinindependent mechanism is used remains unclear at present, but
the existence of this pathway in addition to the well-known
ubiquitin-dependent mechanism could be important in terms of
controlling protein degradation. The ubiquitin-independent process does not appear to be a general response to Fe deprivation,
leading to the degradation of all proteins, as under these same
conditions, the expression of other Fe-regulated proteins is
increased.9,19,20 It is also relevant to discuss that a previous study
suggested cyclin D1 inhibited p21CIP1/WAF1 degradation by
competing for the binding site of proteasomes.49 Therefore,
cyclin D1 down-regulation after Fe depletion20 may contribute
to decreased p21CIP1/WAF1.
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
760
BLOOD, 15 JULY 2007 䡠 VOLUME 110, NUMBER 2
FU and RICHARDSON
In summary, Fe depletion significantly inhibited p21CIP1/WAF1
mRNA export from the nucleus and induced proteasomal degradation via a ubiquitin-independent mechanism. Together, these processes were responsible for decreasing p21CIP1/WAF1 protein expression in spite of increased p21CIP1/WAF1 mRNA. These results are
relevant to understanding the molecular alterations in G1/S arrest
during Fe deficiency and the mechanism of chelators at inducing
antiproliferative activity and apoptosis.
Acknowledgments
Dr Erika Becker, Dr David Lovejoy, Dr Robert Sutak, Dr Daniel
Vyoral, Ms Sarah Champion, Ms Danuta Kalinowski, Ms
Zaklina Kovacevic, Mr Yohan Suryo Rahmanto, and Ms Yu Yu
(Iron Metabolism and Chelation Program, Department of Pathol-
ogy) are thanked for their kind help in reviewing the paper prior
to submission.
This work was supported by a fellowship and grants from the
National Health and Medical Research Council (NHMRC) and
Australian Rotary Health Research Fund to D.R.R.
Authorship
Contribution: D.R.R. designed the study, obtained grant funding,
and wrote the manuscript. D.F. designed studies, wrote the paper,
and performed experiments.
Conflict-of-interest disclosure: The authors declare no competing financial interests.
Correspondence: D. R. Richardson, Department of Pathology,
University of Sydney, Sydney, New South Wales, 2006, Australia;
e-mail: [email protected].
References
1. Hershko C. Control of disease by selective iron
depletion: a novel therapeutic strategy utilizing
iron chelators. Baillieres Clin Haematol. 1994;7:
965-1000.
2. Buss JL, Torti FM, Torti SV. The role of iron chelation in cancer therapy. Curr Med Chem. 2003;10:
1021-1034.
3. Larrick JW, Cresswell P. Modulation of cell surface iron transferrin receptors by cellular density
and state of activation. J Supramol Struct. 1979;
11:579-586.
4. Sutherland R, Delia D, Schneider C, Newman R,
Kemshead J, Greaves M. Ubiquitous cell-surface
glycoprotein on tumor cells is proliferation-associated receptor for transferrin. Proc Natl Acad Sci
U S A. 1981;78:4515-4519.
5. Kalinowski DS, Richardson DR. The evolution of
iron chelators for the treatment of iron overload
disease and cancer. Pharmacol Rev. 2005;57:
547-583.
6. Richardson DR, Ponka P, Baker E. The effect of
the iron(III) chelator, desferrioxamine, on iron and
transferrin uptake by the human malignant melanoma cell. Cancer Res. 1994;54:685-689.
7. Donfrancesco A, Deb G, Dominici C, et al. Deferoxamine, cyclophosphamide, etoposide, carboplatin, and thiotepa (D-CECat): a new cytoreductive chelation-chemotherapy regimen in patients
with advanced neuroblastoma. Am J Clin Oncol.
1992;15:319-322.
8. Donfrancesco A, Deb G, Dominici C, Pileggi D,
Castello MA, Helson L. Effects of a single course
of deferoxamine in neuroblastoma patients. Cancer Res. 1990;50:4929-4930.
9. Richardson DR. Molecular mechanisms of iron
uptake by cells and the use of iron chelators for
the treatment of cancer. Curr Med Chem. 2005;
12:2711-2729.
