Am J Physiol Gastrointest Liver Physiol 303: G93–G102, 2012.
First published April 26, 2012; doi:10.1152/ajpgi.00016.2012.
Gut mucosal injury in neonates is marked by macrophage infiltration in contrast
to pleomorphic infiltrates in adult: evidence from an animal model
Krishnan MohanKumar,1,2,3 Niroop Kaza,4 Ramasamy Jagadeeswaran,1,2 Steven A. Garzon,5
Anchal Bansal,3 Ashish R. Kurundkar,4 Kopperuncholan Namachivayam,1,2 Juan I. Remon,1,2
C. Rekha Bandepalli,1,2 Xu Feng,4 Joern-Hendrik Weitkamp,6 and Akhil Maheshwari1,2,3,7
Departments of Pediatrics, 1Division of Neonatology and 2Center for Neonatal and Pediatric Gastrointestinal Disease,
5
Pathology, and 7Pharmacology, University of Illinois at Chicago, Chicago, Illinois; Departments of 3Pediatrics
and 4Pathology, University of Alabama at Birmingham, Birmingham, Alabama; 6Department of Pediatrics, Vanderbilt
University School of Medicine, Nashville, Tennessee
Submitted 12 January 2012; accepted in final form 19 April 2012
necrotizing enterocolitis; macrophage; CXCL5; LPS-induced CXC
chemokine; macrophage inflammatory protein-2; epithelial-derived
neutrophil chemoattractant-78
(NEC), an inflammatory bowel necrosis of preterm infants, is a leading cause of death among neonates
born before 32 wk of gestation or with a birth weight ⬍1,500 g
(24, 32). Although the etiology of NEC remains unclear, epide-
NECROTIZING ENTEROCOLITIS
Address for reprint requests and other correspondence: A. Maheshwari, 840 S
Wood St, CSB 1257, UIC m/c 856, Chicago, IL 60612 (e-mail: [email protected]).
http://www.ajpgi.org
miological studies show an association with diverse risk factors
such as maternal chorioamnionitis, perinatal asphyxia, indomethacin therapy, viral infections, and blood transfusions (24). Current
pathophysiological models suggest that NEC occurs when altered/
disrupted gut mucosal barrier in the preterm intestine allows
luminal bacteria to translocate across the epithelial barrier into the
lamina propria, triggering a severe mucosal inflammatory response and tissue damage (25).
The present study was designed to investigate the cellular
inflammatory response in NEC. In surgically resected tissue
samples of human NEC, we observed that these infiltrates were
comprised predominantly of macrophages along with a few neutrophils but not many lymphocytes. Existing clinical studies indicate that 1) the incidence of NEC peaks in premature infants at a
specific postmenstrual age (gestational age at birth ⫹ postnatal
age) of 32 wk of gestation (21, 46, 59), and 2) NEC is associated
with a host of very diverse risk factors that may not share a
plausible, unifying mechanism of injury (24, 32). Based on these
observations, we hypothesized that the pathoanatomy of NEC is
related not to a single etiological pathway but may instead represent a generic tissue injury response of the gastrointestinal tract at
a specific stage of development to a variety of insults. To investigate the effect of age on the cellular inflammatory response
during gut mucosal injury, we used the haptenic agent 2,4,6trinitrobenzene sulfonic acid (TNBS) as a nonspecific mucosal
insult in 10-day-old murine pups and adult mice. (44). Using this
TNBS-injury model, archived human tissue samples of NEC, and
other ex vivo models, we show that macrophage-rich leukocyte
infiltrates seen in NEC are a characteristic of inflammatory mucosal injury in the developing intestine. In our murine model, the
recruitment of macrophage precursors was mediated via CXCL5,
which is an important chemoattractant for myeloid cells in the
gastrointestinal tract (18, 56). CXCL5 expression was also significantly increased in human tissue samples, indicating that a similar
pathway may be at work in NEC.
MATERIALS AND METHODS
Human NEC and controls. Human intestinal tissues were collected
after approval by the local Institutional Review Board at University of
Illinois. Deidentified paraffin-embedded tissue sections of NEC were
compared with healthy tissue margins resected for indications other
than NEC (intestinal obstruction or spontaneous intestinal perforation;
n ⫽ 12 in each group). Deidentified, frozen tissue samples were
available for RNA isolation from 11 patients with NEC and 8 controls.
Mice. To induce enterocolitis, we administered TNBS (44) in 10-dayold and adult C57/BL6 mice (n ⫽ 25 animals per group; animals
0193-1857/12 Copyright © 2012 the American Physiological Society
G93
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.1 on June 18, 2017
MohanKumar K, Kaza N, Jagadeeswaran R, Garzon SA, Bansal
A, Kurundkar AR, Namachivayam K, Remon JI, Bandepalli CR,
Feng X, Weitkamp J-H, Maheshwari A. Gut mucosal injury in neonates is marked by macrophage infiltration in contrast to pleomorphic
infiltrates in adult: evidence from an animal model. Am J Physiol
Gastrointest Liver Physiol 303: G93–G102, 2012. First published April
26, 2012; doi:10.1152/ajpgi.00016.2012.—Necrotizing enterocolitis
(NEC) is an inflammatory bowel necrosis of premature infants. In tissue
samples of NEC, we identified numerous macrophages and a few neutrophils but not many lymphocytes. We hypothesized that these pathoanatomic characteristics of NEC represent a common tissue injury response of the gastrointestinal tract to a variety of insults at a specific stage
of gut development. To evaluate developmental changes in mucosal
inflammatory response, we used trinitrobenzene sulfonic acid (TNBS)induced inflammation as a nonspecific insult and compared mucosal
injury in newborn vs. adult mice. Enterocolitis was induced in 10-day-old
pups and adult mice (n ⫽ 25 animals per group) by administering TNBS
by gavage and enema. Leukocyte populations were enumerated in human
NEC and in murine TNBS-enterocolitis using quantitative immunofluorescence. Chemokine expression was measured using quantitative polymerase chain reaction, immunoblots, and immunohistochemistry. Macrophage recruitment was investigated ex vivo using intestinal tissueconditioned media and bone marrow-derived macrophages in a
microchemotaxis assay. Similar to human NEC, TNBS enterocolitis in
pups was marked by a macrophage-rich leukocyte infiltrate in affected
tissue. In contrast, TNBS-enterocolitis in adult mice was associated with
pleomorphic leukocyte infiltrates. Macrophage precursors were recruited
to murine neonatal gastrointestinal tract by the chemokine CXCL5, a
known chemoattractant for myeloid cells. We also demonstrated increased expression of CXCL5 in surgically resected tissue samples of
human NEC, indicating that a similar pathway was active in NEC. We
concluded that gut mucosal injury in the murine neonate is marked by a
macrophage-rich leukocyte infiltrate, which contrasts with the pleomorphic leukocyte infiltrates in adult mice. In murine neonatal enterocolitis,
macrophages were recruited to the inflamed gut mucosa by the chemokine CXCL5, indicating that CXCL5 and its cognate receptor CXCR2
merit further investigation as potential therapeutic targets in NEC.
G94
MACROPHAGES IN NEONATAL INTESTINAL INJURY
1.65 mM MgCl2, 220 mM each dNTPs, 250 nM primers, 200 ng total
small intestinal DNA and 22 U/ml Taq DNA polymerase in a 50-␮l
reaction. Amplification reactions were performed in 0.2-ml tubes using a
Applied Biosystems thermal cycler. The cycling parameters were 1 cycle
of 94°C ⫻ 8 min, 30 cycles of 94°C ⫻ 30 s, 55°C ⫻ 30 s, 72°C ⫻ 30
s, a 5-min hold at 72°C (Applied BioSystems thermocycler), and a
holding temperature of 4°C following the final cycle. PCR products were
resolved by DGGE using the Bio-Rad DCode apparatus. The denaturing
gel consisted of 8% (vol/vol) polyacrylamide (ratio of acrylamidebisacrylamide, 37.5:1), and 0.5 ⫻ Tris-acetate-EDTA buffer (pH 8.0).
