From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
HEMATOPOIESIS
Constitutive mutants of the GM-CSF receptor reveal multiple pathways leading to
myeloid cell survival, proliferation, and granulocyte-macrophage differentiation
Anna L. Brown, Michelle Peters, Richard J. D’Andrea, and Thomas J. Gonda
Activation of the granulocyte-macrophage
colony-stimulating factor (GM-CSF) family of receptors promotes the survival,
proliferation, and differentiation of cells
of the myeloid compartment. Several signaling pathways are activated downstream of the receptor, however it is not
clear how these induce specific biologic
outcomes. We have previously identified
2 classes of constitutively active mutants
of the shared signaling subunit, human
(h) ␤c, of the human GM-CSF/interleukin-3 (IL-3)/IL-5 receptors that exhibit dif-
ferent modes of signaling. In a factordependent bipotential myeloid cell line,
FDB1, an activated mutant containing a
substitution in the transmembrane domain (V449E) induces factor-independent
proliferation and survival, while mutants
in the extracellular domain induce factorindependent granulocyte-macrophage differentiation. Here we have used further
mutational analysis to demonstrate that
there are nonredundant functions for several regions of the cytoplasmic domain
with regard to mediating proliferation,
viability, and differentiation, which have
not been revealed by previous studies
with the wild-type GM-CSF receptor. This
unique lack of redundancy has revealed
an association of a conserved membraneproximal region with viability signaling
and a critical but distinct role for tyrosine
577 in the activities of each class of
mutant. (Blood. 2004;103:507-516)
© 2004 by The American Society of Hematology
Introduction
Interleukin 3 (IL-3), IL-5, and granulocyte-macrophage colonystimulating factor (GM-CSF) are cytokines that affect the survival,
growth, and differentiation of multiple cell lineages within the
hematopoietic system. The functions of these factors are mediated
by high-affinity membrane-bound receptors that are composed of
specific ligand-binding subunits (␣) and a common signal transducing subunit (␤c).1-3 Several regions and motifs within human (h) ␤c
have been identified that contribute to particular signaling pathways and biologic effects. The results of these studies have been
previously reviewed,4,5 but some key observations are briefly
summarized here. The membrane proximal region of the h␤c
contains conserved motifs including Box 1, which is essential for
activation of Janus kinase 2 (JAK2) and induction of c-myc, events
that are necessary for induction of proliferation and antiapoptotic
effects of the activated receptor.6-9 Another conserved membrane
proximal motif, Box 2, appears to make subtle contributions to
long-term proliferation and c-fos promoter activation,7,8,10 however
its specific mode of action in receptor signaling remains enigmatic.
In addition, it is clear that phosphorylated tyrosine and serine
residues are necessary for the association and activation of
particular signaling molecules and pathways from the receptor.11-14
As well as uncovering specificity in the binding of particular
adaptor and signaling molecules, mutational analysis has also
demonstrated that considerable redundancy exists in the activation
of signaling pathways from the GM-CSF receptor. For example,
activation of the Ras/Map kinase (MAPK) pathway can be
mediated through multiple tyrosine residues,8,15 as can activation of
signal transducers and activators of transcription (STATs).12 The
phosphatidylinositol 3-kinase (PI3-K)/Akt pathway can also be
activated via multiple means: through an interaction of Ser585 and
the 14-3-3 adaptor protein, through Tyr577 via Shc, and through
Tyr612 via Src homology 2 domain–containing protein tyrosine
phosphatase-2 (SHP2).15-17 Such redundancy of activation has
made it difficult to assign particular signaling pathways to biologic
outcomes. This is particularly true when considering the question
of specificity of signaling from the GM-CSF and IL-3 receptors.
These receptors share a common ␤ subunit, and presumably
activate common signaling pathways, yet are able to elicit the
distinct biologic responses of differentiation and proliferation,
respectively, in a number of myeloid cell lines.18,19 Clearly the
cytokine-specific ␣ subunits are excellent candidates for contributing, at least partially, to signaling specificity. This has been
demonstrated by experiments that swapped either part or all of the
cytoplasmic domains of the GM-CSF and IL-3 ␣ subunits.19,20
However no distinct signaling events have yet been associated with
these differential responses. The role of the common ␤ subunit in
mediating differentiative signaling has also been addressed. Expression of the human GM-CSF receptor complex (hGMR) in the M1,
WEHI-3B D⫹, and WT19 cell lines induced macrophage differentiation in response to ligand.21,22 While regions of the h␤c
From the Hanson Institute, Institute of Medical and Veterinary Science,
Adelaide, Australia.
Australia, and R.J.D. was a Henley Properties Principal Research Fellow and is
currently a Peter Nelson Leukaemia Research Fellow of the Cancer Council of
South Australia.
Submitted May 7, 2003; accepted August 28, 2003. Prepublished online as
Blood First Edition Paper, September 22, 2003; DOI 10.1182/blood-2003-051435.
R.J.D. and T.J.G. contributed equally to this work.
Supported by research grants from the National Heart, Lung, and Blood
Institute of the National Institutes of Health (R.J.D. and T.J.G.) and the National
Health and Medical Research Council of Australia (T.J.G.). T.J.G. was a Senior
Research Fellow of the National Health and Medical Research Council of
BLOOD, 15 JANUARY 2004 䡠 VOLUME 103, NUMBER 2
Reprints: Richard D’Andrea, Child Health Research Institute, 72 King William
Rd, North Adelaide, South Australia, 5006 Australia; e-mail: richard.
[email protected].
The publication costs of this article were defrayed in part by page charge
payment. Therefore, and solely to indicate this fact, this article is hereby
marked ‘‘advertisement’’ in accordance with 18 U.S.C. section 1734.
© 2004 by The American Society of Hematology
507
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
508
BLOOD, 15 JANUARY 2004 䡠 VOLUME 103, NUMBER 2
BROWN et al
cytoplasmic domain were associated with particular aspects of
differentiation, the regions required varied between the different
cell lines.21,22 In addition, in WT19 cells, at least 2 redundant
pathways signaling for macrophage differentiation from the h␤c
were detected.22 Thus studies aimed at addressing the mechanisms
by which the IL-3/GM-CSF receptors induce proliferation and
differentiation are still limited by the redundancy of signals that
lead to common biologic outcomes. Moreover some of these cell
lines show only limited cytokine requirements, for example M1
and WEHI-3B D⫹ cells, unlike normal myeloid progenitors, do not
require cytokines for survival or growth.
We have addressed these questions here by developing a model
system that uses activated mutants of the GM-CSF receptor in
combination with a unique bipotential myeloid cell line (below).
