Changes in hepatic lipid parameters and hepatic messenger ribonucleic
acid expression following estradiol administration
in laying hens (Gallus domesticus)
B. K. Lee, J. S. Kim, H. J. Ahn, J. H. Hwang, J. M. Kim, H. T. Lee, B. K. An, and C. W. Kang1
Animal Resources Research Center, College of Animal Bioscience and Technology,
Konkuk University, Seoul 143 701, Korea
ABSTRACT Fatty liver hemorrhagic syndrome (FLHS)
is characterized by increased hepatic triacylglycerol
content associated with liver hemorrhages and results
in a sudden decline in egg production. Genetic, environmental, nutritional, and hormonal factors have all
been implicated in the etiology of FLHS, but the exact
cause of FLHS is still unknown. Estrogens have been
implicated in the development of excess fat content of
the liver and in the etiology of FLHS. This study investigated estradiol (E2) administration in hens and
its effect on lipid metabolism. Hy-Line Brown laying
hens were intramuscularly injected with E2 on a daily
basis for 3 wk. The dosages were 0, 0.5, and 1.0 mg/
kg of BW, with corn oil injections used as a control.
Egg production and quality were measured among the
groups, with no significant difference seen in egg production. Liver weights of hens treated with E2 were
greater than those of control hens, but the increase was
not statistically significant. Serum glutamic-oxaloacetic
transaminase and glutamic-pyruvic transaminase activities and E2 plasma concentrations increased in a dose-
dependent manner, with plasma concentration of E2
increasing from 6,900 to 19,000 pg/mL. No significant
differences in free cholesterol or phospholipids were observed, but there was a significant increase in hepatic
triacylglycerol levels. Injection with E2 showed an increased expression of mRNA for peroxisome proliferator-activated receptor γ (23-fold), but not for peroxisome proliferator-activated receptor α. A statistically
significant increase was seen for fatty acid synthase,
apolipoprotein B, and adenosine triphosphate citrate
lyase, but not for acetyl coenzyme A carboxylase, apolipoprotein VLDL-II, microsomal triglyceride transport
protein, or malic enzyme. For proteins involved in the
oxidation of E2, only cytochrome P450 3A37 showed
a statistically significant increase. The present results
suggest that E2 upregulates the synthesis of fatty acids
and triacylglycerols and the accumulation of hepatic
lipids by increasing mRNA expression related to lipid metabolism, and that excess E2 in the blood leads
to activation of E2 catabolic metabolism (cytochrome
P450 3A37)-related mRNA expression.
Key words: fatty liver hemorrhagic syndrome, estradiol, lipid metabolism, estrogen metabolism, laying hen
2010 Poultry Science 89:2660–2667
doi:10.3382/ps.2010-00686
INTRODUCTION
Fatty liver hemorrhagic syndrome (FLHS) was first
described by Couch (1956). This syndrome is characterized by an increased hepatic triacylglycerol content
associated with liver hemorrhages and results in a sudden decline in egg production. Death is caused by massive hemorrhage of the liver. Subclinical cases of FLHS
have a friable, enlarged liver, which is putty-colored
and contains smaller hemorrhages. Large amounts of
yellow fat are present in the abdominal cavity (Squires
and Leeson, 1988). Fatty liver hemorrhagic syndrome
is known to be caused by nutritional factors and met©2010 Poultry Science Association Inc.
Received February 4, 2010.
Accepted August 17, 2010.
1 Corresponding author: [email protected]
abolic states (Butler, 1976; Jensen, 1979; Takahashi
and Jensen, 1984), and genetic, environmental, and
hormonal factors have all been implicated in the etiology of FLHS (Squires and Leeson, 1988; Hansen and
Walzem, 1993).
Although many other factors are related to FLHS, estradiol (E2) administration has been shown to increase
liver size and liver lipid content in chickens (Akiba et
al., 1983; Takahashi and Jensen, 1984; Takahashi et al.,
1984). In contrast to mammals, the liver is the major
site of lipid synthesis in birds; accordingly, the avian
liver has a naturally high lipid content (Leeson et al.,
1995). The normal increase in hepatic fat content of
mature vs. immature birds is a reflection of the lipids
required for yolk synthesis, and as such, is influenced
by estrogen (Leeson et al., 1995). A unique feature of
FLHS in laying hens is the high estrogen level, which is
2660
ESTRADIOL AND HEPATIC LIPID METABOLISM
thought to play a major role in the development of the
disease state (Hansen and Walzem, 1993).
Peroxisome proliferator-activated receptors (PPAR)
are transcription factors that belong to the superfamily
of nuclear receptors and that control nutrient metabolism and energy homeostasis (Desvergne and Wahli,
1999; Chinetti et al., 2000; Duval et al., 2002). Peroxisome proliferator-activated receptor α reduces circulating triacylglycerol levels via transcriptional modulation
of genes related to lipolysis, cellular uptake, β-oxidation
of fatty acids, and decreased synthesis of fatty acids and
triacylglycerols (Schoonjans et al., 1996; Staels et al.,
1998). Peroxisome proliferator-activated receptor γ is a
key regulator in the differentiation and function of adipocytes in mammals and is known to directly modulate
target genes involved in glyceroneogenesis, lipid uptake,
lipid synthesis, lipid storage, and lipolysis (Jeninga et
al., 2009). In mammals, lipogenesis is controlled by the
transcription factor family designated sterol regulatory
element-binding protein (SREBP; Brown and Goldstein, 1999). Several studies have demonstrated that
PPAR and SREBP in chickens have a high homology
with the PPAR of mice, rats, and humans (Diot and
Douaire, 1999; Meng et al., 2005; König et al., 2007).
However, the exact mechanisms by which fatty acid
and triacylglycerol synthesis are regulated in chickens
are not completely understood (König et al., 2009).