One hundred percent denaturing acrylamide was defined as 7 M urea and
40% formamide or 8 M urea, 20% deionized formamide, 2% glycerol,
1⫻ TAE, 0.1% ammonium persulfate, and 0.05% tetramethylethylenediamine. One hour after polymerization, the gel was assembled onto the
apparatus. Twenty microliters of the PCR product was loaded, and the gel
was run with a denaturing gradient of 30% to 70% urea/formamide at 200
V for 5 min at and then overnight at 85 V in 0.5 ⫻ Tris-acetate-EDTA
buffer at a constant temperature of 60°C. The gels were stained with
AgNO3 as previously described. To allow a comparison between PCRDGGE gels, internal standards were used. After completion of electrophoresis, gels were stained with ethidium bromide (1 ␮g/ml) for 5 min.
Real-time PCR. Real-time PCR primers were designed using the
Beacon Design software (Bio-Rad, Hercules, CA). Cytokine mRNA
expression was measured using our previously described SYBR green
protocol; data were analyzed using the 2⫺⌬⌬CT method (1, 45).
Western blots. CXCL5 expression in intestinal tissue and exfoliated
intestinal epithelial cells was measured using our previously described
protocol (45).
ELISA. CXCL5 concentrations were measured in mouse sera, tissueconditioned media (T-CMs), and epithelial-conditioned media (E-CMs)
using a commercially available ELISA kit (R&D; catalog no. DY443).
Optical densities and standard concentrations were log-transformed, and
a linear equation was obtained (accepted if r2 ⱖ 0.95). CXCL5 concentrations in test samples were calculated by regression. The linear range of
measurement of the assay was 31.2–1,000 pg/ml.
Primary intestinal and bone marrow-derived macrophages. Murine intestinal macrophages were isolated by our previously described
density centrifugation and adherence protocol (25). Briefly, intestinal
tissue was washed with Hanks’ balanced-salt solution (HBSS) containing 1 mM DTT (Sigma) to remove any mucus. Tissues were next
treated with HBSS containing 1 mM EDTA (Sigma) twice for 20 min
each at 37°C, washed thrice, and then incubated in HBSS containing
1 mM collagenase type IV (Sigma) for 2 h at 37°C. Isolated cells were
suspended in 40% Percoll (Pharmacia Biotech, Baie d’Urfe, QC,
Canada), layered on to 75% Percoll, and centrifuged at 2,000 revolution/min for 20 min. Cells recovered from the interphase were
selected using CD11b microbeads (Miltenyi Biotec, Cambridge, MA)
and then allowed to adhere on polystyrene plates for 1 h. More than
90% adherent cells were confirmed as CD11b⫹ F4/80⫹ CD11cint
macrophages by fluorescence-activated cell sorting (antibodies form
BD Pharmingen, San Diego, CA) and immunocytochemistry (antibodies from eBiosciences).
Bone marrow-derived macrophages (BMDMs) were prepared from
10-day-old mice as described previously (58). Bone marrow cells
devoid of red blood cells were cultured in BMDM media containing
DMEM with 0.5% MEM essential amino acids, 0.5% MEM nonessential amino acids, 1% 1 mM HEPES, 0.1% ␤-mercaptoethanol, 10%
heat-inactivated fetal calf serum, 1% penicillin/streptomycin (all media products from Invitrogen, Carlsbad, CA), and 40 ng/ml monocyte
colony-stimulating factor (PeproTech, Rocky Hill, NJ) overnight.
Nonadherent cells were collected, and 1 ⫻ 107 cells were plated in
BMDM media per 150-mm plate. After 5 days of incubation, BMDMs
were collected from the plates by scraping. Cells were cultured in
granulomonocyte colony stimulating factor-free RPMI complete media for 24 h before chemotaxis assays were performed.
E-CM and T-CM. We prepared conditioned media from fresh murine
intestinal/colonic tissue using our previously reported protocol. T-CMs
AJP-Gastrointest Liver Physiol • doi:10.1152/ajpgi.00016.2012 • www.ajpgi.org
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.1 on June 18, 2017
reared under conventional conditions) by gavage and enema. Animals
were anesthetized in an isoflurane chamber, a 3.5-gauge French
silicone catheter was inserted into the stomach, the gastric contents
were removed, and TNBS (50 mg/kg total body wt dissolved in 30%
weight/volume ethanol) was administered by gavage. The catheter
was then inserted per rectum to a length of 1–2 cm, and another 50
mg/kg total body wt dose of TNBS was injected slowly as enema. In
preliminary experiments, we defined optimum doses and concentrations of TNBS concentrations to limit mortality in pups to ⱕ30%.
Animals were killed using CO2 inhalation at serial time points up to
48 h after TNBS administration. Control animals received vehicle
alone using the same technique described above. In some experiments, we administered TNBS in 10-day-old and adult mice (n ⫽ 5
each) reared under germ-free conditions (3). We also evaluated TNBS
enterocolitis in a small number of 5-day-old pups (n ⫽ 6). Intestinal
injury was graded as described previously (6): grade 0: no injury;
grade 1: mild separation of lamina propria; grade 2: moderate separation; grade 3: severe separation and/or edema in submucosa; grade
4: transmural injury. Severity of colitis was graded (6) as 0: no
inflammation; grade 1: low level leukocyte infiltration seen in ⬍10%
high-power fields (HPF), and no structural changes; grade 2: moderate
leukocyte infiltration in 10 –25% HPF, crypt elongation, mucosal
thickening, and no ulcerations; grade 3: high level leukocyte infiltration seen in 25–50% HPF, crypt elongation, infiltration beyond the
mucosal layer, thickening of the bowel wall, and superficial ulcerations; and grade 4: marked transmural leukocyte infiltration in ⬎50%
HPF, elongated and distorted crypts, bowel-wall thickening, and
extensive ulcerations.
Immunohistochemistry. Human tissues were stained (49) for HAM56
and epithelial-derived neutrophil chemoattractant (ENA)/CXC ligand 5
(CXCL5) using our previously described protocol (25). Briefly, tissue
sections were deparaffinized, and antigen retrieval was achieved using the
EZ-AR Common solution (Biogenex, San Remon, CA) per the manufacturer’s protocol. The slides were then treated with Proteinase K (20
␮g/ml) (Promega, Madison, WI) for 10 min at room temperature. The
sections were rinsed in PBS (5 min), blocked using SuperBlock T20
blocking buffer (Thermo Scientific, Rockford, IL) for 30 min at room
temperature, rinsed again in PBS, and then incubated (overnight, 4°C) in
appropriate primary antibody: mouse anti-human pan-macrophage
marker (HAM56)IgM (Abcam, Cambridge, MA), monoclonal mouse
anti-human CXCL5 (R&D, Minneapolis, MN), polyclonal rat anti-mouse
F4/80 (eBiosciences, San Diego, CA), mouse monoclonal anti-human/
mouse myeloperoxidase IgG2b (R&D), monoclonal rat anti-mouse CD3
IgG2a (Santa Cruz Biotechnology, Santa Cruz, CA), goat polyclonal
anti-mouse LPS-induced CXC chemokine/CXCL5 (R&D), goat polyclonal macrophage inflammatory protein-2/CXCL2 (R&D), and rabbit
polyclonal anti-mouse CXCR2 (Santa Cruz Biotechnology). Secondary
staining was performed at room temperature for 30 min with Alexa 488
or Alexa 568-conjugated chicken anti-rat, goat anti-mouse IgM, or rabbit
anti-goat antibody (Invitrogen, San Diego, CA). Controls included slides
with no primary antibody, appropriate isotype control, and with competing recombinant CXCL5. Cell nuclei were stained with 4=,6-diamidino2-phenylindole (DAPI; Calbiochem, San Diego, CA), diluted 1:1,000 in
PBS, applied for 3 min. Imaging was performed using a Zeiss Axiovert
fluorescence microscope. Macrophages were enumerated in five randomly chosen HPFs (⫻40) in the ulcerated area and on the edges of the
lesion and normalized against the total number of nuclei in the field.