10. Whitnall M, Howard J, Ponka P, Richardson DR.
A class of iron chelators with a wide spectrum of
potent antitumor activity that overcomes resistance to chemotherapeutics. Proc Natl Acad Sci
U S A. 2006;103:14901-14906.
11. Yuan J, Lovejoy DB, Richardson DR. Novel di-2pyridyl-derived iron chelators with marked and
selective antitumor activity: in vitro and in vivo
assessment. Blood. 2004;104:1450-1458.
12. Feun L, Modiano M, Lee K, et al. Phase I and
pharmacokinetic study of 3-aminopyridine-2carboxaldehyde thiosemicarbazone (3-AP) using
a single intravenous dose schedule. Cancer Chemother Pharmacol. 2002;50:223-229.
13. Finch RA, Liu M, Grill SP, et al. Triapine (3-aminopyridine-2-carboxaldehyde-thiosemicarbazone):
a potent inhibitor of ribonucleotide reductase ac-
tivity with broad spectrum antitumor activity. Biochem Pharmacol. 2000;59:983-991.
14. Torti SV, Torti FM, Whitman SP, Brechbiel MW,
Park G, Planalp RP. Tumor cell cytotoxicity of a
novel metal chelator. Blood. 1998;92:1384-1389.
15. Turner J, Koumenis C, Kute TE, et al. Tachpyridine, a metal chelator, induces G2 cell-cycle arrest, activates checkpoint kinases, and sensitizes
cells to ionizing radiation. Blood. 2005;106:31913199.
16. Greene BT, Thorburn J, Willingham MC, et al.
Activation of caspase pathways during iron
chelator-mediated apoptosis. J Biol Chem. 2002;
277:25568-25575.
17. Liang SX, Richardson DR. The effect of potent
iron chelators on the regulation of p53: examination of the expression, localization and DNA-binding activity of p53 and the transactivation of
WAF1. Carcinogenesis. 2003;24:1601-1614.
18. Le NT, Richardson DR. Potent iron chelators increase the mRNA levels of the universal cyclindependent kinase inhibitor p21(CIP1/WAF1), but
paradoxically inhibit its translation: a potential
mechanism of cell cycle dysregulation. Carcinogenesis. 2003;24:1045-1058.
19. Le NT, Richardson DR. Iron chelators with high
antiproliferative activity up-regulate the expression of a growth inhibitory and metastasis suppressor gene: a link between iron metabolism
and proliferation. Blood. 2004;104:2967-2975.
20. Nurtjahja-Tjendraputra E, Fu D, Phang JM, Richardson DR. Iron chelation regulates cyclin D1 expression via the proteasome: a link to iron deficiency-mediated growth suppression. Blood.
2007;109:4045-4054.
21. Gao J, Richardson DR. The potential of iron
chelators of the pyridoxal isonicotinoyl hydrazone
class as effective antiproliferative agents, IV: the
mechanisms involved in inhibiting cell-cycle progression. Blood. 2001;98:842-850.
22. Abeysinghe RD, Greene BT, Haynes R, et al.
p53-independent apoptosis mediated by tachpyridine, an anticancer iron chelator. Carcinogenesis.
2001;22:1607-1614.
Tsuruoka N, Gomi K. Iron deprivation results in an
increase in p53 expression. Biol Chem Hoppe
Seyler. 1995;376:627-630.
26. Sanchez M, Galy B, Dandekar T, et al. Iron regulation and the cell cycle: identification of an ironresponsive element in the 3⬘-untranslated region
of human cell division cycle 14A mRNA by a refined microarray-based screening strategy. J Biol
Chem. 2006;281:22865-22874.
27. Sherr CJ. G1 phase progression: cycling on cue.
Cell. 1994;79:551-555.
28. Lucas JJ, Terada N, Szepesi A, Gelfand EW.
Regulation of synthesis of p34cdc2 and its homologues and their relationship to p110Rb phosphorylation during cell cycle progression of normal human T cells. J Immunol. 1992;148:18041811.
29. Sherr CJ, Roberts JM. CDK inhibitors: positive
and negative regulators of G1-phase progression. Genes Dev. 1999;13:1501-1512.
30. Le NT, Richardson DR. The role of iron in cell
cycle progression and the proliferation of neoplastic cells. Biochim Biophys Acta. 2002;1603:
31-46.