Estradiol is oxidized to catechol estrogens by cytochrome P450 (CYP) 1A1 and CYP1B1. These enzymes
further oxidize the catechol estrogens to semiquinones
and quinones. Catechol estrogens and their estrogen
quinines and semiquinones undergo redox cycling,
which results in the production of reactive oxygen species that can cause oxidative DNA damage ranging
from oxidation of bases to single-strand breakage (Belous et al., 2007). In mammals, CYP1A1 and CYP1B1
display the highest levels of expression in breast tissue,
whereas other phase I enzymes, such as CYP1A2 and
CYP3A4, are involved in hepatic and extrahepatic estrogen oxidation (Huang et al., 1996; Shimada et al.,
1996). In humans, CYP3A4 catalyzes the hydroxylation of steroid hormones, whereas in chickens, this is
accomplished by CYP3A37 at rates comparable with
those of human CYP3A4 (Ourlin et al., 2000).
The objectives of the present study were 1) to confirm that E2 administration would induce lipid accumulation in the liver of laying hens; 2) to observe the
variation in mRNA expression of PPAR, SREBP, and
other genes involved in lipid and estrogen metabolism
in laying hens treated with E2; and 3) to provide basic
research data related to FLHS in laying hens caused by
circulating estrogen.
MATERIALS AND METHODS
Birds and Treatment
A total of thirty 60-wk-old Hy-Line Brown laying
hens were used in this study. The birds were housed
2661
in wire cages and fed a corn and soybean meal-based
experimental diet for 6 weeks. The diet (Table 1) was
formulated to meet or exceed the nutrient recommendations of the NRC (1994), and food was provided ad
libitum. A room temperature of 25 ± 3°C and a photoperiod of 16L:8D were maintained throughout the
experimental period. All animal care procedures were
approved by the Institutional Animal Care and Use
Committee at Konkuk University.
During the first 3 wk, egg production was recorded
daily. Egg data and hen BW were collected per hen.
Laying percentage was calculated as the number of eggs
produced per hen divided by the number of days in the
experimental period. At the end of the 3 wk, the hens
were weighed and divided into 3 groups of 10 birds each
to provide a similar egg production and BW distribution. The 2 treated groups were administered estradiol
benzoate (Esrone, Samyang Anipharm, Seoul, Korea)
intramuscularly in doses of 0.5 and 1.0 mg/kg of BW,
whereas birds in the control group were injected with
corn oil every day for 3 wk. The eggs were exposed
to a breaking force using an eggshell strength tester
(FHK, Fujihira Ltd., Tokyo, Japan). In addition, their
albumen heights were measured. Haugh units were calculated using the Haugh unit formula (Haugh, 1937),
Table 1. Formula and chemical composition of the experimental
diet
Item
Amount
Ingredient, %
Yellow corn
Soybean meal
Limestone
Rapeseed meal
Wheat
Wheat bran
Rice bran
Corn gluten meal
Tallow
Dicalcium phosphate
Salt
Vitamin mixture1
Mineral mixture2
Methionine hydroxy analog (88%)
NaHCO3
Choline chloride (50%)
Total
Calculated value
CP, %
Ether extract, %
Crude fiber, %
Crude ash, %
Calcium, %
Phosphorus, %
Lysine, %
Methionine + cysteine, %
TMEn, kcal/kg
59.38
15.60
10.60
4.00
3.00
2.00
2.00
1.80
0.80
0.20
0.20
0.12
0.10
0.10
0.08
0.02
100.00
15.50
3.58
3.10
13.68
4.30
0.40
0.74
0.55
2,700
1Vitamin mixture provided the following nutrients per kilogram of
diet: vitamin A, 10,000 IU; vitamin D3, 2,300 IU; vitamin E, 20 IU; vitamin K3, 2 mg; vitamin B1, 2 mg; vitamin B2, 5 mg; vitamin B6, 3.5 mg;
vitamin B12, 0.02 mg; biotin, 0.12 mg; niacin, 30 mg; pantothenic acid,
10 mg; folic acid, 0.7 mg.
2Mineral mixture provided the following nutrients per kilogram of diet:
Fe, 70 mg; Zn, 60 mg; Mn, 8 mg; Cu, 7.5 mg; I, 1 mg; Se, 0.2 mg; Co,
0.13 mg.
2662
Lee et al.
and the yolk color was determined with a Roche yolk
color fan.
Quantitative Reverse
Transcription-PCR Analysis
Sample Collection and Chemical Analysis
in Blood
Total RNA was extracted from liver samples using
a commercial kit (RNeasy Mini Kit, Qiagen, Courtaboeuf, France) according to the instructions of the manufacturer. Complementary DNA was synthesized by RT
Premix (AccuPower RT Premix, Bioneer, Daejon, Korea) according to the manufacturer’s instructions. After reverse transcription, the cDNA of genes involved
in lipid metabolism [PPARα, PPARγ, SREBP-1, fatty
acid synthase (FAS), acetyl coenzyme A carboxylase
(ACC), apolipoprotein B (apoB), apolipoprotein
VLDL-II (apoVLDL-II), microsomal triglyceride
transport protein, malic enzyme, adenosine triphosphate citrate lyase (ACLY)] and in estrogen metabolism [estrogen receptor α (ERα), CYP1A1, CYP1B1,
CYP3A37], with β-actin as a reference, were amplified
by real-time quantitative reverse transcription-PCR using a Rotor-Gene 3000 instrument (Corbett Research,
Mortlake, Australia) with the Rotor-Gene SYBR Green
PCR Master Mix (Qiagen, Courtaboeuf, France). For
each gene, specific primers are provided in Table 2. The
cycling conditions consisted of a denaturation step at
95°C for 5 min, followed by an amplification program
(10 s at 95°C, followed by 30 s at 60°C) that was repeated 40 times. Each PCR run included a no-template
control and the samples of each group. Fluorescence
data were acquired to generate a melting curve to distinguish specific amplicons from nonspecific ones. The
PCR product sizes were confirmed by submarine agarose gel electrophoresis and staining with ethidium bromide.