PCR-denaturing gradient gel electrophoresis. Qualitative assessment
of gut bacterial flora was performed using PCR amplification of the
V6-V8 region of bacterial 16S ribosomal DNA followed by denaturing
gradient gel electrophoresis (DGGE) (54). Briefly, total genomic DNA
from the murine small intestine was extracted using the GenElute
Genomic DNA Miniprep Kit (Sigma-Aldrich). Bacterial 16s ribosomal
DNA was amplified by PCR using the primers Bac-1 GCCGCCGGGCCGCGGCCCGCCCGCCCGCGGGGG-, CACGGGGGACTACGTGCCAGCAGCC, and Bac2 -GGACTACCAGGGTATCTAATCC in a
reaction mixture comprised of 22 mM Tris·HCl, pH 8.4, 55 mM KCl,
G95
MACROPHAGES IN NEONATAL INTESTINAL INJURY
to collect migrated cells attached to the underside of the filter. The
fluorescence in each well was determined at 485/530 nm, and the number
of cells that migrated through the filter was computed by comparing the
fluorescence signal in test wells with that of the standard curve generated
from known numbers of fluorescence-labeled cells.
Statistical methods. Parametric and nonparametric tests were applied using the Sigma Stat 3.1.1 software (Systat, Point Richmond,
CA). The number of samples and statistical analyses are indicated in
each figure legend. Each sample was tested in duplicate. A P value of
⬍0.05 was considered significant.
RESULTS
Necrotizing enterocolitis is characterized by a macrophage-rich
inflammatory infiltrate. To characterize the leukocyte infiltrate in
NEC, we first examined hematoxylin and eosin-stained sections
from non-NEC premature intestinal tissue (n ⫽ 8; postmenstrual
age 27.2 ⫾ 3 wk; representative section shown in Fig. 1, A and B)
and compared those with tissue specimens of advanced NEC (n ⫽
15; postmenstrual age 29.1 ⫾ 2.6 wk; representative section
shown in Fig. 1, C and D). NEC was associated with a prominent
inflammatory infiltrate, comprised mainly of HAM56⫹ macrophages (12.8 ⫾ 1.1 cells/HPF in control tissue vs. 128.6 ⫾ 9.4
cells/HPF in NEC; P ⬍ 0.001). We also detected a modest
increase in the number of polymorphonuclear leukocytes (PMNs)
in NEC (7.7 ⫾ 1.7 cells/HPF in control tissue vs. 37.9 ⫾ 5.8
cells/HPF in NEC; P ⬍ 0.001). Interestingly, there was no
Fig. 1. Necrotizing enterocolitis (NEC) is characterized by a macrophage-rich inflammatory
infiltrate. A: normal premature intestine (jejunum) from a 2-wk-old neonate born at 28-wk
gestation showing normal cellularity and cryptvillus histoarchitecture (hematoxylin & eosin,
magnification ⫻100); inset: high-magnification
(⫻1,000) photomicrograph shows the normal
absence of inflammatory cells in the lamina
propria. B: fluorescence photomicrograph of a
serial section shows HAM56⫹ macrophages
(red) in the normal premature intestine. Nuclear
staining was obtained with 4=,6-diamidino-2phenylindole (DAPI) (blue); inset: highmagnification photomicrograph highlights the
cytoplasmic HAM56 staining in macrophages.
C: NEC in a 5-wk-old neonate born at 24-wk
gestation, showing epithelial necrosis and a
prominent inflammatory infiltrate; inset: many
infiltrating cells showed a macrophage-like appearance (large, rounded cells with eccentrically placed vesicular nuclei; black arrows),
although a few polymorphonuclear leukocytes
(PMNs) were also noted (white arrow). D: fluorescence photomicrograph of a serial section
highlights the predominance of HAM56⫹ macrophages (red) in NEC; inset: high-magnification photomicrograph shows HAM56-stained
macrophages with better resolution. E: bar diagrams (means ⫾ SE) show the number of
HAM56⫹ macrophages, PMNs, and lymphocytes per high-power field (HPF) in premature
intestine and in NEC. N ⫽ 15 cases of NEC and
8 controls. Groups were compared by MannWhitney U-test; ***P ⬍ 0.001; N.S. indicates
that differences were not significant.
AJP-Gastrointest Liver Physiol • doi:10.1152/ajpgi.00016.2012 • www.ajpgi.org
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.1 on June 18, 2017
were prepared by incubating intact intestinal tissue overnight in serumfree DMEM (1 ml/g tissue). To prepare E-CMs, intestinal epithelial cells
were isolated by treating the tissue with 0.2 M ethylenediaminetetraacetic
acid and 10 mM 2-mercaptoethanol in HBSS for 30 min, washed, and
then incubated in serum-free DMEM (1 ⫻ 106 cells/ml) for 18 h.
Conditioned media were sterile-filtered (0.2-mm syringe filter, Corningware, Corning, NY) and frozen at ⫺80°C.
Macrophage chemotaxis. Macrophage chemotaxis was measured using our previously described microchemotaxis method (48). Briefly,
BMDMs were stained with the fluorescence dye calcein-AM (2 ␮M;
Molecular Probes, Eugene, OR) and suspended in HBSS with 0.1% BSA
at a concentration of 1.1 ⫻ 106 cells/ml. T-CMs from untreated and
TNBS-treated intestines were placed in lower wells of microchemotaxis
chambers (ChemoTx System; NeuroProbe, Gaithersburg, MD). In some
wells, we added the T-CMs after preincubation for 30 min with excess
neutralizing anti-CXCL5 antibody (10 ␮g/ml; R&D). Additional experiments were performed after pretreatment of BMDMs with anti-CXCR2
antibody or with SB225002 (10 nM; Sigma), a small molecule inhibitor
of CXCR2. Recombinant murine CXCL5 (10 and 100 pM) standards
were included for positive control. A polycarbonate filter membrane (5
␮m pores; Neuro Probe, Gaithersburg, MD) was placed on the microchemotaxis chamber, and then 80,000 macrophages (72 ␮l, ⱖ98%
viability, suspended in HBSS plus 0.1% BSA) were placed in the upper
wells marked on the filter. Control wells contained 0 – 80,000 calceinstained cells per well to generate a standard curve. The microchemotaxis
chamber was incubated for 60 min (37°C, 5% CO2, humidified air). After
incubation, nonmigrated cells on the top of the filter were removed with
a smooth-edged wiper, and the plate was centrifuged at 200 g for 5 min
G96
MACROPHAGES IN NEONATAL INTESTINAL INJURY
nuclear leukocytes, and T-lymphocytes in TNBS-induced enterocolitis in pups vs. adult mice. As shown in representative photomicrographs and summarized in the bar diagrams in Fig. 3A,
TNBS-induced mucosal injury was associated with increased
number of macrophages in small intestine (16.3 ⫾ 2.3 cells/
HPF in control vs. 124 ⫾ 11.1 cells/HPF in TNBS-induced
injury; P ⬍ 0.001) and large intestine (26.8 ⫾ 3.6 cells/HPF in
control tissue vs. 272.6 ⫾ 30.7 cells/HPF in TNBS-induced
injury; P ⬍ 0.001). Similar to human NEC, there was a
moderate increase in PMNs. There was no change in the
number of lymphocytes. A similar predominance of macrophages was observed at 12 and 24 h after TNBS administration
(not depicted). In contrast, TNBS-induced mucosal injury in
adult mice was associated with a pleomorphic inflammatory
infiltrate as shown in Fig. 3B.
TNBS-induced gut mucosal injury in pups is associated with
increased mRNA expression of the chemokines CXCL5 and
CXCL2. To determine the mechanism(s) by which macrophage
precursors are recruited to areas of gut mucosal injury in mouse
pups, we used a PCR-based array to compare tissue expression
of key chemokines/cytokines in the intestine (not depicted) and
colon (Fig. 4) from pups and adult animals. We detected
increased interleukin (IL)-12 and interferon-␥ expression in
adult mice with TNBS-enterocolitis, which was consistent with
previous reports (44), but not in pups. TNBS enterocolitis
increased the expression of transforming growth factor
(TGF)-␤2 in adult mice but inhibited its expression in pups;
this dichotomous change was consistent with our previously
reported findings in NEC (25). TNBS enterocolitis increased
Fig. 2. Trinitrobenzene sulfonic acid (TNBS)
administration by gavage and enema in 10day-old pups and adult mice induces inflammatory mucosal injury in both small intestine
and colon. A: photomicrographs (hematoxylin
& eosin, ⫻100) of distal jejunum (left) and
colon (right) from 10-day-old pups. Tissue
sections from sham-treated pups with no injury (top), TNBS-induced mild injury (middle), and TNBS-induced severe injury (bottom). B: photomicrographs of distal jejunum
(left) and colon (right) from adult mice after
sham (top) and TNBS treatment (bottom).