31. Harper JW, Adami GR, Wei N, Keyomarsi K,
Elledge SJ. The p21 Cdk-interacting protein Cip
is a potent inhibitor of G1 cyclin-dependent kinase. Cell. 1993;75:805-881.
32. el-Deiry WS, Tokino T, Velculescu VE, et al.
WAF1, a potential mediator of p53 tumor suppression. Cell. 1993;75:817-825.
33. Xiong Y, Hannon GJ, Zhang H, Casso D, Kobayashi R, Beach D. p21 is a universal inhibitor of
cyclin kinases. Nature. 1993;366:701-704.
34. Cheng M, Olivier P, Diehl JA, et al. The p21(Cip1)
and p27(Kip1) CDK ‘inhibitors’ are essential activators of cyclin D-dependent kinases in murine
fibroblasts. EMBO J. 1999;18:1571-1583.
35. LaBaer J, Garrett MD, Stevenson LF, et al. New
functional activities for the p21 family of CDK inhibitors. Genes Dev. 1997;11:847-862.
36. Weiss RH. p21Waf1/Cip1 as a therapeutic target
in breast and other cancers. Cancer Cell. 2003;4:
425-429.
23. Kulp KS, Green SL, Vulliet PR. Iron deprivation
inhibits cyclin-dependent kinase activity and decreases cyclin D/CDK4 protein levels in asynchronous MDA-MB-453 human breast cancer
cells. Exp Cell Res. 1996;229:60-68.
37. Weiss RH, Marshall D, Howard L, Corbacho AM,
Cheung AT, Sawai ET. Suppression of breast cancer growth and angiogenesis by an antisense oligodeoxynucleotide to p21(Waf1/Cip1). Cancer
Lett. 2003;189:39-48.
24. Darnell G, Richardson DR. The potential of iron
chelators of the pyridoxal isonicotinoyl hydrazone
class as effective antiproliferative agents III: the
effect of the ligands on molecular targets involved
in proliferation. Blood. 1999;94:781-792.
38. Richardson DR, Bernhardt PV. Crystal and molecular structure of 2-hydroxy-1-naphthaldehyde
isonicotinoyl hydrazone (NIH) and its iron(III)
complex: an iron chelator with anti-tumour activity. J Biol Inorg Chem. 1999;4:266-273.
25. Fukuchi K, Tomoyasu S, Watanabe H, Kaetsu S,
39. Sheaff RJ, Singer JD, Swanger J, Smitherman M,
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
BLOOD, 15 JULY 2007 䡠 VOLUME 110, NUMBER 2
Roberts JM, Clurman BE. Proteasomal turnover
of p21Cip1 does not require p21Cip1 ubiquitination. Mol Cell. 2000;5:403-410.
40. Chowdary DR, Dermody JJ, Jha KK, Ozer HL.
Accumulation of p53 in a mutant cell line defective in the ubiquitin pathway. Mol Cell Biol. 1994;
14:1997-2003.
IRON CHELATION AND p21CIP1/WAF1 EXPRESSION
52. Chen X, Chi Y, Bloecher A, Aebersold R, Clurman
BE, Roberts JM. N-acetylation and ubiquitin-independent proteasomal degradation of p21(Cip1).
Mol Cell. 2004;16:839-847.
53. Bloom J, Pagano M. To be or not to be ubiquitinated? Cell Cycle. 2004;3:138-140.
41. Nuovo GJ. Detection of viral infections by in situ
PCR: theoretical considerations and possible
value in diagnostic pathology. J Clin Lab Anal.
1996;10:335-349.
54. Lee DH, Goldberg AL. Proteasome inhibitors
cause induction of heat shock proteins and trehalose, which together confer thermotolerance in
Saccharomyces cerevisiae. Mol Cell Biol. 1998;
18:30-38.
42. Nuovo GJ. Co-labeling using in situ PCR: a review. J Histochem Cytochem. 2001;49:13291339.
55. Lee DH, Goldberg AL. Proteasome inhibitors:
valuable new tools for cell biologists. Trends Cell
Biol. 1998;8:397-403.