At the end of the experimental period, all hens were
weighed and blood was collected from a wing vein by
using sterilized syringes for determination of the various blood profiles. On necropsy, the liver, spleen, and
abdominal fat were immediately removed and weighed.
Liver samples were directly frozen in liquid nitrogen and
then stored at −80°C until further analysis. The activity of glutamic-oxaloacetic transaminase (GOT) and
glutamic-pyruvic transaminase (GPT) were estimated
according to the colorimetric method using a GOTGPT assay kit (BCS GOT-GPT assay kit, Bio Clinical
System Corporation, Anyang, Korea) according to the
manufacturer’s instructions. Plasma E2 concentrations
were determined by electrochemiluminescence immunoassay (Estradiol II, F. Hoffmann-La Roche Ltd., Basel,
Switzerland) according to the manufacturer’s instructions. Very low density lipoprotein (VLDL) in plasma
was determined using the turbidimetric method described by Griffin and Whitehead (1982), which is well
correlated with plasma levels of VLDL (Crespo and Esteve-Garcia, 2003). A calibration curve was made with
solutions containing different concentrations of human
VLDL (Sigma, St. Louis, MO). An aliquot of 0.2 mL
of plasma was mixed with 4 mL of a buffer solution
containing 0.25 g of heparin/L. After incubation for 30
min at room temperature, precipitation of VLDL was
considered complete and the absorbance was measured
at 520 nm (Crespo and Esteve-Garcia, 2003).
Determination of the Lipid Fraction in Liver
The contents of each lipid fraction in the liver were
separated by thin-layer chromatography (TLC) on silica gel chromarods (Chromarod-S III, Mitsubishi Kagaku Iatron, Inc., Tokyo, Japan), which are composed
of an exclusive medium similar to normal-phase TLC,
using hexane:diethylether:formic acid (85:15:0.15, by
vol) as developing solvents, and then quantified by
an Iatroscan (TH-10 TLC/flame-ionization detection
analyzer, Mitsubishi Kagaku Iatron Ltd.) as described
previously (An et al., 1997). A modified method was
used to determine the thiobarbituric acid reactive substance values in the liver to evaluate lipid oxidation, as
described by Botsoglou et al. (1994). To evaluate the
malondialdehyde contents of the liver, a 1.5-g sample
was homogenized with 5% aqueous trichloroacetic acid
solution containing 0.8% butylated hydroxytoluene and
then centrifuged for 3 min at 3,000 × g at 25°C. After
the reaction with thiobarbituric acid reagent, malondialdehyde was directly quantified by third-derivative
spectrophotometry against a blank reaction mixture
(Beckman DU-650, Beckman Coulter Inc., Fullerton,
CA).
Statistical Analyses
Differences among groups were determined by ANOVA using the GLM procedure of SAS (SAS Institute,
2002), and significant differences were determined using Duncan’s multiple range test at a level of P < 0.05
(Duncan, 1955). Percentage data were transformed
to arcsine percentages before square root percentage
ANOVA was performed.
RESULTS AND DISCUSSION
Effects on Egg Production and Qualities
Laying percentage decreased in a dose-dependent
manner after E2 injection; however, these differences
were not significant (Table 3). Additionally, the BW
of the estrogenized hens decreased after injection (P <
0.05). As shown in Table 4, there were no differences in
egg and eggshell qualities among groups.
Egg production is controlled by the rate of growth
and differentiation of ovarian follicles, which are, in
turn, under the control of reproductive hormones, such
as luteinizing hormone, follicle-stimulating hormone,
progesterone, E2, and growth factors (Onagbesan et
2663
ESTRADIOL AND HEPATIC LIPID METABOLISM
Table 2. Characteristics of the specific primers used for real-time reverse transcription-PCR analysis
Product
size, bp
Gene1
Forward primer
Reverse primer
PPARα
PPARγ
SREBP-1
ACC
FAS
apoB
apoVLDL-II
MTP
ACLY
Malic enzyme
ERα
CYP1A1
CYP1B1
CYP3A37
β-Actin
AGGCCAAGTTGAAAGCAGAA
GATCGCCCAGGTTTGTTAAA
CTACCGCTCATCCATCAACG
TGTGGCTGATGTGAGCTTTC
GCTGAGAGCTCCCTAGCAGA
ATTCCTGACTTGAAGATACCAGAG
TTCAGCCTGGGAGAGAGAAA
CAAGAACCGGATAGCCATGT
GGGCCACAAAGAAATCTTGA
AGTGCCTACCTGTGATGTTG
TGAGCTGGAGACTCTGAGCA
GACCCCTACCGCTACATGGT
TCCACGTCTCCATGCACTCT
AGCTGACCAAGTTTGACTTCTTTGA
GTGATGGACTCTGGTGATGG
TTTCCCTGCAAGGATGACTC
TGCACGTGTTCCGTTACAAT
CTGCTTCAGCTTCTGGTTGC
ACTGTCGGGTCACCTTCAAC
TCCTCTGCTGTCCCAGTCTT
GTTCGCAGATGCTGTAGTATTATG
TGAGTGCACTTCAGGGACAG
AGGAGAGCCAACTCTGTCCA
CAGCAATAATGGCAATGGTG
GGCTTGACCTCTGATTCTCT
CCGTACACTGGAGCGGTAGT
CAGCAGCAGTCACATCCACA
GGCTGCAGTGTTCAAAGCAT
AAGCTGATGTTCATCTTGGCCAT
TGGTGAAGCTGTAGCCTCTC
155
167
145
152
164
159
140
175
167
101
147
139
131
94
150
GenBank no.