Previously, we have isolated several activated mutants of the h␤c
that are capable of stimulating factor-independent growth in a
number of hematopoietic cell lines.23 Several of these mutants
contain amino acid substitutions in the membrane-proximal extracellular (EC) domain of h␤c, the best characterized being I374N
(containing an isoleucine to asparagine substitution at position
374),24 and FI⌬ (which contains a 37 amino acid duplication and
exhibits similar properties).25 Another class of mutants (represented by the V449E valine to glutamic acid substitution) contains
activating transmembrane (TM) substitutions.24
The EC and TM mutants were all isolated on the basis of their ability
to confer factor-independent proliferation on FDC-P1 cells; however
they clearly signal by distinct mechanisms and most likely activate
overlapping signaling pathways that are a subset of those activated by
the ligand-bound complex.26 Most notably there are obvious differences
in receptor tyrosine phosphorylation and the phosphorylation of the
adapter protein Shc, while no difference has been observed in phosphorylation of JAK2, extracellular signal-related kinase 1 (ERK1) and
ERK2, or Akt, or with regard to STAT5 activation (Jenkins et al27; and T.
Blake and T.J.G., unpublished data, October 1998).
Functional differences between the EC and TM activated
mutants are clearly apparent in a novel murine hematopoietic cell
line, FDB1.18 These cells are strictly factor-dependent for survival
and proliferate continuously in the presence of IL-3, while in the
presence of GM-CSF they undergo complete differentiation along
the granulocyte and monocyte lineages. Importantly, IL-3 is
“dominant” over GM-CSF as cells continue to proliferate without
differentiation in a mixture of these 2 cytokines. FDB1 cells thus
constitute a unique model of myeloid differentiation that permits
dissection and association of signaling pathways contributing to
myeloid cell proliferation, survival, and differentiation. Importantly, FDB1 cells also have differential responses to signaling via
the 2 classes of activated mutants. When the EC mutants (FI⌬ and
I374N) are expressed in this cell line in the absence of growth
factor, they deliver a differentiation signal (similar to GM-CSF),
whereas the TM mutant, V449E, induces continuous factorindependent proliferation.18 This ability to mimic the cellular
signaling outcomes of GM-CSF and IL-3 while triggering a
reduced set of signaling events led us to propose that it would be
possible to use these activated receptor mutants to associate
receptor-associated events with particular cellular outcomes.
Materials and methods
Cytokines and antibodies
Recombinant murine (m) IL-3 and GM-CSF were produced from baculovirus vectors supplied by Dr Andrew Hapel (John Curtin School of Medical
Research, Canberra, Australia). The anti-ERK1/2 and anti–phospho ERK1/2
antibodies were purchased from Cell Signaling Technology (Beverly, MA).
Cell lines
␺2 producer cells transfected with retrovirus-containing receptor constructs
were maintained as described previously.24 HEK 293T cells were maintained in Dulbecco modified Eagle medium supplemented with 10% fetal
bovine serum. FDB1 cells were maintained as described previously.18
Infected pools were maintained as described plus 1 ␮g/mL Puromycin
(Sigma, St Louis, MO).
Construction of retroviral expression plasmids
The N⬘ fludarabine, cytarabine, and G-CSF (FLAG)–tagged full-length
h␤c, V449E, and FI⌬ cDNAs in pRufPuro have been described previously.18 Cytoplasmic domain deletions were constructed by polymerase
chain reaction (PCR) using the full-length clones as a template. All PCR
products were generated by using common 5⬘ primer containing a BamHI
site (5⬘ATCGGATCCGCCTGCCTGTCCAGAGC3⬘) and specific 3⬘ primers containing a stop codon and an EcoRI site as follows: 763 (5⬘CGGAATTCATGACCTGGGGGACCG3⬘); 626-(5⬘CGGAATTCACAGAGGGACCAGTTGCAC3⬘); 544 (5⬘CGGAATTCAATCTGAGG-CAGCTGGAGT3⬘); 517 (5⬘CGGAATTCACTCGCTGTCCCCGAATC3⬘). The tyrosine mutant h␤c cDNAs (Y8F, Y577F, and Y612F) have been described
previously28 and were a gift from Dr James Griffin (Dana-Farber Cancer
Institute, Boston, MA). The cytoplasmic domains of the h␤c containing the
Y8F, Y577F, and Y612F mutations were each amplified using the primers
5⬘ (5⬘GCGATACGAACACATAGACC3⬘) and 3⬘ (5⬘CGGAATTCAACACACCTCC-CCAGG3⬘). The PCR products were restricted with FspI and
EcoRI. Full-length V449E or FI⌬ mutants in pRufPuro were digested with
SnaBI and EcoRI to remove the cytoplasmic domain. These were then
ligated to the digested Tyr mutant cytoplasmic domain PCR products to
create V449E and FI⌬ Tyr mutant constructs. Double tyrosine mutant
cDNAs (Y577F/Y612F) were created by site-directed mutagenesis of
Y612F cDNAs using the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA) using the 5⬘ primer (5⬘ GACTTCAATGGGCCCTTCCTAGGGCCGCCCCACAGC3⬘) and the 3⬘ primer (5⬘ GCTGTGGGGCGGCCCTAGGAAGGGCCCATTGAAGTC3⬘).
Transfection and infection
To make stable ␺2 producer cell lines, 30 ␮g retroviral construct was
electroporated into 107 cells at 270V/975 ␮F with a Biorad Gene Pulser II
(Hercules, CA). After overnight recovery, cells were selected with 4 ␮g/mL
Puromycin (Sigma). To make transient viral producer lines, equal amounts
of pEQEco ecotropic packaging vector (a gift from Dr Elio Vanin, St Jude
Children’s Research Hospital, Memphis, TN)29 and retroviral constructs
were transfected into HEK 293T cells using Lipofectamine Plus Reagent
per the manufacturer’s instructions (Invitrogen Life Technologies, Carlsbad, CA). FDB1 cells were infected either by stable or transient viral
producers as previously described.18 Cells were assessed for receptor cell
surface expression by staining with a murine anti-FLAG antibody (Sigma)
followed by an antimouse fluorescein isothiocyanate–conjugated antibody
(Silenus, Hawthorn, Victoria, Australia) and analyzed by flow cytometry
with the use of an Epics-Profile II analyzer (Coulter Electronics, Hialeah,
FL). If necessary, cells were sorted for expression as previously described.24
Cell proliferation assays, viability assays,
and differentiation assays
Cells were washed 3 times in Iscoves modified Dulbecco medium and
cultured in 500 U/mL mIL-3 or mGM-CSF, or without factor. Cells were
seeded at 5000/well in 96-well flat-bottom plates. Growth was assessed
using CellTiter 96 Aqeous One Solution Cell Proliferation Assay per the
manufacturer’s instructions (Promega, Madison, WI). To assess differentiation, cells were cytocentrifuged and Jenner-Giemsa stained, and the
proportion of differentiated cells was determined microscopically. To assess
cell viability, the percentage of cells excluding trypan blue was determined
microscopically using a hemocytometer.