Column scatter plots on the right show the
frequency distribution of the injury grade in
pups (top) and adult mice (bottom). N ⫽ 25
animals per group. Groups were compared by
Mann-Whitney U-test, ***P ⬍ 0.001. C: representative photomicrographs of distal jejunum (left) and colon (right) from germ-free
pups treated with TNBS treatment show minimal injury to intestinal villi and intact colonic
mucosa. D: 16S rRNA PCR-DGGE gels run
on colonic tissue from 10-day-old pups (1),
adults (2), and germ-free pups (3). Gels from
10-day-old pups show numerous bands in
10-day-old pups, confirming the presence of
bacterial flora. Adult mice showed greater
diversity of bacterial flora than pups. No
bands were detected in germ-free animals.
Data represent 3 separate experiments.
AJP-Gastrointest Liver Physiol • doi:10.1152/ajpgi.00016.2012 • www.ajpgi.org
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.1 on June 18, 2017
difference in the number of lymphocytes in NEC and control
specimens.
TNBS administration by gavage and enema in 10-day-old pups
and adult mice induces inflammatory mucosal injury in both small
intestine and colon. To investigate the hypothesis that macrophage infiltration in NEC is a generic pathoanatomic feature of
gut mucosal injury in the developing intestine, we administered
TNBS by gavage and enema in 10-day-old mouse pups and adult
mice and observed these animals for up to 48 h. TNBS caused
inflammatory mucosal injury in both small and large intestine in
pups (Fig. 2A) and adult mice (Fig. 2B). Pups sustained more
severe injury in both the small intestine (median 3, range 0 – 4 in
pups vs. 2, 0 –3 in adult mice; P ⫽ 0.003) as well as colon
(median 2, range 0 – 4 in pups vs. 1, 0 –3 in adult mice; P ⫽
0.003). Consistent with previous reports, the same dose of TNBS
produced only minimal mucosal damage in germ-free pups, indicating that gut microbial flora was essential for the development
of TNBS-induced enterocolitis (Fig. 2, C and D). To ensure that
the inflammatory changes we observed in 10-day-old pups were
not an artifact of this specific postnatal time point, we also
performed the experiment in a small number of 5-day-old mouse
pups (n ⫽ 6). These animals also developed gut mucosal inflammation that was similar to the 10-day-old pups with prominent,
macrophage-rich leukocyte infiltrates in the lamina propria (data
not depicted).
TNBS-induced mucosal injury was characterized by a macrophage-rich infiltrate in pups but a pleomorphic inflammatory
response in adult mice. We next used quantitative immunofluorescence to enumerate the number of macrophages, polymorpho-
MACROPHAGES IN NEONATAL INTESTINAL INJURY
IL-1␣ exclusively in pups, whereas IL-1␤ was upregulated in
both pups and adult mice. Compared with adult mice, TNBSenterocolitis in pups was associated with increased expression
of CXCL5 (84.1 ⫾ 8.5-fold vs. 2.3 ⫾ 2.2-fold; P ⬍ 0.05) and
G97
Fig. 3. TNBS-induced mucosal injury was characterized by a macrophagerich infiltrate in pups but a pleomorphic inflammatory response in adult mice.
A: TNBS-induced mucosal inflammatory response in 10-day-old mouse pups.
Fluorescence photomicrographs (magnification ⫻250) of distal jejunum and
colon from control and TNBS-treated pups show immunostaining for F4/80,
myeloperoxidase (MPO), and CD3 (all green), which was used to enumerate
macrophages, PMNs, and lymphocytes, respectively; nuclear staining was
obtained with DAPI (blue). TNBS-induced mucosal injury was associated with
an increase in macrophages in both small and large intestine. There was a small
increase in PMNs, but the number of lymphocytes did not change significantly.
Asterisk on the immunofluorescence panel showing myeloperoxidase staining indicates nonspecific staining on the edge of the tissue. Bar diagrams
(means ⫾ SE) show the number of F4/80, myeloperoxidase, and CD3-positive
cells per HPF. Cells were counted in fields with at least 10 villi or 10 colonic
crypts. N ⫽ 5 animals per group. Groups compared by Mann-Whitney U-test,
*P ⬍ 0.05; **P ⬍ 0.01, and ***P ⬍ 0.001. B: TNBS-induced mucosal
inflammatory response in adult mice. Fluorescence photomicrographs of distal
jejunum and colon from control and TNBS-treated adult mice show immunostaining for F4/80, myeloperoxidase, and CD3. TNBS-induced mucosal injury
in mature animals was associated with a smaller increase in macrophages in
small and large intestine than in pups, whereas the increase in PMNs and
lymphocytes was more robust. Bar diagrams (means ⫾ SE) show the number
of F4/80, myeloperoxidase, and CD3-positive cells per HPF; n ⫽ 5 per group;
data were analyzed as described in A.
AJP-Gastrointest Liver Physiol • doi:10.1152/ajpgi.00016.2012 • www.ajpgi.org
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.1 on June 18, 2017
CXCL2 (30.6 ⫾ 6.5-fold vs. 2.3 ⫾ 1.3-fold; P ⬍ 0.05). There
was a trend toward increased CCL4 expression that did not
reach statistical significance.
TNBS-induced gut mucosal injury in pups is associated with
increased CXCL5 expression in affected tissues and in sera.
We first used immunohistochemistry to localize CXCL5 in
intestinal tissue from control and TNBS-treated mice. CXCL5
was detected in the epithelial and muscularis layers in TNBStreated but not in control animals (Fig. 5A). In contrast,
CXCL2 was detected exclusively in the infiltrating F4/80⫹
macrophages (Fig. 5A, inset). We interpreted these differences
in the cellular origin of the two chemokines to identify CXCL5
to be a primary initiator of macrophage recruitment and
CXCL2 as a secondary “amplifier” of this process. Therefore,
we focused on CXCL5 in subsequent experiments. Using
Western blots, we confirmed increased expression of CXCL5
protein in TNBS enterocolitis (Fig. 5B). We also detected
increased expression of CXCL5 in T-CMs, E-CMs, and sera
from mouse pups with TNBS enterocolitis (Fig. 5C).
CXCL5 recruits macrophages to the gastrointestinal tract during
inflammatory mucosal injury in mouse pups. To determine whether
CXCL5 recruits macrophage precursors during TNBS enterocolitis, we first confirmed the expression of CXCR2 (cognate receptor for CXCL5) on murine intestinal macrophages using immunohistochemistry and flow cytometry (detected on 97.1 ⫾ 2.2%
cells; Fig. 6A). Because differentiated intestinal macrophages do
not migrate consistently along chemokine gradients (48), we
hypothesized that macrophage infiltration at sites of mucosal
inflammation resulted from the recruitment of macrophage precursors and used BMDMs as a model of gut macrophage precursors. CXCR2 expression on BMDMs was confirmed by flow
cytometry (48.3 ⫾ 8.1% cells) and immunocytochemistry (variable but uniformly positive staining on all cells; not depicted).
We next used BMDMs in a microchemotaxis assay to measure
macrophage chemotactic activity of TNBS T-CMs. As shown in
Fig. 6B, T-CMs prepared from TNBS mice had greater macrophage chemotactic activity than T-CMs from control mice. Macrophage chemotactic activity of TNBS T-CMs was blocked by the
G98
MACROPHAGES IN NEONATAL INTESTINAL INJURY
Fig. 4. TNBS-induced gut mucosal injury in pups is associated with increased mRNA expression of the chemokines CXCL5 and CXCL2. Bar diagrams (means ⫾ SE)
show fold change in mRNA expression of major cytokines/chemokines in TNBS-induced colonic injury above
control in 10-day-old pups and adult mice. N ⫽ 5 animals
per group. Crossing-threshold (⌬⌬CT) values for genes
with a ⱖ2-fold increase were compared by MannWhitney U-test; *P ⬍ 0.05. Differences that did not reach
statistical significance were left unmarked.