NM_001001464.1
NM_001001460.1
AY029924
NM_205505.1
NM_205155.1
NM_001044633.1
NM_205483.1
XM_420662.2
NM_001030540.1
AF408407
NM_205183.1
NM_205146.1
XM_419515.2
NM_001001751
NM_205518
1Abbreviations: PPARα = peroxisome proliferator-activated receptor α; PPARγ = peroxisome proliferator-activated receptor γ; SREBP-1 = sterol
regulatory element-binding protein-1; ACC = acetyl coenzyme A carboxylase; FAS = fatty acid synthase; apoB = apolipoprotein B; apoVLDL-II =
apolipoprotein VLDL-II; MTP = microsomal triglyceride transport protein; ACLY = adenosine triphosphate citrate lyase; ERα = estrogen receptor
α; CYP1A1 = cytochrome P450 1A1; CYP1B1 = cytochrome P450 1B1; CYP3A37 = cytochrome P450 3A37.
al., 2006). Previous studies have suggested that there
is no correlation between plasma E2 concentration and
egg production (Akiba et al., 1983; Pearce and Johnson, 1986). Moreover, exogenous E2 administration was
found to have no effect on egg production (Pearce and
Johnson, 1986). Brenes et al. (1985) reported that estrogen administration led to a significant reduction in
BW in laying hens, which is in agreement with the
results of the present study.
Effects on Lipid Parameters in Liver
and Blood
Liver weight increased with increasing concentrations
of E2 and were significantly different at the highest dose
(P < 0.05; Table 5). There were no significant differences in the relative weights of the spleen and abdominal
fat among groups. Pearce and Johnson (1986) reported
that E2 administration had no effect on the liver lipid
concentration, but others found that liver weight and
hepatic lipid deposition increased proportionately with
increasing doses of E2 in immature and mature chickens (Akiba et al., 1983; Brenes et al., 1985). Brenes
et al. (1985) reported that although E2 administration
increased the size, weight, and lipid content of the liver,
the BW was reduced. The weight of the abdominal fat
of hens increased with the fatty liver state (Ugochukwu, 1983). The relative weight of the abdominal fat of
hens treated with E2 in this study did not differ from
that of the control.
The activities of serum GOT and GPT and the concentrations of plasma E2 and VLDL in estrogenized
hens increased in a dose-dependent manner when compared with those of the control (P < 0.05; Table 6).
Measurement of the serum GOT and GPT activities
as indicators of liver damage in birds is a valuable tool
(Lumeiji, 1997). For example, So et al. (2009) found
higher activities of GOT in the serum of commercial
flocks with FLHS. They suggested that selected parameters of blood biochemistry, particularly GOT, could
be used to diagnose FLHS before significant liver damage occurred in commercial layers. These results are
consistent with the results of the present study. In hens
injected with E2, the circulating E2 increased from approximately 6,900 to 19,000 pg/mL, as expected. The
effects of E2 administration on the contents of various lipid fractions and malondialdehyde in the liver of
laying hens are shown in Table 7. There were no significant differences in the concentrations of cholesterol,
free cholesterol, and phospholipids in the liver among
Table 3. Effects of estradiol administration on laying percentage and BW of laying hens1
Estradiol
Item
Laying percentage
3 wk before injection
3 wk after injection
BW, g/bird
Before injection
After injection
Difference
a,bValues
1Values
Corn oil
0.5 mg/kg
1.0 mg/kg
81.90 ± 4.07
83.82 ± 4.02
2,013.89 ± 79.42
2,068.33 ± 81.02
54.44 ± 39.93a
81.90 ± 3.68
75.71 ± 5.19
2,108.33 ± 76.78
2,060.56 ± 79.61
−47.78 ± 15.26b
82.85 ± 3.83
69.53 ± 6.07
2,030.63 ± 71.51
1,990.00 ± 66.86
−40.63 ± 32.83b
with different superscripts differ significantly (P < 0.05).
are presented as the mean ± SE (n = 10, each group).
2664
Lee et al.
Table 4. Effects of estradiol administration on egg and eggshell qualities in laying hens1
Estradiol
Item
Corn oil
Eggshell color
Eggshell thickness, mm/100
Eggshell strength, kg/cm2
Haugh unit
Yolk color, Roche yolk color fan
1Values
27.18
34.90
2.82
90.82
7.13
±
±
±
±
±
0.5 mg/kg
0.47
0.25
0.06
0.92
0.07
27.19
33.82
2.62
89.58
7.06
±
±
±
±
±
0.55
0.33
0.06
1.29
0.16
1.0 mg/kg
28.51
34.34
2.72
88.05
7.06
±
±
±
±
±
0.42
0.40
0.07
1.28
0.04
are presented as the mean ± SE (n = 150, each group).
groups. The concentration of hepatic triacylglycerol of
estrogenized hens increased by approximately 3-fold
when compared with the control (Table 7). Our findings corroborate those of others who reported that the
relative weight of liver and the content of hepatic triacylglycerol increased in chickens treated with E2 (Akiba
et al., 1983; Takahashi and Jensen, 1984, 1985; Takahashi et al., 1984; Brenes et al., 1985).
Effects on mRNA Related
to Lipid Metabolism
All mRNA analyzed in this study were detected in
the liver of laying hens by real-time quantitative reverse
transcription-PCR (Figures 1, 2, and 3). Hens treated
with E2 had 4- to 23-fold higher relative mRNA concentrations of FAS, apoB, PPARγ, ACLY, and CYP3A37
in the liver (P < 0.05) and approximately 3-fold higher relative mRNA concentrations of ACC, SREBP-1,
ERα, and CYP1A1 than hens injected with corn oil.