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
BLOOD, 15 JANUARY 2004 䡠 VOLUME 103, NUMBER 2
CONSTITUTIVE GM-CSF RECEPTOR SIGNALING
Western blot analysis
107
For preparation of lysates for phospho-ERK analysis,
cells were
initially starved for 6 hours in growth media without cytokine. Cells were
left unstimulated or stimulated with 1000 bone marrow (BM) units/mL
murine IL-3 for 5 minutes. Lysates were prepared and Western blot analysis
was performed as described previously.27
Results
Construction of C-terminal truncations of the human ␤c
activated mutants
To examine functional regions of h␤c necessary for inducing
proliferative and differentiative signals we initially constructed a
series of V449E and FI⌬ mutants with sequential deletions of the
cytoplasmic domain (Figure 1). Each was epitope-tagged at the
N-terminus with the FLAG peptide to facilitate detection in the
FDB1 cells. The numbering system that refers to the activated point
mutation (V449E) includes the leader sequence of the h␤c as in our
previous publications; however, to maintain consistency with other
studies that have used cytoplasmic truncations,10,30,31 our numbering system for truncations and cytoplasmic tyrosines does not
include the leader sequence.
Ability of the V449E truncation mutants to induce
factor-independent proliferation
Pools of cells expressing full-length V449E and each of the 4
V449E cytoplasmic truncations were generated by retroviral infection. In all cases, expression by pools of infected cells was
509
confirmed by flow cytometry (as shown in Figure 2A) and Western
analysis (data not shown). As observed previously,18 full-length
V449E generates a strong proliferative signal such that cells were
able to proliferate without factor in a manner similar to cells in IL-3
(Figure 2B). Cells expressing each truncation mutant were compared with the full-length V449E in at least 3 independent
experiments; representative results are shown in Figure 2B.
Truncation of the cytoplasmic domain of the V449E mutant to
amino acids 763 or 626 did not affect its ability to confer
factor-independent proliferation on FDB1 cells when compared
with the full-length V449E (Figure 2B). Not unexpectedly, these
truncations were also able to maintain full cellular viability over a
5-day period in the absence of factor (Figure 2C). These results
indicate that the residues distal of 626 are dispensable for
proliferative and survival signals generated by this factorindependent mutant. In contrast, growth and viability were clearly
affected by truncating the V449E cytoplasmic domain to amino
acid 544. Factor-independent growth was abolished, however a
substantial proportion of the cells were still viable, at day 5 without
factor (Figure 2C). A further truncation of V449E to residue 517
completely abolished the ability of cells expressing this mutant to
maintain growth or viability without factor (Figure 2B-C). These
results indicate that an essential proliferation signal generated by
V449E originates from the domain between amino acids 545 and
626 and that a viability signal emanates from the region between
amino acids 518 and 544.
Differentiation of factor-independent cells expressing V449E
C-terminal truncations
As FDB1 cells are capable of granulocyte-macrophage differentiation, we examined the morphology of factor-independent cells
expressing the V449E truncations to see if altered signaling by
these mutants was affecting the differentiation state of the cells.
Control FDB1 cells (expressing only wild-type [wt] ␤c) were
cultured in either mIL-3 or mGM-CSF for 5 days as a comparison.
As expected, parental FDB1 cells cultured in mIL-3 were undifferentiated and those cultured in mGM-CSF, at day 5, had differentiated into neutrophils and macrophages (Figure 3A-B). At day 5 of
culture without factor, cells expressing full-length V449E and the
763 and 626 truncations were also undifferentiated. This is
consistent with the ability of these truncations to mediate factorindependent proliferation and viability. In contrast, cells expressing
the V449E 544 truncation displayed increased differentiation along
the monocyte/macrophage lineage, revealing the presence of a
signal from the 545-626 region that is suppressing macrophage
differentiation.
Tyrosine 577 is essential for proliferation of the V449E mutant
but not for survival
Figure 1. Schematic representation of the h␤c. The positions of the activated
mutants and the 6 distal cytoplasmic tyrosine residues are indicated. The cytoplasmic
truncations, made in combination with each of the V449E and FI⌬ activated mutants,
are depicted relative to the full-length cytoplasmic domain.
To further delineate the signaling events evoked by the V449E
mutant we next examined the importance of tyrosine residues in the
cytoplasmic region. To this end, we constructed a mutant where all
6 distal cytoplasmic tyrosine residues were replaced with phenylalanine (Y6F; see Figure 1 for positions of tyrosines). In addition,
because we had found that the 544-626 cytoplasmic region of
V449E is important for proliferation and suppression of differentiation, we constructed mutants that replaced either or both of the 2
tyrosine residues in this region singly or together with phenylalanine (Y577F, Y612F, and Y2F, respectively).
Since we previously reported that the V449E activated mutant
exhibits constitutive tyrosine phosphorylation in FDC-P1 cells,27
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
510
BROWN et al
BLOOD, 15 JANUARY 2004 䡠 VOLUME 103, NUMBER 2
Figure 2. Effect of V449E cytoplasmic truncations on
factor-independent growth and viability. (A) Cell surface expression of the indicated FLAG-tagged h␤c proteins on FDB1 cells expressing cytoplasmic truncations
of the V449E activated mutant. Infected cells (solid lines)
were stained with an anti-FLAG monoclonal antibody and
compared with identically stained uninfected cells (dotted
lines). (B) Proliferation of FDB1 cells expressing cytoplasmic truncations of the V449E activated mutant. Growth
without factor (NF indicates no factor) (diamonds) is
shown compared with growth with the control cytokine
IL-3 (squares). Results representative of at least 3
independent experiments are shown. Error bars indicate
the SD of triplicate samples. (C) Viability of cells without
factor at day 5 after factor withdrawal. Cell viability was
determined by trypan blue exclusion, and the combined
results of at least 3 independent experiments are shown.