43. Huang JW, Shiau CW, Yang YT, et al. Peroxisome proliferator-activated receptor gammaindependent ablation of cyclin D1 by thiazolidinediones and their derivatives in breast cancer
cells. Mol Pharmacol. 2005;67:1342-1348.
56. Luo H, Zhang J, Dastvan F, et al. Ubiquitin-dependent proteolysis of cyclin D1 is associated
with coxsackievirus-induced cell growth arrest.
J Virol. 2003;77:1-9.
44. Richardson DR, Milnes K. The potential of iron
chelators of the pyridoxal isonicotinoyl hydrazone
class as effective antiproliferative agents, II: the
mechanism of action of ligands derived from
salicylaldehyde benzoyl hydrazone and 2-hydroxy-1-naphthylaldehyde benzoyl hydrazone.
Blood. 1997;89:3025-3038.
45. Richardson DR, Tran EH, Ponka P. The potential
of iron chelators of the pyridoxal isonicotinoyl hydrazone class as effective anti-proliferative
agents. Blood. 1995;86:4295-4306.
46. Chaston TB, Lovejoy DB, Watts RN, Richardson
DR. Examination of the antiproliferative activity of
iron chelators: multiple cellular targets and the
different mechanism of action of triapine compared with desferrioxamine and the potent pyridoxal isonicotinoyl hydrazone analogue 311. Clin
Cancer Res. 2003;9:402-414.
47. Ashcroft M, Taya Y, Vousden KH. Stress signals
utilize multiple pathways to stabilize p53. Mol Cell
Biol. 2000;20:3224-3233.
48. Carlson B, Lahusenm T, Singh S, et al. Downregulation of cyclin D1 by transcriptional repression in MCF-7 human breast carcinoma cells induced by flavopiridol. Cancer Res. 1999;59:46344641.
49. Coleman ML, Marshall CJ, Olson MF. Ras promotes p21(Waf1/Cip1) protein stability via a cyclin D1-imposed block in proteasome-mediated
degradation. EMBO J. 2003;22:2036-2046.
50. Fernandes ER, Zhang JY, Rooney RJ. Adenovirus E1A-regulated transcription factor p120E4F
inhibits cell growth and induces the stabilization
of the cdk inhibitor p21WAF1. Mol Cell Biol. 1998;
18:459-467.
51. Bendjennat M, Boulaire J, Jascur T, et al. UV irradiation triggers ubiquitin-dependent degradation
of p21(WAF1) to promote DNA repair. Cell. 2003;
114:599-610.
66.
67.
68.
69.
70.
57. Massey AC, Kaushik S, Sovak G, Kiffin R, Cuervo
AM. Consequences of the selective blockage of
chaperone-mediated autophagy. Proc Natl Acad
Sci U S A. 2006;103:5805-5810.
58. Massey AC, Zhang C, Cuervo AM. Chaperonemediated autophagy in aging and disease. Curr
Top Dev Biol. 2006;73:205-235.
59. Morgan EH. Inhibition of reticulocyte iron uptake
by NH4Cl and CH3NH2. Biochim Biophys Acta.
1981;642:119-134.
60. Iacopetta BJ, Morgan EH. The kinetics of transferrin endocytosis and iron uptake from transferrin in rabbit reticulocytes. J Biol Chem. 1983;
258:9108-9115.
61. Paterson S, Armstrong NJ, Iacopetta BJ, McArdle
HJ, Morgan EH. Intravesicular pH and iron uptake by immature erythroid cells. J Cell Physiol.
1984;120:225-232.
62. Salvat C, Acquaviva C, Scheffner M, Robbins I,
Piechaczyk M, Jariel-Encontre I. Molecular characterization of the thermosensitive E1 ubiquitinactivating enzyme cell mutant A31N-ts20: requirements upon different levels of E1 for the
ubiquitination/degradation of the various protein
substrates in vivo. Eur J Biochem. 2000;267:
3712-3722.
63. Green DA, Antholine WE, Wong SJ, Richardson
DR, Chitambar CR. Inhibition of malignant cell
growth by 311, a novel iron chelator of the pyridoxal isonicotinoyl hydrazone class: effect on the
R2 subunit of ribonucleotide reductase. Clin Cancer Res. 2001;7:3574-3579.