Hepatic mRNA concentrations of PPARα (Figure 1),
apoVLDL-II, malic enzyme, and microsomal triglyceride transport protein (data not shown) did not differ among groups. The results clearly showed that the
mRNA of PPAR, SREBP, and genes involved in lipid
and estrogen was expressed in laying hens treated with
E2. Because few reports have been published evaluating
these effects in hens, it is difficult to make quantitative
conclusions regarding these matters.
Peroxisome proliferator-activated receptors are transcription factors that belong to the superfamily of nuclear receptors, and they control nutrient metabolism
and energy homeostasis (Desvergne and Wahli, 1999;
Chinetti et al., 2000; Duval et al., 2002). Peroxisome
proliferator-activated receptor α reduces circulating triacylglycerol levels via transcriptional modula-
tion of genes related to lipolysis, cellular uptake, and
β-oxidation of fatty acids and decreased synthesis of
fatty acids and triacylglycerols (Schoonjans et al., 1996;
Staels et al., 1998). The mechanisms underlying the
reduced synthesis of fatty acids and triacylglycerols
are not completely understood (König et al., 2009).
Peroxisome proliferator-activated receptor γ directly
modulates a large number of target genes that mediate glyceroneogenesis, lipid uptake, lipid synthesis, lipid
storage, and lipolysis (Jeninga et al., 2009). It has been
shown that chick livers also express PPAR that have
a high homology with the PPAR of mice, rats, and
humans (Diot and Douaire, 1999; Meng et al., 2005;
König et al., 2007). However, the function of PPAR
in laying hens has not yet been elucidated (König et
al., 2009). In mammals, lipogenesis is controlled by the
transcription factor family designated SREBP (Brown
and Goldstein, 1999). Sterol regulatory element-binding protein-1c, the major isoform in adult liver, preferentially activates genes required for fatty acid synthesis and their incorporation into triacylglycerols and
phospholipids (Horton et al., 2002; König et al., 2009).
Sterol regulatory element-binding protein-1c regulates
only lipogenic genes, such as ACC and FAS (Shimano,
2001; Wang et al., 2009).
The results of this study are interesting in that the
hepatic mRNA expression of PPARγ in estrogenized
hens was increased by 23-fold when compared with that
of control hens (Figure 1), and the mRNA expression
of lipogenic enzymes (ACC and FAS, which catalyze
fatty acid synthesis) in estrogenized hens was higher
than their expression in control hens (Figure 2). Acetyl
coenzyme A carboxylase and FAS, the major enzymes
related to fatty acid biosynthesis, act as rate-limiting
enzymes of lipogenesis. The results revealed that E2 administration upregulated the hepatic mRNA expression
Table 5. Effects of estradiol administration on the relative weights of liver, spleen, and abdominal
fat in laying hens1
Estradiol
Item, g/100 g
of BW
Corn oil
0.5 mg/kg
1.0 mg/kg
Liver
Spleen
Abdominal fat
1.87 ± 0.08b
77.64 ± 4.08
4.91 ± 0.39
2.09 ± 0.07ab
78.81 ± 4.50
5.19 ± 0.54
2.18 ± 0.09a
78.99 ± 4.46
5.69 ± 0.54
a,bValues
1Values
with different superscripts differ significantly (P < 0.05).
are presented as the mean ± SE (n = 10, each group).
2665
ESTRADIOL AND HEPATIC LIPID METABOLISM
Table 6. Effects of estradiol administration on the activities of glutamic-oxaloacetic transaminase
(GOT) and glutamic-pyruvic transaminase (GPT) in serum and concentrations of estradiol and very
low density lipoprotein (VLDL) in the plasma of laying hens1
Estradiol
Item
Corn oil
GOT, IU/L
GPT, IU/L
Estradiol, pg/mL
VLDL, mg/mL
82.53
5.10
119.30
0.33
±
±
±
±
0.5 mg/kg
0.87c
0.07b
11.82c
0.03c
104.40
9.73
6,901.20
0.65
±
±
±
±
1.0 mg/kg
6.20b
1.71a
723.66b
0.09b
123.70
11.53
19,152.60
0.98
±
±
±
±
8.27a
1.11a
1,359.70a
0.14a
a–cValues
1Values
within a row with different superscripts differ significantly (P < 0.05).
are presented as the mean ± SE (n = 10, each group).
of PPARγ, whereas PPARγ regulated lipid metabolism,
such as lipid uptake, lipid synthesis, and lipid storage
in laying hens, similar to that in mammals (Sato et.
al., 2009). Sato et al. (2004) suggest that PPARγ plays
an important role in the regulation of fat deposition
and egg production, and the characteristic pattern of
PPARγ mRNA expression may be indicative of specific differences in the lipid and glucose metabolism of
chickens compared with mammals. In addition, Sato et
al. (2009) demonstrated that PPARγ gene expression is
a useful marker of fat deposition in chickens, suggesting that PPARγ is a key factor in fat accumulation in
chickens.