Human NEC is associated with increased tissue expression
of ENA-78/CXCL5. Murine CXCL5 is similar to its human
homologue ENA-78/CXCL5 [identities ⫽ 60/117 (51%), positives ⫽ 76/117 (65%), gaps ⫽ 4/117 (3%); e-value ⫽ 4e-29]
(11). To validate our findings in NEC, we measured CXCL5
expression in a small set of tissue samples of NEC. CXCL5
Fig. 5. TNBS-induced gut mucosal injury in
pups is associated with increased CXCL5 expression in affected tissues and in sera. A: fluorescence photomicrographs (magnification
⫻1,000) of colonic tissue from control and
TNBS-treated mouse pups. CXCL5 (green) was
immunolocalized to the epithelium and muscularis layers. Nuclear staining (blue) was obtained
with DAPI. Inset: photomicrographs (⫻400)
show CXCL2 expression exclusively in F4/80⫹
macrophages and not in primary intestinal cells.
B: western immunoblots show increased
CXCL5 expression in jejunoileal tissue and colon from TNBS-treated pups. Bar-diagrams
(means ⫾ SE) show densitometric units for
CXCL5 bands normalized against ␤-actin in
each sample. N ⫽ 5 per group. Groups compared by Mann-Whitney U-test; **P ⬍ 0.01,
and ***P ⬍ 0.001. C: bar diagrams (means ⫾
SE) show that tissue-conditioned media
(T-CMs) and epithelial-conditioned media
(E-CMs) prepared from TNBS-treated pups and
serum samples contained higher concentrations of
CXCL5 than from controls. N ⫽ 5 per group;
statistical analysis as in Fig. 4A.
AJP-Gastrointest Liver Physiol • doi:10.1152/ajpgi.00016.2012 • www.ajpgi.org
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.1 on June 18, 2017
addition of neutralizing anti-CXCL5 antibody to the T-CMs,
indicating its important role in the recruitment of macrophage
precursors to the TNBS intestine. In support of these data, macrophage chemotaxis toward TNBS T-CMs was also blocked by
prior treatment of macrophages with either anti-CXCR2 antibody
or with SB225005, a small molecule inhibitor of CXCR2.
MACROPHAGES IN NEONATAL INTESTINAL INJURY
G99
mRNA expression in NEC was increased significantly over
control tissues (Fig. 7). Consistent with these data, we detected
CXCL5 protein in the epithelium in tissue samples of NEC but
not in normal preterm intestinal tissue (Fig. 7, inset).
DISCUSSION
We present a detailed investigation into the mechanism(s) by
which macrophage precursors are recruited to areas of tissue
injury during NEC and identify CXCL5 and its cognate receptor,
CXCR2, as potential therapeutic targets in NEC. We also propose
a novel pathophysiological model of NEC, where its pathoanatomic characteristics represent an integrated tissue injury response
related to a specific stage of gut development rather than to
specific etiological factor(s). Such a model would adequately
explain the occurrence of NEC almost exclusively in preterm
infants, even though gut barrier dysfunction and bacterial translocation are frequently encountered in critically ill patients of all
ages (33). In this schema, NEC, which is a clinical and histopathological diagnosis, could be conceptualized not as a single
nosological entity but as a group of conditions with shared
clinico-pathological manifestations; an appropriate simile could
be drawn from our current understanding of hepatic cirrhosis,
where diverse etiological factors such as genetic mutations, viruses, and environmental toxins can produce similar clinical
features and histoarchitectural changes in the liver.
We detected a marked increase in the number of macrophages
in our tissue samples of NEC. Pender et al. (38) have previously
described the characteristics of the inflammatory response in a
small cohort (n ⫽ 9) of patients with NEC. Although these
investigators did not investigate the mechanism of leukocyte
infiltration in their study, they detected a similar increase in the
number of CD68⫹ macrophages in affected tissue. They also
detected increased expression of tumor necrosis factor in NEC,
thereby providing indirect evidence for the activated, inflammatory nature of these macrophages. Macrophages in the adult
intestine display a profound inflammatory “anergy” to bacterial
products, a unique adaptation to maintain the absence of inflammation in the normal gut mucosa despite close physical proximity
to luminal bacteria (49). In contrast, macrophages in the preterm
intestine are yet to undergo this inflammatory downregulation
and respond to bacterial products with exaggerated cytokine/
chemokine responses (25). Understanding the mechanism(s) by
which macrophages accumulate at sites of tissue injury during
NEC is an important step in the development of novel antiinflammatory therapies that can prevent/ameliorate tissue damage
in NEC.
We used TNBS-induced enterocolitis in murine pups and adult
mice as a nonspecific mucosal insult. The major advantage of
using a chemical agent to induce mucosal inflammation was that
the dose of the inciting agent (TNBS) could be normalized against
AJP-Gastrointest Liver Physiol • doi:10.1152/ajpgi.00016.2012 • www.ajpgi.org
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.1 on June 18, 2017
Fig. 6. CXCL5 recruits macrophages to the gastrointestinal tract during inflammatory mucosal injury in mouse
pups. A: intestinal macrophages express CXCR2, the
cognate receptor for CXCL5. Fluorescence photomicrographs (⫻1,000) show CXCR2 staining on intestinal
macrophages in the lamina propria. Photomicrographs
on the right show a cross-sectional view through a villus,
where CXCR2 colocalizes with the macrophage marker
F4/80. Representative histograms on the extreme right
show CXCR2 expression on CD11b⫹ CD11cint intestinal
macrophages (top), and on bone marrow-derived macrophages (BMDMs) (bottom). B: T-CMs prepared from
TNBS-treated colons showed greater macrophage chemoattractant activity than controls. As depicted in the
schematic, macrophage chemotactic activity of T-CMs
was measured using BMDMs in a fluorescence-based
assay. Bar diagram (means ⫾ SE) summarizes the number of cells migrating through a polycarbonate filter toward
standards or test samples. Standards (shaded bars) included
a range of concentrations of recombinant murine CXCL5
(200 –2,000 pg/ml). Macrophage chemotactic activity of
TNBS-T-CMs was blocked by neutralizing anti-CXCL5
antibody or when BMDMs were pretreated with antiCXCR2 antibody or with SB225002, a small molecule
inhibitor of CXCR2. Data represent 3 separate experiments.
Groups were compared by Kruskal-Wallis H-test/Dunn’s
multiple-comparison post test; **P ⬍ 0.01, ***P ⬍ 0.001.
G100
MACROPHAGES IN NEONATAL INTESTINAL INJURY
the body weight of the animal, which allowed comparison of
mucosal injury across age groups. An added theoretical advantage
was that TNBS-induced enterocolitis requires the presence of
luminal bacteria (44), which is also the case in NEC (24, 29). We
chose TNBS enterocolitis after careful evaluation of existing
animal models of neonatal gut mucosal injury, which were not
suitable for age-based comparisons. In the rodent models of NEC,
newborn rats (25) or 10-day-old mouse pups (25, 50) are provided
formula feedings and exposed to hypoxia and hypothermia twice
a day for up to 4 days, which induces intestinal injury in up to
70 – 80% rats or 30 – 40% mouse pups. This model was not
suitable for the present study because it does not induce injury in
adult animals. In other studies, parenteral (intra-arterial/
intraperitoneal) administration of platelet-activating factor and
Escherichia coli LPS was used to induce gut mucosal injury. In
this model, the animals are killed after 2–3 h of treatment (16).