Error bars represent the SD of at least 3 independent
experiments.
we predicted that at least some tyrosine residues may be important
for its activity. This was confirmed by the inability of V449E Y6F
to confer factor-independent proliferation on FDB1 cells and a
marked reduction in its ability to sustain viability without factor at
day 5 (Figure 4A-B). Mutation of tyrosine 577 to phenylalanine
abolished the ability of V449E to proliferate without factor,
consistent with a major proliferative signal emanating from this
tyrosine residue (Figure 4A). Interestingly, however, this mutation
was able to separate factor-independent proliferation from viability,
as there was no reduction in viability at day 5 (Figure 4B).
Mutation of tyrosine 612 did not have a measurable effect on
proliferation or viability (Figure 4A-B), and, not surprisingly,
mutation of both tyrosines together (Y2F) gave a phenotype
identical to that observed for Y577F alone (Figure 4A-B). To
determine whether the effects of Tyr577 in V449E were transduced
by ERK 1/2 kinases, we performed phospho-ERK Western blots of
lysates from the mutant cell lines (Figure 4C). V449E was able to
constitutively activate ERK 1/2, however mutation of Tyr577 alone
or Tyr577 and Tyr612 together (Y2F) did not abolish this activation. In contrast, removal of the 6 distal tyrosines by mutation
(Y6F) or truncation (V449E 544) severely reduced constitutive
ERK 1/2 activation. Stimulation of cells with mIL-3 was able to
induce equal amounts of phospho-ERK 1/2 in all the cell lines,
indicating that there was no intrinsic defect in this signaling
pathway in any of the cells examined (data not shown).
Morphology of factor-independent cells expressing V449E
cytoplasmic tyrosine mutants
We next assessed the effects of V449E cytoplasmic tyrosine
mutants on the differentiation of FDB1 cells (Figure 5). Cells
expressing the Y6F mutant (which has only 20% viability at day 5)
had the morphologic appearance of macrophages with the presence
of very few undifferentiated cells. Thus, in the absence of major
proliferation and survival signaling macrophages are the predominant remaining cell type. Cells expressing the Y577F mutant,
which do not proliferate but retain viability, interestingly showed a
small increase in the number of macrophages compared with
parental V449E (Figure 5A-B). As was seen with factorindependent viability and proliferation, the Y612F mutant had no
effect on V449E suppression of differentiation (Figure 5A-B).
However, mutation of tyrosines 577 and 612 together (in the Y2F
mutant) resulted in a marked shift from the blast cell phenotype to
macrophages, considerably more than observed by mutating Tyr577
alone (Figure 5A-B). Thus, Tyr612 and Tyr577 may each contribute to a signal that suppresses differentiation.
These experiments show that there are both tyrosine-dependent
and -independent viability signals generated by V449E. Importantly we have also shown that Tyr577 is specifically required for
factor-independent proliferation and that multiple tyrosines contribute to a signal that suppresses differentiation of the FDB1 cell line.
Next, we wished to compare these results with those obtained using
corresponding second site mutants of FI⌬, which induces factorindependent granulocyte-macrophage differentiation, rather than
continued factor-independent proliferation.
Function of the FI⌬ cytoplasmic deletion mutants in
factor-independent proliferation
Pools of infected cells expressing each of the 4 cytoplasmic FI⌬
truncations were cultured in the absence of factor and assays were
performed to proliferation and viability. As previously reported,18 no
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
BLOOD, 15 JANUARY 2004 䡠 VOLUME 103, NUMBER 2
CONSTITUTIVE GM-CSF RECEPTOR SIGNALING
511
region.21 The survival advantage of the FI⌬ 763 truncation was not seen
in the cells expressing the FI⌬ 626 truncation, which behaved similarly
to cells expressing the full-length FI⌬ mutant (Figure 6A-B). In contrast,
cells expressing FI⌬ truncated to amino acid 544 lost all ability to
maintain viability without factor as did cells expressing FI⌬ 517. Thus in
the FI⌬ mutant, a major survival signal originates from the region
between amino acids 545 and 626. The tyrosine-independent
survival signal originating from between residues 518 and 544
of the V449E mutant is not generated by the FI⌬ activated
mutant, consistent with different modes of signaling for the EC
and TM classes of mutants.
Differentiation of factor-independent cells expressing FI⌬
cytoplasmic truncations
Figure 3. Morphology of cells expressing C-terminal truncations of the V449E
activated mutant. (A) Control cells (expressing wt h␤c) were cultured in the indicated
growth factors for 5 days. Cells expressing truncations of the activated mutant were
cultured in the absence of growth factor for 5 days. At day 5, cells were cytocentrifuged to
assess morphology. Original magnification, ⫻ 400. (B) Differential counts from cytospins
done at day 5. For each sample, 200 cells were scored microscopically for morphology. The
combined data from a minimum of 3 independent experiments are shown. The standard
error of the mean was less than 10% for all samples.
significant proliferation was seen without factor in cells expressing the
full-length FI⌬ mutation (Figure 6A). In contrast, cells expressing the
FI⌬ 763 truncation appeared to be capable of some expansion without
factor (Figure 6A) associated with improved viability over a 5-day
period (Figure 6B). This may be due to the removal of a negative
regulatory domain that has been previously reported to be in this
Figure 4. Effects of V449E cytoplasmic tyrosine
mutants on factor-independent growth and viability.
(A) Growth without factor (diamonds) is shown compared
with growth with the control cytokine IL-3 (squares).
Results representative of at least 3 independent experiments are shown. Error bars represent the SD of triplicate samples. (B) Viability of cells without factor at day 5
after factor withdrawal. Cell viability was determined by
trypan blue exclusion, and the combined results of at
least 3 independent experiments are shown. Error bars
represent the SD of at least 3 independent experiments.
(C) Constitutive activation of ERK1/2. Lysates were
made from FDB1 cells expressing mutant receptors and
were blotted for phospho-ERK1/2 and total ERK1/2 as
described in “Materials and methods.”
We next examined the morphology of cells expressing the Cterminal truncations after 5 days without factor. As expected, the
full-length FI⌬ mutant could induce the differentiation of FDB1
cells to both granulocytes and macrophages (Figure 7A-B). A slight
increase in the number of undifferentiated cells at day 5 was
observed with the FI⌬ 763 expressing cells compared with those
expressing full-length FI⌬. Cells expressing FI⌬ 626 behaved
similarly to full-length FI⌬, differentiating completely by day 5;
however the cells showed a bias toward granulocytic differentiation at this time point (Figure 7B). In contrast, the lack of viable
factor-independent cells expressing FI⌬ 544 shows that survival of
cells expressing FI⌬ is strictly dependent on the 544-626 region.