No significant differences were observed in the hepatic
mRNA expression of PPARα and SREBP-1 in response
to E2 administration (Figure 1). It is assumed that E2
administration did not stimulate PPARα-mediated
lipid metabolism, such as lipolysis and β-oxidation of
fatty acids. As in mammals, hepatic gene expression of
FAS in avian species is modulated by SREBP-1 (Wang
et al., 2009). König et al. (2007) reported that hens
treated with clofibrate (synthetic PPARα agonist) had
lower mRNA concentrations of FAS than control hens,
whereas hepatic mRNA concentrations of SREBP-1 did
not differ between the 2 groups of hens. The authors
concluded that the concentration of mature SREBP-1
in the nucleus was reduced, which in turn led to reduced
mRNA concentration of FAS. The mRNA concentration of ACLY, which produces acetyl-coenzyme A, the
substrate of FAS in estrogenized hens, was significantly
increased by 4-fold when compared with that of the
control hens (P < 0.05; Figure 2). In addition, there
was no significant difference in the mRNA concentra-
tion of malic enzyme (data not shown). The mRNA
concentration of apoB, which is a cofactor of VLDL,
was significantly higher than that of control hens (P <
0.05; Figure 2). However, there was no difference in the
mRNA concentration of apoVLDL-II, which is a reproduction-specific apolipoprotein, among groups (data not
shown). Apolipoprotein B and apoVLDL-II are cofactors of VLDL, yolk-targeted VLDL, or both that lead
to the release of VLDL from the liver. Hepatic lipid biosynthesis was stimulated by estrogen in hens, whereas
cholesterol synthesis remained unchanged (Kudzma et
al., 1975; Dashti et al., 1983). Estrogen also dramatically stimulated hepatic apoB synthesis in birds (Williams, 1979; Capony and Williams, 1980; Kirchgessner
et al., 1987) and induced de novo synthesis of the reproduction-specific apolipoprotein apoVLDL-II (Chan et
al., 1976; Williams 1979; Walzem et al., 1999). It is unclear why the concentration of apoVLDL-II mRNA was
not increased. The hepatic mRNA expression of ERα
in estrogenized hens was increased by 3-fold when compared with that of control hens (Figure 3). Because the
circulating E2 concentration was also increased by E2
administration, this result seems reasonable. In mammals, CYP1A1 and CYP1B1 display the highest levels
of expression in breast tissue, whereas other phase I enzymes, such as CYP1A2 and CYP3A4, are involved in
hepatic and extrahepatic estrogen oxidation (Huang et
al., 1996; Shimada et al., 1996). In chickens, CYP3A37
catalyzes the hydroxylation of steroid hormones at rates
comparable with those of human CYP3A4 (Ourlin et
al., 2000). In the present study, there were no significant differences in mRNA concentrations of CYP1A1
and CYP1B1 among groups, and mRNA concentrations
Table 7. Effects of estradiol administration on the contents of various lipid fractions and malondialdehyde in the liver of laying hens1
Estradiol
Item
Corn oil
Cholesterol, mg/g
Free cholesterol, mg/g
Triacylglycerol, mg/g
Phospholipid, mg/g
Malondialdehyde, μg/g
a,bValues
1Values
4.03
1.90
41.72
16.52
0.23
±
±
±
±
±
0.07
0.05
5.69b
0.95
0.03b
0.5 mg/kg
4.89
2.46
126.65
18.95
0.34
±
±
±
±
±
0.22
0.33
11.19a
1.45
0.03a
within a row with different superscripts differ significantly (P < 0.05).
are presented as the mean ± SE (n = 10, each group).
1.0 mg/kg
4.86
2.05
103.72
21.82
0.28
±
±
±
±
±
0.23
0.08
21.43a
2.65
0.03ab
2666
Lee et al.
Figure 1. Effects of estradiol administration on the mRNA concentration of peroxisome proliferator-activated receptor (PPAR) α,
PPARγ, and sterol regulatory element-binding protein-1 (SREBP-1)
in the liver of laying hens. Total RNA was extracted from the liver,
and the relative mRNA concentrations of the genes were determined
by real-time reverse transcription-PCR analysis using the β-actin
mRNA concentration for normalization. Values are presented as the
means ± SE (n = 10, each group). Values with different letters (a, b)
differ significantly (P < 0.05).
of CYP3A37 in estrogenized hens were significantly
(4-fold) higher than those of control hens (P < 0.05;
Figure 3). These results indicate that the production
of CYP as phase I enzymes increased in estrogenized
hens, which led to catalysis of the hydroxylation of E2.
Cytochrome P450 also catalyzes the decomposition of
fatty acid hydroperoxide to a wide range of lipid freeradical products (O’Brien, 1984). These free radicals
can react with cellular components such as nucleic acids, proteins, and lipids to induce cellular damage. This
may be the key to the initiation of hemorrhages in hen
livers that contain a large amount of unsaturated fat
(Squires and Leeson, 1988).
In conclusion, the results presented here confirmed
that E2 administration induced lipid accumulation in
the liver of laying hens in a dose-dependent manner.
Figure 2. Effects of estradiol administration on the mRNA concentration of adenosine triphosphate citrate lyase (ACLY), acetyl coenzyme A carboxylase (ACC), fatty acid synthase (FAS), and apolipoprotein B (apoB) in the liver of laying hens. Total RNA was extracted
from the liver, and the relative mRNA concentrations of the genes
were determined by real-time reverse transcription-PCR analysis using
the β-actin mRNA concentration for normalization. Values are presented as the means ± SE (n = 10, each group). Values with different
letters (a–c) differ significantly (P < 0.05).
Figure 3. Effects of estradiol administration on the mRNA concentration of estrogen receptor α (ERα), cytochrome P450 1A1 (CYP1A1), cytochrome P450 1B1 (CYP1B1), and cytochrome P450 3A37
(CYP3A37) in the liver of laying hens. Total RNA was extracted from
the liver, and the relative mRNA concentrations of the genes were
determined by real-time reverse transcription-PCR analysis using the
β-actin mRNA concentration for normalization. Values are presented
as the means ± SE (n = 10, each group). Values with different letters
(a–c) differ significantly (P < 0.05).
Additionally, the present results suggest that E2 upregulates the synthesis of fatty acids and triacylglycerols and the accumulation of hepatic lipids by increasing mRNA expression related to lipid metabolism, such
as PPARγ, ACLY, FAS, and apoB, and that excess
E2 in blood leads to activate E2 catabolic metabolism
(CYP3A37)-related mRNA expression. These findings
should be useful as basic research data to develop research related to the FLHS of laying hens caused by
circulating estrogen.
REFERENCES
Akiba, Y., L. S. Jensen, and C. X. Mendonca. 1983. Laboratory
model with chicks for assay of nutritional factors affecting hepatic lipid accumulation in laying hens. Poult. Sci. 62:143–151.