64. Nyholm S, Mann GJ, Johansson AG, Bergeron
RJ, Graslund A, Thelander L. Role of ribonucleotide reductase in inhibition of mammalian cell
growth by potent iron chelators. J Biol Chem.
1993;268:26200-26205.
65. Chong TW, Horwitz LD, Moore JW, Sowter HM,
Harris AL. A mycobacterial iron chelator, desferri-
71.
72.
73.
74.
75.
76.
77.
78.
761
exochelin, induces hypoxia-inducible factors 1
and 2, NIP3, and vascular endothelial growth factor in cancer cell lines. Cancer Res. 2002;62:
6924-6927.
Bao W, Thullberg M, Zhang H, Onischenko A,
Stromblad S. Cell attachment to the extracellular
matrix induces proteasomal degradation of
p21(CIP1) via Cdc42/Rac1 signaling. Mol Cell
Biol. 2002;22:4587-4597.
Hileti D, Panayiotidis P, Hoffbrand AV. Iron chelators induce apoptosis in proliferating cells. Br J
Haematol. 1995;89:181-187.
Janicke RU, Sohn D, Essmann F, Schulze-Osthoff K. The multiple battles fought by anti-apoptotic p21. Cell Cycle. 2007;6:407-413.
Zenklusen D, Stutz F. Nuclear export of mRNA.
FEBS Lett. 2001;498:150-156.
Tsvetkov P, Asher G, Reiss V, Shaul Y, Sachs L,
Lotem J. Inhibition of NAD(P)H:quinone oxidoreductase 1 activity and induction of p53 degradation by the natural phenolic compound curcumin. Proc Natl Acad Sci U S A. 2005;102:55355540.
Asher G, Bercovich Z, Tsvetkov P, Shaul Y, Kahana C. 20S proteasomal degradation of ornithine decarboxylase is regulated by NQO1. Mol
Cell. 2005;17:645-655.
Murakami Y, Matsufuji S, Kameji T, et al. Ornithine decarboxylase is degraded by the 26S proteasome without ubiquitination. Nature. 1992;
360:597-599.
Fan Y, Borowsky AD, Weiss RH. An antisense
oligodeoxynucleotide to p21(Waf1/Cip1) causes
apoptosis in human breast cancer cells. Mol Cancer Ther. 2003;2:773-782.
Abramova MV, Pospelova TV, Nikulenkov FP,
Hollander CM, Fornace AJ Jr, Pospelov VA. G1/S
arrest induced by histone deacetylase inhibitor
sodium butyrate in E1A ⫹ Ras-transformed cells
is mediated through down-regulation of E2F activity and stabilization of beta-catenin. J Biol
Chem. 2006;281:21040-21051.
Sullivan GF, Yang JM, Vassil A, Yang J, BashBabula J, Hait WN. Regulation of expression of
the multidrug resistance protein MRP1 by p53 in
human prostate cancer cells. J Clin Invest. 2000;
105:1261-1267.
Tu Y, Wu W, Wu T, et al. Antiproliferative autoantigen CDA1 transcriptionally upregulates p21Wafl/
Cip1 by activating p53 and MEK/ERK1/2 MAPK
pathways. J Biol Chem. 2007;282:11722-11731.
Hsu YF, Lee TS, Lin SY, et al. Involvement of
Ras/Raf-1/ERK actions in the magnolol-induced
upregulation of p21 and cell-cycle arrest in colon
cancer cells. Mol Carcinog. 2007;46:275-283.
Fu M, Wang C, Li Z, Sakamaki T, Pestell RG. Minireview: Cyclin D1: normal and abnormal functions. Endocrinology. 2004;145:5439-5447.
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
2007 110: 752-761
doi:10.1182/blood-2007-03-076737 originally published
online April 11, 2007
Iron chelation and regulation of the cell cycle: 2 mechanisms of
posttranscriptional regulation of the universal cyclin-dependent kinase
inhibitor p21CIP1/WAF1 by iron depletion
Dong Fu and Des R. Richardson
Updated information and services can be found at:
http://www.bloodjournal.org/content/110/2/752.full.html
Articles on similar topics can be found in the following Blood collections
Cell Cycle (231 articles)
Free Research Articles (4545 articles)
Gene Expression (1086 articles)
Red Cells (1159 articles)
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society
of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.