We cannot rule out that a similar survival signal emanates from the
V449E mutant, as it may be masked by the presence of the
secondary signal in the proximal region. However the FI⌬ mutant
clearly does not activate the proliferation pathway that originates in
the 545-626 region of V449E.
FI⌬ generates tyrosine-dependent survival signals
We have previously shown that the EC h␤c mutants, I374N and
FI⌬, which are capable of inducing factor-independent proliferation of FDC-P1 cells and differentiation of FDB1 cells, do not
exhibit any detectable tyrosine phosphorylation in the absence of
factor (McCormack and Gonda18 and Jenkins et al27). Despite this,
mutational analysis has shown that replacement of all I374N
cytoplasmic tyrosines with phenylalanine compromises its ability
to induce factor-independent growth in FDC-P1 cells (T. Blake and
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
512
BLOOD, 15 JANUARY 2004 䡠 VOLUME 103, NUMBER 2
BROWN et al
expressed these in FDB1 cells. Substitution of the 6 membrane
distal cytoplasmic tyrosine residues with phenylalanine abolished
factor-independent activity of FI⌬, as shown by the rapid loss of
cellular viability. This was similar to the effect seen with cells
expressing only wt h␤c after factor withdrawal (Figure 8A-B).
Substitution of tyrosine residues 577 or 612, separately or together,
did not affect viability signals from FI⌬ as these mutants were able
to maintain survival without factor at least as well as parental FI⌬
(Figure 8B). These data show an absolute requirement for at least
some cytoplasmic tyrosines for the factor-independent activity of
FI⌬. Any effect of the Y2F mutation on viability may be masked in
the context of the full-length receptor, as the effects of the Y6F
mutant show that viability signals must also be emanating from
other cytoplasmic tyrosines. These results indicate that there are
multiple viability signals generated in FI⌬, any of which may be
sufficient, but none of which have been found to be essential for
maintaining viability.
Cytoplasmic tyrosine mutations of FI⌬ can modulate
factor-independent differentiation of FDB1 cells
Figure 5. Morphology of cells expressing cytoplasmic tyrosine mutants of the
V449E activated mutant. (A) Cells expressing the indicated cytoplasmic tyrosine
substitutions were cultured in the absence of growth factor for 5 days and
cytocentrifuged to assess morphology. Original magnification, ⫻ 400. (B) Differential
counts from cytospins done at day 5. For each sample, 200 cells were scored
microscopically for morphology. The combined data from a minimum of 3 independent experiments are shown. The standard error of the mean was less than 10% for
all samples.
T.J.G., unpublished data, July 1998). We therefore predicted that
tyrosine residues might also be important for constitutive activity
of the EC FI⌬ duplication mutant. We introduced phenylalanine
substitutions equivalent to those used to replace cytoplasmic
tyrosine residues in V449E (ie, Y6F, Y577F, Y612F, and Y2F) and
To investigate the potential effects of the FI⌬ tyrosine mutations on
differentiation, the morphology of cells expressing these mutants
was assessed at day 5 of culture without factor. Substitution of
tyrosine 577 with phenylalanine almost totally abolished neutrophil
differentiation but did not affect macrophage differentiation (Figure 9A-B). Substitution of tyrosine 612 with phenylalanine was
also able to shift the balance of differentiation to macrophage
production, however the effect seen was not as dramatic. As might
be expected, the Y2F mutant also showed almost total loss of
neutrophil differentiation. Thus, the signals for neutrophil and
macrophage differentiation induced by FI⌬ are separable.
Discussion
Understanding the role of the GM-CSF receptor family in controlling myeloid progenitor cell survival, proliferation, and differentiation and the mechanisms through which these effects occur has
proved to be complex and challenging. We have developed a
system with 2 key features designed to help better address these
issues. First, the FDB1 cell line has proved to be a powerful model
Figure 6. Effects of FI⌬ cytoplasmic truncations
on factor-independent growth and viability. (A)
Proliferation of FDB1 cells infected with cytoplasmic
truncations of the FI⌬ activated mutant. Growth
without factor (diamonds) is shown compared with
growth with the control cytokine IL-3 (squares).
Results representative of at least 3 independent
experiments are shown. Error bars represent the SD
of triplicate samples. (B) Viability of cells without
factor at day 5 after factor withdrawal. Cell viability
was determined by trypan blue exclusion, and the
combined results of at least 3 independent experiments are shown. Error bars represent the SD.
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
BLOOD, 15 JANUARY 2004 䡠 VOLUME 103, NUMBER 2
CONSTITUTIVE GM-CSF RECEPTOR SIGNALING
513
do not activate all pathways downstream of the normal GM-CSF
receptor, thus reducing the redundancy of pathways involved. This
is of clear importance as one of the main complications in
connecting signaling events to biologic outcomes is the presence of
multiple, functionally equivalent pathways. That this occurs for the
GM-CSF receptor family is clear from several previous studies.10,21,22,30-32 While multiple regions have been associated with
survival, proliferation, and differentiation in different circumstances, a reduced level of redundancy in our system has allowed
the association of new receptor features and signaling pathways
with survival, proliferation, self-renewal, and modulation of differentiation (summarized in Figure 10).
The membrane-proximal region (518-544) of the V449E mutant
is required for a tyrosine-independent survival signal
Figure 7. Morphology of cells expressing cytoplasmic truncations of the FI⌬
activated mutant. (A) Control cells (expressing wt h␤c) were cultured in the indicated
growth factors for 5 days. Cells expressing truncations of the activated mutant were
cultured in the absence of growth factor for 5 days. At day 5, cells were cytocentrifuged to
assess morphology. Original magnification, ⫻ 400. (B) Differential counts from cytospins
done at day 5. For each sample, 200 cells were scored microscopically for morphology. The
combined data from a minimum of 3 independent experiments is shown. The standard
error of the mean was less than 10% for all samples.
system in which to study GM-CSF/IL-3 receptor signaling, as (like
normal cells) it is strictly factor-dependent and shows the full
spectrum of biologic responses, that is, proliferation, and differentiation in response to IL-3 and GM-CSF, respectively. Second, we
have used FDB1 cells together with a set of constitutive mutants of
h␤c, which induce biologic effects similar to IL-3 and GM-CSF but
Figure 8. Effects of FI⌬ cytoplasmic tyrosine mutants
on factor-independent growth and viability.(A) Growth
without factor (diamonds) is shown compared with growth
with the control cytokine IL-3 (squares). Results representative of at least 3 independent experiments are shown.