An, B. K., K. Nishiyama, K. Tanaka, S. Ohtani, K. Iwata, K. Tsutsumi, and M. Kasai. 1997. Dietary safflower phospholipid reduces
liver lipids in laying hens. Poult. Sci. 76:689–695.
Belous, A. R., D. L. Hachey, S. Dawling, N. Roodi, and F. F. Parl.
2007. Cytochrome P450 1B1-mediated estrogen metabolism results in estrogen-deoxyribonucleoside adduct formation. Cancer
Res. 67:812–817.
Botsoglou, N. A., D. J. Fletouris, G. E. Papageorgiou, V. N. Vassilopoulos, A. J. Mantis, and A. G. Trakatellis. 1994. Rapid, sensitive, and specific thiobarbituric acid method for measuring lipid
peroxidation in animal tissue, food, and feedstuff samples. J.
Agric. Food Chem. 42:1931–1937.
Brenes, A., L. S. Jensen, K. Takahashi, and S. L. Bolden. 1985.
Dietary effects on content of hepatic lipid, plasma minerals, and
tissue ascorbic acid in hens and estrogenized chicks. Poult. Sci.
64:947–954.
Brown, M. S., and J. L. Goldstein. 1999. A proteolytic pathway that
controls the cholesterol content of membranes, cells, and blood.
Proc. Natl. Acad. Sci. USA 96:11041–11048.
Butler, E. J. 1976. Fatty liver disease in the domestic fowl. A review.
Avian Pathol. 5:1–14.
Capony, F., and D. L. Williams. 1980. Apolipoprotein B of avian
very low density lipoprotein: Characteristics of its regulation in
nonstimulated and estrogen-stimulated rooster. Biochemistry
19:2219–2226.
Chan, L., R. L. Jackson, B. W. O’Malley, and A. R. Means. 1976.
Synthesis of very low density lipoproteins in the cockerel. Effects
of estrogen. J. Clin. Invest. 58:368–379.
ESTRADIOL AND HEPATIC LIPID METABOLISM
Chinetti, G., J. C. Fruchart, and B. Staels. 2000. Peroxisome proliferator-activated receptors (PPARs): Nuclear receptors at the
crossroads between lipid metabolism and inflammation. Inflamm. Res. 49:497–505.
Couch, J. R. 1956. Fatty livers in laying hens—A condition which
may occur as a result of increased stress. Feedstuffs 28:46–54.
Crespo, N., and E. Esteve-Garcia. 2003. Polyunsaturated fatty acids
reduce insulin and very low density lipoprotein levels in broiler
chickens. Poult. Sci. 82:1134–1139.
Dashti, N., J. L. Kelley, R. H. Thayer, and J. A. Ontko. 1983. Concurrent inductions of avian hepatic lipogenesis, plasma lipids,
and plasma apolipoprotein B by estrogen. J. Lipid Res. 24:368–
380.
Desvergne, B., and W. Wahli. 1999. Peroxisome proliferator-activated receptors: Nuclear control of metabolism. Endocr. Rev.
20:649–688.
Diot, C., and M. Douaire. 1999. Characterization of a cDNA sequence encoding the peroxisome proliferator activated receptor α
in the chicken. Poult. Sci. 78:1198–1202.
Duncan, D. B. 1955. Multiple range and multiple F tests. Biometrics 11:1–42.
Duval, C., G. Chinetti, F. Trottein, J. C. Fruchart, and B. Staels.
2002. The role of PPARs in atherosclerosis. Trends Mol. Med.
8:422–430.
Griffin, H. D., and C. C. Whitehead. 1982. Plasma lipoprotein concentration as an indicator of fatness in broilers: Development and
use of a simple assay for plasma very low density lipoproteins.
Br. Poult. Sci. 23:307–313.
Hansen, R. J., and R. L. Walzem. 1993. Avian fatty liver hemorrhagic syndrome: A comparative review. Adv. Vet. Sci. Comp.
Med. 37:451–468.
Haugh, R. R. 1937. The Haugh unit for measuring egg quality. US
Egg Poult. Mag. 43:552–555, 572–573.
Horton, J. D., J. L. Goldstein, and M. S. Brown. 2002. SREBPs:
Activators of the complete program of cholesterol and fatty acid
synthesis in the liver. J. Clin. Invest. 109:1125–1131.
Huang, Z., M. J. Fasco, H. L. Figge, K. Keyomarsi, and L. S. Kaminsky. 1996. Expression of cytochromes P450 in human breast tissue and tumors. Drug Metab. Dispos. 24:899–905.
Jeninga, E. H., M. Gurnell, and E. Kalkhoven. 2009. Functional
implications of genetic variation in human PPARγ. Trends Endocrinol. Metab. 20:380–387.
Jensen, L. S. 1979. Control of liver lipid accumulation in laying
birds. Fed. Proc. 38:2631–2634.
Kirchgessner, T. G., C. Heinzmann, K. L. Svenson, D. A. Gordon,
M. Nicosia, H. G. Lebherz, A. J. Lusis, and D. L. Williams. 1987.
Regulation of chicken apolipoprotein B: Cloning, tissue distribution, and estrogen induction of mRNA. Gene 59:241–251.
König, B., A. Koch, J. Spielmann, C. Hilgenfeld, F. Hirche, G. I.
Stangl, and K. Eder. 2009. Activation of PPARα and PPARγ reduces triacylglycerol synthesis in rat hepatoma cells by reduction
of nuclear SREBP-1. Eur. J. Pharmacol. 605:23–30.
König, B., A. Koch, J. Spielmann, C. Hilgenfeld, G. I. Stangl, and
K. Eder. 2007. Activation of PPARα lowers synthesis and concentration of cholesterol by reduction of nuclear SREBP-2. Biochem. Pharmacol. 73:574–585.