AJP-Gastrointest Liver Physiol • doi:10.1152/ajpgi.00016.2012 • www.ajpgi.org
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.1 on June 18, 2017
Fig. 7. Human NEC is associated with increased tissue expression of epithelialderived neutrophil chemoattractant-78 (ENA-78)/CXCL5. Scatter bar diagram
shows fold change (above control) in ENA-78/CXCL5 mRNA expression in tissue
samples of human NEC vs. controls, measured by real-time PCR. Data represent
8 controls and 11 samples of NEC. Crossing-threshold (⌬⌬CT) values were
compared by Mann-Whitney U-test. Representative fluorescence photomicrographs (⫻250) in inset show immunofluorescence staining for CXCL5 in normal
premature intestine (jejunum; 3-wk-old neonate born at 27-wk gestation) and in
NEC (jejunum; 4-wk-old neonate born at 26-wk gestation). CXCL5 staining was
detected in epithelium in NEC but not in control tissue.
Although this model is a useful screening tool for the investigation
of inflammatory signaling, its short duration limits its value in the
study of leukocyte trafficking (20). Intestinal ischemia-reperfusion
injury, induced by superior mesenteric artery occlusion, is another
short-duration model (2–3 h) with similar limitations (23). We
opted against the use of live infectious agents such as Enterobacter sakazakii (17) because the dose of the inciting agent (density
of Enterobacter population in the gut lumen) is difficult to control
and normalize by body weight/size of the animal. We also evaluated models of NEC-like injury in experimental animals such as
rabbits (37), quails (5), and piglets (42) but did not find a suitable
way to induce comparable mucosal injury in adult animals.
TNBS-mediated mucosal injury was particularly suitable for agebased comparisons because TNBS colitis in adult mice is associated with a striking increase in the number of T-lymphocytes with
relatively few macrophages (7, 15, 35, 36, 44), which contrasted
with the leukocyte infiltrates we observed in NEC. Therefore, if
the null hypothesis was to be disproven and we were to detect
abundant macrophages but few lymphocytes in neonatal TNBS
enterocolitis, we anticipated these differences to be significant.
We chose the postnatal age of 10 days for the pups to ensure
postnatal bacterial colonization and for ease of comparison with
previous studies that have used animals at this specific postnatal
age (25, 50). It was convenient that the rodent neonatal intestine,
which has been compared with the preterm human intestine, takes
nearly 3 wk to undergo structural and functional maturation to
levels seen in the full-term human neonate (6, 13, 30, 34, 55).
We detected important differences in the inflammatory response in TNBS-enterocolitis in pups vs. adult mice. In adult
mice, rectal instillation of TNBS causes colitis that resembles
Crohn’s disease with its T-helper 1 (Th1) lymphocyte response
and induction of proinflammatory cytokines such as IFN-␥,
TNF-␣, and IL-12 (44). To induce inflammatory changes in both
the small and large intestine, we modified the colitis protocol (44)
and administered a weight-normalized dose of TNBS in 10-dayold pups by both gavage and enema. We (25, 27), as others (31),
have previously documented the “proinflammatory bias” in the
developing intestine and had therefore anticipated the pups to
sustain more severe mucosal injury than adults when challenged
with a similar inflammatory stimulus. However, the mechanisms
underlying the observed differences in the leukocyte infiltrates
were unclear. Similar to our observations in NEC, pups with
TNBS-enterocolitis showed leukocyte infiltrates comprised predominantly of macrophages and a few neutrophils. These findings
in pups with TNBS enterocolitis contrasted with TNBS-treated in
adult animals, which developed pleomorphic leukocyte infiltrates.
Although age-related differences in cytokine/chemokine expression can account for these findings, maturational differences in the
development of gut leukocyte populations are also likely to play
an important role in the relative composition of leukocyte infiltrates during inflammatory injury. Macrophages are the first leukocytes to appear in the developing intestine, and the intestinal
macrophage pool approaches mature levels in both its size and
function by midgestation (2, 22, 26). In contrast, gut lymphocyte
populations appear during fetal development a few weeks after
macrophages but remain limited in size and repertoire until postnatal bacterial colonization and weaning (19, 22, 40). There were
significant regional differences in the cellular inflammatory response between the small and large intestine, emphasizing the
need to compare similar regions of the gastrointestinal tract when
evaluating clinical specimens of NEC.
MACROPHAGES IN NEONATAL INTESTINAL INJURY
data in rodent pups precludes the use of robust statistical tools
such as multivariate regression analysis to dissect the relative
contribution of the clinical course of the animals, their feeding
experience, and the microbial flora.
GRANTS
This work was supported by the National Institutes of Health awards
HD059142 (A. Maheshwari), HD061607 (J.-H. Weitkamp), and a research
grant from the CACA Jones Family Foundation (A. Maheshwari).
DISCLOSURES
No conflicts of interest, financial or otherwise, are declared by the authors.
AUTHOR CONTRIBUTIONS
Author contributions: K.M., N.K., A.R.K., and A.M. conception and design
of research; K.M., N.K., R.J., S.A.G., A.B., A.R.K., K.N., J.I.R., R.B., X.F.,
J.-H.W., and A.M. performed experiments; K.M., S.A.G., K.N., R.B., J.-H.W.,
and A.M. analyzed data; K.M., K.N., and A.M. interpreted results of experiments; K.M., R.J., and A.M. prepared figures; K.M. and A.M. drafted manuscript; K.M., X.F., J.-H.W., and A.M. edited and revised manuscript; K.M.,
N.K., R.J., S.A.G., A.B., A.R.K., K.N., J.I.R., R.B., X.F., J.-H.W., and A.M.
approved final version of manuscript.
REFERENCES
1. Benjamin JT, Smith RJ, Halloran BA, Day TJ, Kelly DR, Prince LS.
FGF-10 is decreased in bronchopulmonary dysplasia and suppressed by
Toll-like receptor activation. Am J Physiol Lung Cell Mol Physiol 292:
L550 –L558, 2007.
2. Braegger CP, Spencer J, MacDonald TT. Ontogenetic aspects of the
intestinal immune system in man. Int J Clin Lab Res 22: 1–4, 1992.
3. Bullard DC, Hu X, Adams JE, Schoeb TR, Barnum SR. p150/95
(CD11c/CD18) expression is required for the development of experimental autoimmune encephalomyelitis. Am J Pathol 170: 2001–2008, 2007.
4. Burl S, Townend J, Njie-Jobe J, Cox M, Adetifa UJ, Touray E, Philbin
VJ, Mancuso C, Kampmann B, Whittle H, Jaye A, Flanagan KL, Levy
O. Age-dependent maturation of Toll-like receptor-mediated cytokine
responses in Gambian infants. PLoS One 6: e18185, 2011.
5. Butel MJ, Waligora-Dupriet AJ, Szylit O. Oligofructose and experimental model of neonatal necrotising enterocolitis. Br J Nutr 87, Suppl 2:
S213–S219, 2002.
6. Carlile AE, Beck F. Maturation of the ileal epithelium in the young rat.
J Anat 137: 357–369, 1983.
7. Chen DF, Gong BD, Xie Q, Ben QW, Liu J, Yuan YZ. MicroRNA155
is induced in activated CD4(⫹) T cells of TNBS-induced colitis in mice.
World J Gastroenterol 16: 854 –861, 2010.
8. Eisenfeld L, Krause PJ, Herson V, Savidakis J, Bannon P, Maderazo
E, Woronick C, Giuliano C, Banco L. Longitudinal study of neutrophil
adherence and motility. J Pediatr 117: 926 –929, 1990.
9. Fida NM, Al-Mughales J, Farouq M. Interleukin-1alpha, interleukin-6
and tumor necrosis factor-alpha levels in children with sepsis and meningitis. Pediatr Int 48: 118 –124, 2006.
10. Fox SE, Lu W, Maheshwari A, Christensen RD, Calhoun DA. The
effects and comparative differences of neutrophil specific chemokines on
neutrophil chemotaxis of the neonate. Cytokine 29: 135–140, 2005.
11. Gish W, States DJ. Identification of protein coding regions by database
similarity search. Nat Genet 3: 266 –272, 1993.
12. Harris MC, Costarino AT Jr, Sullivan JS, Dulkerian S, McCawley L,
Corcoran L, Butler S, Kilpatrick L. Cytokine elevations in critically ill infants
with sepsis and necrotizing enterocolitis. J Pediatr 124: 105–111, 1994.