Error bars represent the SD of triplicate samples. (B)
Viability of cells without factor at day 5 after factor
withdrawal. Cell viability was determined by trypan blue
exclusion, and the combined results of at least 3 independent experiments are shown. Error bars represent the
SD.
This short region (518-544) of h␤c is conserved in the cytokine
receptor family and contains the Box 2 motif.33 Importantly, we
have found this region to be active in generation of a constitutive
survival signal from the V449E mutant. In contrast, an equivalent
truncation of FI⌬ was unable to support factor-independent survival. This differential signaling is most likely related to the nature
of the complex formed by the constitutive receptors. The mode of
activation of the V449E mutant is presumed to involve homodimerization, while that of the EC mutants involves a functional
association with GMR␣.23 The EC mutants, while able to activate
JAK2, lack detectable receptor tyrosine phosphorylation, consistent with the failure to form appropriate h␤c dimers that mediate
transphosphorylation by associated JAK2.
While it is tempting to ascribe the survival function of the
518-544 region to the Box 2 motif, it has not been demonstrated to
bind any specific signaling molecules. Moreover, internal deletion
of Box 2 does not affect the ability of the GM-CSF receptor to
induce short-term proliferation and JAK2 activation in Ba/F3
cells.7,8 Therefore we may be able to use our system to further
define signaling activities associated with Box 2.
A tyrosine-dependent proliferation signal emanates
from Tyr577 in V449E
A key aim of this study was to determine regions of the h␤c
cytoplasmic domain that are required for proliferative signaling by
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
514
BROWN et al
BLOOD, 15 JANUARY 2004 䡠 VOLUME 103, NUMBER 2
Figure 9. Morphology of cells expressing cytoplasmic tyrosine mutants of the FI⌬ activated mutant. (A)
Cells expressing the indicated cytoplasmic tyrosine substitutions were cultured in the absence of growth factor
for 5 days and cytocentrifuged to assess morphology.
Original magnification, ⫻ 400. (B) Differential counts
from cytospins done at day 5. For each sample, 200 cells
were scored microscopically for morphology. The combined data from a minimum of 3 independent experiments is shown. The standard error of the mean was less
than 10% for all samples except for FI⌬ Y577F blasts
(SEM ⫽ 14.7%), and FI⌬ Y577F macrophages
(SEM ⫽ 18.4%).
V449E. The region between amino acids 545 and 626 was essential
for factor-independent proliferation, and further mutational analysis determined tyrosine 577 to be an essential requirement. Cells
expressing the V449E 544 truncation or V449E Y577F did not
proliferate but were still able to survive without factor, demonstrating that proliferative and survival signals can be separated.
Previous work from several other laboratories has shown that the
presence of Tyr577 is required for binding and phosphorylation of
the Shc adaptor molecule.7,8,13 In fact Tyr577 is both necessary and
sufficient for activation of Shc.34 This is in contrast to other
signaling molecules associated with this tyrosine residue such as
SHP2 and STAT5b, whose activation can also be mediated by
several other tyrosine residues.12 Interestingly, in FDC-P1 cells, we
have found that activation of Shc can be detected in response to
signaling from V449E but not the I374N EC mutant (T. Blake and
T.J.G., unpublished data, October 1998), further associating Shc
with the proliferative activity of the V449E mutant. Activation of
Shc has been linked to the MAPK (for a recent review see
Ravichandran35), PI3-K,15 and Src family kinase pathways.36 Gab2
activation also occurs through tyrosine 577, while a dominantnegative Gab2 suppresses PI3-K activation and proliferation of
Ba/F3 cells in response to IL-3.15 Importantly, mutation of this
tyrosine to phenylalanine (Y577F) in the context of wild-type h␤c
(while abolishing detectable Shc activation) does not significantly
affect proliferation or viability of Ba/F3 cells in response to
hGM-CSF.13 This is not surprising as activation of both ERK1/2
and PI3-K/Akt can occur by Shc-independent routes.13,16,17 In
agreement with this, we found that mutation of Tyr577 did not
abolish V449E-induced constitutive activation of ERK1/2 and that
mutation of several additional tyrosine residues was required to
significantly affect ERK1/2 activation (Figure 4C). As activation of
the ERK1/2 MAPK pathway is intact in the V449E Y577F mutant,
it is likely that the loss of a different Shc-mediated signaling
pathway may be responsible for the observed proliferation defect.
Future biochemical studies in this system will confirm this and lead
to the elucidation of this pathway.
Ablation of the major V449E proliferative signal also had
significant effects on the differentiation status of cells. FDB1 cells
expressing the mutant forms of V449E showed an increased
propensity to differentiate to macrophages. This suggests the
possibility that proliferation is associated with a block in the
pathway mediating macrophage differentiation, at least (next
paragraph). Macrophage differentiation was most pronounced
when Tyr577 and Tyr612 were mutated together (in the Y2F
mutant). Thus, although Tyr612 was not shown to affect V449E
activity when mutated alone, it contributes to a signal that can
block differentiation of FDB1 cells.
Little neutrophil differentiation was observed with V449E Y2F,
even at time points earlier than day 5 (data not shown), suggesting
that the mutant either retains the ability to suppress neutrophil
differentiation and/or lacks the ability to induce it. We favor the
former since our preliminary experiments have shown that V449E
Y2F can suppress neutrophil differentiation induced by GM-CSF
(data not shown). Thus V449E appears to generate a proliferation
signal that is closely coupled to suppression of macrophage
differentiation but independent of a separate, as-yet-undefined
signal that suppresses granulocyte differentiation. The pathways
that mediate such blocks in myeloid differentiation are not well
understood but play an important role in leukemic transformation. These mutants may provide useful tools for dissecting such
a pathway.
FI⌬ requires tyrosine residues for viability despite its lack of
detectable tyrosine phosphorylation
Figure 10. Summary of the effects on FDB1 cells of V449E and FI⌬ mutational
analysis.
The FI⌬ truncation series shows that factor-independent differentiation and viability signals originate from the region between amino
acids 545 and 626. Given that mutation of all 6 membrane distal
cytoplasmic tyrosines to phenylalanine abolished survival in the
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
BLOOD, 15 JANUARY 2004 䡠 VOLUME 103, NUMBER 2
CONSTITUTIVE GM-CSF RECEPTOR SIGNALING
absence of factor, we tested whether the tyrosine residues in the
545-626 region were important for FI⌬-induced survival. However
mutation of these 2 residues in full-length FI⌬ did not affect
viability, indicating that tyrosine residues downstream of amino
acid 626 are contributing to an independently generated signal for
viability. This result, demonstrating a tyrosine-dependent viability
signal in FI⌬ was of particular interest given that EC mutants have
no detectable phosphorylation of tyrosine residues.27 We cannot
rule out that the tyrosine residue/s responsible for FI⌬ viability
signaling are phosphorylated at a level that is sufficient for
physiologic signaling via phosphotyrosine binding proteins but undetectable using phosphotyrosine antibodies. These results also raise the
possibility that proteins that bind nonphosphorylated tyrosine residues
are involved in this response (for review see Yaffe37).