Kudzma, D. J., F. St Claire, L. DeLallo, and S. J. Friedberg. 1975.
Mechanism of avian estrogen-induced hypertriglyceridemia: Evidence for overproduction of triglyceride. J. Lipid Res. 16:123–
133.
Leeson, S., G. J. Diaz, and J. D. Summers. 1995. Fatty liver hemorrhagic syndrome. Pages 55–68 in Poultry Metabolic Disorders
and Mycotoxins. University Books, Canada.
Lumeiji, J. T. 1997. Avian clinical biochemistry. Pages 857–883 in
Clinical Biochemistry of Domestic Animals. 5th ed. J. J. Kaneko,
J. W. Harvey, and M. L. Bruss, ed. Academic Press, Oxford,
UK.
Meng, H., H. Li, J. G. Zhao, and Z. L. Gu. 2005. Differential expression of peroxisome proliferator-activated receptors α and
γ gene in various chicken tissues. Domest. Anim. Endocrinol.
28:105–110.
2667
NRC. 1994. Nutrient Requirements of Poultry. 9th ed. Natl. Acad.
Press, Washington DC.
O’Brien, P. J. 1984. Multiple mechanisms of metabolic activation
of aromatic amine carcinogens. Pages 289–316 in Free Radicals
in Biology. Vol. 6. W. A. Pryor, ed. Academic Press, New York,
NY.
Onagbesan, O. M., S. Metayer, K. Tona, J. Williams, E. Decuypere,
and V. Bruggeman. 2006. Effects of genotype and feed allowance
on plasma luteinizing hormones, follicle-stimulating hormones,
progesterone, estradiol levels, follicle differentiation, and egg production rates of broiler breeder hens. Poult. Sci. 85:1245–1258.
Ourlin, J. C., M. Baader, D. Fraser, J. R. Halpert, and U. A. Meyer.
2000. Cloning and functional expression of a first inducible avian
cytochrome P450 of the CYP3A subfamily (CYP3A37). Arch.
Biochem. Biophys. 373:375–384.
Pearce, J., and A. H. Johnson. 1986. Failure of oestradiol administration to induce fatty liver haemorrhagic syndrome in the laying
hen. Br. Poult. Sci. 27:41–47.
SAS Institute. 2002. SAS/STAT User’s Guide: Statistics, Release 8.2
Edition. SAS Inst. Inc., Cary, NC.
Sato, K., H. Abe, T. Kono, M. Yamazaki, K. Nakashima, T. Kamada, and Y. Akiba. 2009. Changes in peroxisome proliferatoractivated receptor gamma gene expression of chicken abdominal
adipose tissue with different age, sex and genotype. Anim. Sci.
J. 80:322–327.
Sato, K., K. Fukao, Y. Seki, and Y. Akiba. 2004. Expression of the
chicken peroxisome proliferator-activated receptor-γ gene is influenced by aging, nutrition, and agonist administration. Poult.
Sci. 83:1342–1347.
Schoonjans, K., B. Staels, and J. Auwerx. 1996. Role of the peroxisome proliferator-activated receptor (PPAR) in mediating the
effects of fibrates and fatty acids on gene expression. J. Lipid
Res. 37:907–925.
Shimada, T., C. L. Hayes, and H. Yamazaki. 1996. Activation of
chemically diverse procarcinogens by human cytochrome P-450
1B1. Cancer Res. 56:2979–2984.
Shimano, H. 2001. Sterol regulatory element-binding proteins
(SREBPs): Transcriptional regulators of lipid synthetic genes.
Prog. Lipid Res. 40:439–452.
So, H. H., E. O. Jeon, S. H. Byun, and I. P. Mo. 2009. Early diagnosis of fatty liver-hemorrhagic syndrome using blood biochemistry
in commercial layers. Korean J. Poult. Sci. 36:165–175.
Squires, E. J., and S. Leeson. 1988. Aetiology of fatty liver syndrome
in laying hens. Br. Vet. J. 144:602–609.
Staels, B., J. Dallongeville, J. Auwerx, K. Schoonjans, E. Leitersdorf, and J. C. Fruchart. 1998. Mechanism of action of fibrates
on lipid and lipoprotein metabolism. Circulation 98:2088–2093.
Takahashi, K., and L. S. Jensen. 1984. Effect of dietary composition and estradiol implants on hepatic microsomal mixed function oxidase and lipid deposition in growing chicks. Poult. Sci.
63:2217–2224.
Takahashi, K., and L. S. Jensen. 1985. Liver response to diet and estrogen in White Leghorn and Rhode Island Red chickens. Poult.
Sci. 64:955–962.
Takahashi, K., L. S. Jensen, and S. L. Bolden. 1984. Diet composition, environmental temperature, and exogenous estradiol effects on hepatic lipid deposition in growing chicks. Poult. Sci.
63:524–531.
Ugochukwu, E. I. 1983. The involvement of diet in fatty liver haemorrhagic syndrome in Anabra state of Nigeria. Bull. Anim.
Health Prod. Afr. 31:157–160.
Walzem, R. L., R. J. Hansen, D. L. Williams, and R. L. Hamilton.
1999. Estrogen induction of VLDLy assembly in egg-laying hens.
J. Nutr. 129:467S–472S.
Wang, P. H., Y. H. Ko, H. J. Chin, C. Hsu, S. T. Ding, and C. Y.
Chen. 2009. The effect of feed restriction on expression of hepatic
lipogenic genes in broiler chickens and the function of SREBP1.
Comp. Biochem. Physiol. B Biochem. Mol. Biol. 153:327–331.
Williams, D. L. 1979. Apoproteins of avian very low density lipoprotein: Demonstration of a single high molecular weight apoprotein.
Biochemistry 18:1056–1063.