13. Henning SJ. Development of the gastrointestinal tract. Proc Nutr Soc 45:
39 –44, 1986.
14. Hernandez M, Gamonal J, Salo T, Tervahartiala T, Hukkanen M,
Tjaderhane L, Sorsa T. Reduced expression of lipopolysaccharideinduced CXC chemokine in Porphyromonas gingivalis-induced experimental periodontitis in matrix metalloproteinase-8 null mice. J Periodontal Res 46: 58 –66, 2011.
15. Hoffmann JC, Peters K, Henschke S, Herrmann B, Pfister K, Westermann J, Zeitz M. Role of T lymphocytes in rat 2,4,6-trinitrobenzene
sulphonic acid (TNBS) induced colitis: increased mortality after gammadelta T cell depletion and no effect of alphabeta T cell depletion. Gut 48:
489 –495, 2001.
AJP-Gastrointest Liver Physiol • doi:10.1152/ajpgi.00016.2012 • www.ajpgi.org
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.1 on June 18, 2017
We detected important qualitative differences in the expression
of chemokines and inflammatory cytokines during gut mucosal
inflammation in pups and adult mice, even though the inciting
agent was administered in amounts that were normalized against
total body weight. Unlike in adult mice, which upregulated a wide
repertoire of cytokines/chemokines, TNBS enterocolitis in the pup
induced a very limited set of cytokines/chemokines. We detected
increased expression of CXCL5, CXCL2, and IL-1␣ in pups to
levels several fold higher than in adult animals. TNBS injury in
pups did not induce cytokines associated with TNBS colitis in
adult animals such as IFN-␥ and IL-12 (44), which is consistent
with existing data from human studies showing that neonates,
particularly those born at preterm gestation, are relatively deficient
in these two cytokines (39). The increase in IL-1␣ expression we
detected in pups is likely to have originated in the large number of
macrophages recruited to the inflamed tissues (41). Although
increased IL-1␣ expression has not been reported previously in
NEC, circulating IL-1␣ levels are increased in neonatal sepsis (9).
These findings are of interest in view of recent data indicating that
the gut microenvironment in the neonate may influence local
IL-1␣ expression (47). Finally, pups upregulated IL-1␤ to levels
comparable to those in adults, which is consistent with information that the inflammasome pathway is largely intact in the
neonate (4, 43).
We show increased expression of CXCL5 in pups with TNBSenterocolitis than in adult mice and also in tissue samples of
human NEC. These findings are consistent with existing information that human neonates have higher circulating CXCL5 concentrations than adults (52) and detection of elevated plasma CXCL5
concentrations in patients with NEC (12). The mechanism of
these developmental differences remains unclear although promoter methylation and micro-RNA-mediated mRNA instability
are plausible possibilities (53). Besides functioning as a chemokine for CXCR2⫹ cells such as neutrophils and monocytes/
macrophages (14), CXCL5 can also increase the bioavailability of
other CXC chemokines (such as CXCL2) by binding nonsignaling chemokine sinks such as the Duffy antigen receptor for
chemokines and heparan sulfate proteoglycans (28). Therefore,
increased CXCL5 expression during neonatal enterocolitis provides a unifying mechanism for the recruitment of both macrophages and neutrophils. The relative predominance of macrophages in these lesions (compared to neutrophils) is consistent
with differences in the functional maturation of neonatal macrophages vs. neutrophils; whereas macrophages attain functional
maturity by midgestation (51, 57), neonatal neutrophils remain
limited in their chemotactic capacity until up to 42 wk postmenstrual age (8, 10).
In conclusion, we show that the cellular inflammatory response
during mucosal injury is affected by the stage of gastrointestinal
development. We also show that macrophages were recruited to
the inflamed gut mucosa in murine neonatal enterocolitis by the
chemokine CXCL5, indicating that CXCL5 and its cognate receptor CXCR2 merit further investigation as potential therapeutic
targets in NEC. The present study has important limitations, in its
use of an animal model, the small sample size, and the lack of
information on the microbiota. We acknowledge that inflammatory changes induced by chemical agents such as TNBS, which
although acceptable in proof-of-concept studies, may not accurately simulate pathological changes in a natural disease process
and require further corroboration in other models. Finally, unlike
large animals, limited availability of clinical and demographic
G101
G102
MACROPHAGES IN NEONATAL INTESTINAL INJURY
39. Peoples JD, Cheung S, Nesin M, Lin H, Tatad AM, Hoang D, Perlman
JM, Cunningham-Rundles S. Neonatal cord blood subsets and cytokine
response to bacterial antigens. Am J Perinatol 26: 647–657, 2009.
40. Rognum TO, Thrane S, Stoltenberg L, Vege A, Brandtzaeg P. Development of intestinal mucosal immunity in fetal life and the first postnatal
months. Pediatr Res 32: 145–149, 1992.
41. Rugtveit J, Nilsen EM, Bakka A, Carlsen H, Brandtzaeg P, Scott H.
Cytokine profiles differ in newly recruited and resident subsets of mucosal
macrophages from inflammatory bowel disease. Gastroenterology 112:
1493–1505, 1997.
42. Sangild PT, Siggers RH, Schmidt M, Elnif J, Bjornvad CR, Thymann
T, Grondahl ML, Hansen AK, Jensen SK, Boye M, Moelbak L,
Buddington RK, Westrom BR, Holst JJ, Burrin DG. Diet- and colonization-dependent intestinal dysfunction predisposes to necrotizing enterocolitis in preterm pigs. Gastroenterology 130: 1776 –1792, 2006.
43. Sautois B, Fillet G, Beguin Y. Comparative cytokine production by in
vitro stimulated mononucleated cells from cord blood and adult blood. Exp
Hematol 25: 103–108, 1997.
44. Scheiffele F, Fuss IJ. Induction of TNBS colitis in mice. Curr Protoc
Immunol Chapter 15: Unit 15 19, 2002.
45. Shaik SS, Soltau TD, Chaturvedi G, Totapally B, Hagood JS, Andrews WW, Athar M, Voitenok NN, Killingsworth C, Patel RP, Fallon
MB, Maheshwari A. Low-intensity shear stress increases endothelial
ELR⫹ CXC chemokine production via a FAK-P38beta MAPK-NF-kappa
B pathway. J Biol Chem 284: 5945–5955, 2009.
46. Sharma R, Hudak ML, Tepas JJ 3rd, Wludyka PS, Marvin WJ,
Bradshaw JA, Pieper P. Impact of gestational age on the clinical
presentation and surgical outcome of necrotizing enterocolitis. J Perinatol
26: 342–347, 2006.
47. Siggers J, Sangild PT, Jensen TK, Siggers RH, Skovgaard K, Stoy AC,
Jensen BB, Thymann T, Bering SB, Boye M. Transition from parenteral
to enteral nutrition induces immediate diet-dependent gut histological and
immunological responses in preterm neonates. Am J Physiol Gastrointest
Liver Physiol 301: G435–G445, 2011.
48. Smythies LE, Maheshwari A, Clements R, Eckhoff D, Novak L, Vu HL,
Mosteller-Barnum LM, Sellers M, Smith PD. Mucosal IL-8 and TGF-beta
recruit blood monocytes: evidence for cross-talk between the lamina propria
stroma and myeloid cells. J Leukoc Biol 80: 492–499, 2006.
49. Smythies LE, Sellers M, Clements RH, Mosteller-Barnum M, Meng
G, Benjamin WH, Orenstein JM, Smith PD. Human intestinal macrophages display profound inflammatory anergy despite avid phagocytic and
bacteriocidal activity. J Clin Invest 115: 66 –75, 2005.
50. Sodhi CP, Shi XH, Richardson WM, Grant ZS, Shapiro RA, Prindle
T Jr, Branca M, Russo A, Gribar SC, Ma C, Hackam DJ. Toll-like
receptor-4 inhibits enterocyte proliferation via impaired beta-catenin signaling in necrotizing enterocolitis. Gastroenterology 138: 185–196, 2010.