Tyr577 is required for a signal that supports granulocyte
differentiation induced by FI⌬
A previous study of the GM-CSF receptor family in myeloid cell
differentiation has indicated a specific role for GMR␣ in induction
of differentiation.19 Regions of the IL-3 and GM-CSF ␣ subunit
cytoplasmic domains have been identified that contribute to
specifying a proliferation or differentiation response (see also
Evans et al20); however, these studies did not explore the regions of
the h␤c required for the different responses. One of the aims of our
study was to separate signals for granulocyte and macrophage
differentiation emanating from FI⌬. This was problematic using
truncations, as all signaling was abolished by the FI⌬ 544
truncation. Importantly, however, a single amino acid substitution
(Y577F) in the FI⌬-activated mutant specifically abolished granulocytic differentiation at day 5 following factor withdrawal. With
this mutant, cells present at day 5 of differentiation were predominantly macrophages in contrast to normal FI⌬, which generated
approximately equal numbers of granulocytes and macrophages.
515
The presence of granulocytes (up to 20%) was noted at day 2 of
factor withdrawal (compare with normal FI⌬, which had 38%
granulocytes at day 2), but numbers dropped rapidly after this time
point (data not shown). This result suggests that multiple signals
are generated that contribute to the pathway that stimulates
maximal granulocyte production and survival in the FDB1 cell line.
The nature of the disruption in FI⌬ signaling by the Y577F mutant
is intriguing given that, as discussed in “FI⌬ requires tyrosine
residues for viability despite its lack of detectable tyrosine phosphorylation,” there is no detectable phosphorylation of the receptor on
EC mutant tyrosine residues.27 The major signaling events that
have been delineated as originating from Tyr577 thus far all
involve activation of Shc or SHP2, both of which are thought to
require binding to phosphotyrosine. As we have observed that
EC mutants do not appear to activate Shc (T. Blake, unpublished
observations, October 1998), it is unlikely that Y577F is having
an effect on granulocyte differentiation via a Shc-dependent
pathway. We are now exploring the possibility that activation of
a novel signaling pathway is involved in mediating this
differentiation.
In summary, our data are consistent with constitutive mutants of
h␤c activating only a subset of the pathways activated by the
wild-type receptor in response to ligand.27 This has provided an
opportunity to remove a significant level of redundancy from the
GM-CSF receptor system and permitted simultaneous analysis of
survival, proliferation, and the differentiation response. Follow-up
studies using biochemical and gene expression profiling approaches will be informative with regard to associating signaling pathways and downstream genes with the different cellular
outcomes. Ultimately, we predict that these studies will lead to a
better understanding of the receptor-associated signaling and
gene expression changes associated with myeloid cell behavior
and leukemogenesis.
References
1. Hayashida K, Kitamura T, Gorman DM, et al. Molecular cloning of a second subunit of the receptor
for human granulocyte-macrophage colonystimulating factor (GM-CSF): reconstitution of a
high-affinity GM-CSF receptor. Proc Natl Acad
Sci U S A. 1990;87:9655-9659.
2. Kitamura T, Sato N, Arai K, Miyajima A. Expression cloning of the human IL-3 receptor cDNA
reveals a shared beta subunit for the human IL-3
and GM-CSF receptors. Cell. 1991;20;66:11651174.
3. Tavernier J, Devos R, Cornelis S, et al. A human
high affinity interleukin-5 receptor (IL5R) is composed of an IL5-specific alpha chain and a beta
chain shared with the receptor for GM-CSF. Cell.
1991;20;66:1175-1184.
4. de Groot RP, Coffer PJ, Koenderman L. Regulation of proliferation, differentiation and survival by
the IL-3/IL-5/GM-CSF receptor family. Cell Signal.
1998;10:619-628.
5. Geijsen N, Koenderman L, Coffer PJ. Specificity
in cytokine signal transduction: lessons learned
from the IL-3/IL-5/GM-CSF receptor family. Cytokine Growth Factor Rev. 2001;12:19-25.
6. Quelle FW, Sato N, Witthuhn BA, et al. JAK2 associates with the beta c chain of the receptor for
granulocyte-macrophage colony-stimulating factor, and its activation requires the membraneproximal region. Mol Cell Biol. 1994;14:43354341.
7. Watanabe S, Itoh T, Arai K. JAK2 is essential for
activation of c-fos and c-myc promoters and cell
proliferation through the human granulocyte-macrophage colony-stimulating factor receptor in
BA/F3 cells. J Biol Chem. 1996;271:1268112686.
8. Itoh T, Muto A, Watanabe S, et al. Granulocytemacrophage colony-stimulating factor provokes
RAS activation and transcription of c-fos through
different modes of signaling. J Biol Chem. 1996;
271:7587-7592.
9. Sakai I, Kraft AS. The kinase domain of Jak2 mediates induction of bcl-2 and delays cell death in
hematopoietic cells. J Biol Chem. 1997;272:
12350-12358.
10. Sakamaki K, Miyajima I, Kitamura T, Miyajima A.
Critical cytoplasmic domains of the common beta
subunit of the human GM-CSF, IL-3 and IL-5 receptors for growth signal transduction and tyrosine phosphorylation. EMBO J. 1992;11:35413549.
11. Chin H, Nakamura N, Kamiyama R, et al. Physical and functional interactions between Stat5 and
the tyrosine-phosphorylated receptors for erythropoietin and interleukin-3. Blood. 1996;88:44154425.
12. Itoh T, Liu R, Yokota T, Arai KI, Watanabe S. Definition of the role of tyrosine residues of the common beta subunit regulating multiple signaling
pathways of granulocyte-macrophage colonystimulating factor receptor. Mol Cell Biol. 1998;18:
742-752.
13. Durstin M, Inhorn RC, Griffin JD. Tyrosine phosphorylation of Shc is not required for proliferation
or viability signaling by granulocyte-macrophage
colony-stimulating factor in hematopoietic cell
lines. J Immunol. 1996;157:534-540.
14. Stomski FC, Dottore M, Winnall W, et al. Identifi-
cation of a 14-3-3 binding sequence in the common beta chain of the granulocyte-macrophage
colony-stimulating factor (GM-CSF), interleukin-3
(IL-3), and IL-5 receptors that is serine-phosphorylated by GM-CSF. Blood. 1999;94:1933-1942.
15. Gu H, Maeda H, Moon JJ, et al. New role for Shc
in activation of the phosphatidylinositol 3-kinase/
Akt pathway. Mol Cell Biol. 2000;20:7109-7120.
16. Guthridge MA, Stomski FC, Barry EF, et al. Sitespecific serine phosphorylation of the IL-3 receptor is required for hemopoietic cell survival. Mol
Cell. 2000;6:99-108.
17. Dijkers PF, van Dijk TB, de Groot RP, et al. Regulation and function of protein kinase B and MAP
kinase activation by the IL-5/GM-CSF/IL-3 receptor. Oncogene. 1999;18:3334-3342.
18. McCormack MP, Gonda TJ. Novel murine myeloid cell lines that exhibit a differentiation switch
in response to IL-3 or GM-CSF, or to different
constitutively active mutants of the GM-CSF receptor beta subunit. Blood. 2000;95:120-127.
19. Evans CA, Pierce A, Winter SA, et al. Activation
of granulocyte-macrophage colony-stimulating
factor and interleukin-3 receptor subunits in a
multipotential hematopoietic progenitor cell line
leads to differential effects on development.
Blood. 1999;94:1504-1514.
20. Evans CA, Ariffin S, Pierce A, Whetton AD. Identification of primary structural features that define
the differential actions of IL-3 and GM-CSF receptors. Blood. 2002;100:3164-3174.
21. Smith A, Metcalf D, Nicola NA. Cytoplasmic domains of the common beta-chain of the GM-CSF/
IL-3/IL-5 receptors that are required for inducing
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
516
BROWN et al
differentiation or clonal suppression in myeloid
leukaemic cell lines. EMBO J. 1997;16:451-464.
22. Matsuguchi T, Lilly MB, Kraft AS. Cytoplasmic
domains of the human granulocyte-macrophage
colony-stimulating factor (GM-CSF) receptor beta
chain (hbetac) responsible for human GM-CSFinduced myeloid cell differentiation. J Biol Chem.
1998;273:19411-19418.
23. D’Andrea RJ, Gonda TJ. A model for assembly
and activation of the GM-CSF, IL-3 and IL-5 receptors: insights from activated mutants of the
common beta subunit. Exp Hematol. 2000;28:
231-243.
24. Jenkins BJ, D’Andrea R, Gonda TJ. Activating
point mutations in the common beta subunit of
the human GM-CSF, IL-3 and IL-5 receptors suggest the involvement of beta subunit dimerization
and cell type-specific molecules in signalling.
EMBO J. 1995;14:4276-4287.
25. D’Andrea R, Rayner J, Moretti P, et al. A mutation
of the common receptor subunit for interleukin-3
(IL-3), granulocyte-macrophage colony-stimulating factor, and IL-5 that leads to ligand independence and tumorigenicity. Blood. 1994;83:28022808.
26. Gonda TJ, D’Andrea RJ. Activating mutations in
BLOOD, 15 JANUARY 2004 䡠 VOLUME 103, NUMBER 2
cytokine receptors: implications for receptor function and role in disease. Blood. 1997;89:355-369.
27. Jenkins BJ, Blake TJ, Gonda TJ. Saturation mutagenesis of the beta subunit of the human granulocyte-macrophage colony-stimulating factor receptor shows clustering of constitutive mutations,
activation of ERK MAP kinase and STAT pathways, and differential beta subunit tyrosine phosphorylation. Blood. 1998;92:1989-2002.
28. Okuda K, Foster R, Griffin JD. Signaling domains
of the beta c chain of the GM-CSF/IL-3/IL-5 receptor [discussion 312-313]. Ann N Y Acad Sci.
1999;872:305-312.
29. Persons DA, Mehaffey MG, Kaleko M, Nienhuis
AW, Vanin EF. An improved method for generating retroviral producer clones for vectors lacking a
selectable marker gene. Blood Cells Mol Dis.
1998;24:167-182.
30. Sato N, Sakamaki K, Terada N, Arai K, Miyajima
A. Signal transduction by the high-affinity GMCSF receptor: two distinct cytoplasmic regions of
the common beta subunit responsible for different
signaling. EMBO J. 1993;12:4181-4189.
31. Kinoshita T, Yokota T, Arai K, Miyajima A. Suppression of apoptotic death in hematopoietic cells
32.
33.
34.
35.
36.
37.
by signalling through the IL-3/GM-CSF receptors.
EMBO J. 1995;14:266-275.
Weiss M, Yokoyama C, Shikama Y, et al. Human
granulocyte-macrophage colony-stimulating factor receptor signal transduction requires the
proximal cytoplasmic domains of the alpha and
beta subunits. Blood. 1993;82:3298-3306.
Murakami M, Narazaki M, Hibi M, et al. Critical
cytoplasmic region of the interleukin 6 signal
transducer gp130 is conserved in the cytokine
receptor family. Proc Natl Acad Sci U S A. 1991;
88:11349-11353.
Okuda K, Smith L, Griffin JD, Foster R. Signaling
functions of the tyrosine residues in the betac
chain of the granulocyte-macrophage colonystimulating factor receptor. Blood. 1997;90:47594766.
Ravichandran KS. Signaling via Shc family
adapter proteins. Oncogene. 2001;20:6322-6330.
Grishin A, Sinha S, Roginskaya V, et al. Involvement of Shc and Cbl-PI 3-kinase in Lyn-dependent proliferative signaling pathways for G-CSF.
Oncogene. 2000;19:97-105.
Yaffe MB. Phosphotyrosine-binding domains in
signal transduction. Nat Rev Mol Cell Biol. 2002;
3:177-186.
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
2004 103: 507-516
doi:10.1182/blood-2003-05-1435 originally published online
September 22, 2003
Constitutive mutants of the GM-CSF receptor reveal multiple pathways
leading to myeloid cell survival, proliferation, and
granulocyte-macrophage differentiation
Anna L. Brown, Michelle Peters, Richard J. D'Andrea and Thomas J. Gonda
Updated information and services can be found at:
http://www.bloodjournal.org/content/103/2/507.full.html
Articles on similar topics can be found in the following Blood collections
Apoptosis (747 articles)
Hematopoiesis and Stem Cells (3432 articles)
Signal Transduction (1930 articles)
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society
of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.