51. Speer CP, Wieland M, Ulbrich R, Gahr M. Phagocytic activities in
neonatal monocytes. Eur J Pediatr 145: 418 –421, 1986.
52. Sullivan SE, Staba SL, Gersting JA, Hutson AD, Theriaque D, Christensen RD, Calhoun DA. Circulating concentrations of chemokines in
cord blood, neonates, and adults. Pediatr Res 51: 653–657, 2002.
53. Tessema M, Klinge DM, Yingling CM, Do K, Van Neste L, Belinsky
SA. Re-expression of CXCL14, a common target for epigenetic silencing
in lung cancer, induces tumor necrosis. Oncogene 29: 5159 –5170, 2010.
54. Tian R, Liu SX, Williams C, Soltau TD, Dimmitt R, Zheng X, De
Plaen IG. Characterization of a necrotizing enterocolitis model in newborn mice. Int J Clin Exp Med 3: 293–302, 2010.
55. Walthall K, Cappon GD, Hurtt ME, Zoetis T. Postnatal development of
the gastrointestinal system: a species comparison. Birth Defects Res B Dev
Reprod Toxicol 74: 132–156, 2005.
56. Walz A, Schmutz P, Mueller C, Schnyder-Candrian S. Regulation and
function of the CXC chemokine ENA-78 in monocytes and its role in
disease. J Leukoc Biol 62: 604 –611, 1997.
57. Weston WL, Carson BS, Barkin RM, Slater GD, Dustin RD, Hecht
SK. Monocyte-macrophage function in the newborn. Am J Dis Child 131:
1241–1242, 1977.
58. Xu D, Wang S, Liu W, Liu J, Feng X. A novel receptor activator of
NF-kappaB (RANK) cytoplasmic motif plays an essential role in osteoclastogenesis by committing macrophages to the osteoclast lineage. J
Biol Chem 281: 4678 –4690, 2006.
59. Yee WH, Soraisham AS, Shah VS, Aziz K, Yoon W, Lee SK. Incidence
and timing of presentation of necrotizing enterocolitis in preterm infants.
Pediatrics 129: e298 –e304, 2012.
AJP-Gastrointest Liver Physiol • doi:10.1152/ajpgi.00016.2012 • www.ajpgi.org
Downloaded from http://ajpgi.physiology.org/ by 10.220.33.1 on June 18, 2017
16. Hsueh W, Caplan MS, Qu XW, Tan XD, De Plaen IG, GonzalezCrussi F. Neonatal necrotizing enterocolitis: clinical considerations and
pathogenetic concepts. Pediatr Dev Pathol 6: 6 –23, 2003.
17. Hunter CJ, Singamsetty VK, Chokshi NK, Boyle P, Camerini V,
Grishin AV, Upperman JS, Ford HR, Prasadarao NV. Enterobacter
sakazakii enhances epithelial cell injury by inducing apoptosis in a rat
model of necrotizing enterocolitis. J Infect Dis 198: 586 –593, 2008.
18. Keates S, Keates AC, Mizoguchi E, Bhan A, Kelly CP. Enterocytes are the
primary source of the chemokine ENA-78 in normal colon and ulcerative
colitis. Am J Physiol Gastrointest Liver Physiol 273: G75–G82, 1997.
19. Kyriazis AA, Esterly JR. Fetal and neonatal development of lymphoid
tissues. Arch Pathol 91: 444 –451, 1971.
20. Liu SX, Tian R, Baskind H, Hsueh W, De Plaen IG. Platelet-activating
factor induces the processing of nuclear factor-kappaB p105 into p50,
which mediates acute bowel injury in mice. Am J Physiol Gastrointest
Liver Physiol 297: G76 –G81, 2009.
21. Llanos AR, Moss ME, Pinzon MC, Dye T, Sinkin RA, Kendig JW.
Epidemiology of neonatal necrotising enterocolitis: a population-based
study. Paediatr Perinat Epidemiol 16: 342–349, 2002.
22. MacDonald TT, Spencer J. Ontogeny of the mucosal immune response.
Springer Semin Immunopathol 12: 129 –137, 1990.
23. Maheshwari A, Christensen RD, Calhoun DA, Dimmitt RA, Lacson
A. Circulating CXC-chemokine concentrations in a murine intestinal
ischemia-reperfusion model. Fetal Pediatr Pathol 23: 145–157, 2004.
24. Maheshwari A, Corbin LL, Schelonka RL. Neonatal Necrotizing Enterocolitis. Res Rep Neonatol 1: 39 –53 2011.
25. Maheshwari A, Kelly DR, Nicola T, Ambalavanan N, Jain SK, Murphy-Ullrich J, Athar M, Shimamura M, Bhandari V, Aprahamian C,
Dimmitt RA, Serra R, Ohls RK. TGF-beta2 suppresses macrophage
cytokine production and mucosal inflammatory responses in the developing intestine. Gastroenterology 140: 242–253, 2011.
26. Maheshwari A, Kurundkar AR, Shaik SS, Kelly DR, Hartman Y, Zhang
W, Dimmitt R, Saeed S, Randolph DA, Aprahamian C, Datta G, Ohls
RK. Epithelial cells in fetal intestine produce chemerin to recruit macrophages. Am J Physiol Gastrointest Liver Physiol 297: G1–G10, 2009.
27. Maheshwari A, Lacson A, Lu W, Fox SE, Barleycorn AA, Christensen
RD, Calhoun DA. Interleukin-8/CXCL8 forms an autocrine loop in fetal
intestinal mucosa. Pediatr Res 56: 240 –249, 2004.
28. Mei J, Liu Y, Dai N, Favara M, Greene T, Jeyaseelan S, Poncz M, Lee
JS, Worthen GS. CXCL5 regulates chemokine scavenging and pulmonary host defense to bacterial infection. Immunity 33: 106 –117, 2010.
29. Musemeche CA, Kosloske AM, Bartow SA, Umland ET. Comparative
effects of ischemia, bacteria, and substrate on the pathogenesis of intestinal necrosis. J Pediatr Surg 21: 536 –538, 1986.
30. Nanthakumar NN, Dai D, Meng D, Chaudry N, Newburg DS, Walker
WA. Regulation of intestinal ontogeny: effect of glucocorticoids and
luminal microbes on galactosyltransferase and trehalase induction in mice.
Glycobiology 15: 221–232, 2005.
31. Nanthakumar NN, Fusunyan RD, Sanderson I, Walker WA. Inflammation in the developing human intestine: A possible pathophysiologic
contribution to necrotizing enterocolitis. Proc Natl Acad Sci USA 97:
6043–6048, 2000.
32. Neu J, Walker WA. Necrotizing enterocolitis. N Engl J Med 364: 255–264,
2011.
33. Oostdijk EA, de Smet AM, Kesecioglu J, Bonten MJ. The role of
intestinal colonization with gram-negative bacteria as a source for intensive care unit-acquired bacteremia. Crit Care Med 39: 961–966, 2011.
34. Pacha J. Development of intestinal transport function in mammals.
Physiol Rev 80: 1633–1667, 2000.
35. Palmen MJ, Dieleman LA, van der Ende MB, Uyterlinde A, Pena AS,
Meuwissen SG, van Rees EP. Non-lymphoid and lymphoid cells in acute,
chronic and relapsing experimental colitis. Clin Exp Immunol 99: 226 –232,
1995.
36. Palmen MJ, van der Ende MB, Pena AS, van Rees EP. Non-lymphoid
cells in acute and chronic experimental inflammatory bowel disease. Adv
Exp Med Biol 355: 283–287, 1994.
37. Panigrahi P, Gupta S, Gewolb IH, Morris JG Jr. Occurrence of
necrotizing enterocolitis may be dependent on patterns of bacterial adherence and intestinal colonization: studies in Caco-2 tissue culture and
weanling rabbit models. Pediatr Res 36: 115–121, 1994.
38. Pender SL, Braegger C, Gunther U, Monteleone G, Meuli M, Schuppan G. Matrix metalloproteinases in necrotising enterocolitis. Pediatr Res
54: 160 –164, 2003.