Research Article
Differentially Active Origins of DNA Replication in
Tumor versus Normal Cells
Domenic Di Paola, Gerald B. Price, cand Maria Zannis-Hadjopoulos
1,2
1,
1,2
1
McGill Cancer Center and 2Department of Biochemistry, McGill University, Montreal, Quebec, Canada
Abstract
Previously, a degenerate 36 bp human consensus sequence
was identified as a determinant of autonomous replication
in eukaryotic cells. Random mutagenesis analyses further
identified an internal 20 bp of the 36 bp consensus sequence
as sufficient for acting as a core origin element. Here, we have
located six versions of the 20 bp consensus sequence (20mer)
on human chromosome 19q13 over a region spanning f211
kb and tested them for ectopic and in situ replication activity
by transient episomal replication assays and nascent DNA
strand abundance analyses, respectively. The six versions of
the 20mer alone were capable of supporting autonomous
replication of their respective plasmids, unlike random
genomic sequence of the same length. Furthermore, comparative analyses of the endogenous replication activity of these
20mers at their respective chromosomal sites, in five tumor/
transformed and two normal cell lines, done by in situ
chromosomal DNA replication assays, involving preparation
of nascent DNA by the L exonuclease method and quantification by real-time PCR, showed that these sites coincided
with chromosomal origins of DNA replication in all cell lines.
Moreover, a 2- to 3-fold higher origin activity in the tumor/
transformed cells by comparison to the normal cells was
observed, suggesting a higher activation of these origins in
tumor/transformed cell lines. (Cancer Res 2006; 66(10): 5094-103)
Introduction
Chromosomal DNA is replicated in units termed replicons,
whose average size varies from 10 to 300 kb, depending on the
stage of development, growth conditions, or cell transformation
status (1, 2). Each replicon contains one centrally placed functional
origin (ori), where replication is initiated, with an estimated
number of 104 to 106 replication origins per mammalian cell (1, 2).
Control over the timing and frequency of initiation of DNA
replication is exerted at the origin site (3, 4). We recently identified
and tested a putative 36 bp mammalian origin consensus sequence
capable of supporting autonomous replication of a plasmid after
transfection into eukaryotic cells (5). Initiation of plasmid
replication in vitro occurred within the consensus, whereas
homologues of the consensus were found consistently at mammalian chromosomal sites of initiation of DNA replication as well
as within CpG islands. Versions of the consensus functioned as
Note: cThis work is dedicated to the memory of Dr. Gerald B. Price, whose expert
intellectual and technical advice and most of all friendship will be greatly missed.
Requests for reprints: Maria Zannis-Hadjopoulos, McGill Cancer Center, 3655
Promenade Sir William Osler, Room 710, Montreal, Quebec, Canada H3G 1Y6. Phone:
514-398-3536; Fax: 514-398-6769; E-mail: [email protected].
I2006 American Association for Cancer Research.
doi:10.1158/0008-5472.CAN-05-3951
Cancer Res 2006; 66: (10). May 15, 2006
origins of DNA replication in normal and malignant human cells;
immortalized monkey and mouse cells; and normal cow, chicken,
and fruit fly cells. Mutation analysis of the 36 bp consensus
sequence suggested that an internal 20 bp sequence (20mer)
is sufficient to act as a core origin consensus element. The
distribution of the 20mer over 1 Mb human chromosomal DNA
varied between approximately every 20 to 50 kb and was
quantitatively and qualitatively (i.e., relative proximity to each
other) similar to the distribution of the autonomously replicating
sequence consensus sequence on Saccharomyces cerevisiae chromosomes (5).
Several variables regulate the activation of mammalian replication origins. These include the concentration and conformation of
initiator proteins (6, 7), as well as the specific DNA sequences
acting as replication origins having differential affinities for the six
subunits of the origin recognition complex (6–8). Transcription
factors may also play important roles in the initiation and timing of
replication for different cell types (9, 10). Gene transcription, by
way of transcriptional activation of certain gene loci in cells, has
been linked to the initiation of DNA replication, which occurs
earlier in S phase than in cells in which the same loci are not
transcribed (11, 12). Chromatin structure and nuclear organization
are also essential for the spatial positioning and interaction of
replication origins with initiator proteins, thus regulating origin
activation (13–15). Furthermore, epigenetic components leading to
protein or DNA modification, such as DNA methylation (16, 17),
histone modification (18), and nucleotide pool levels (19) have been
postulated as determinants of replication origins. Deregulation of
any one of these variables brought about by cellular transformation
would be expected to result in altered DNA replication as is the
case during embryonic development (20, 21). Thus, cellular
transformation may modify the regulation of origin activation,
resulting in differential origin usage between normal and transformed cells.
Cellular transformation and tumor progression are thought to be
a return to the early stages of embryonic development (3). DNA
fiber autoradiography measurements indicated that the average
replicon size was decreased in transformed cells by comparison to
normal cells (22, 23), suggesting the existence of tumor-specific and
malignancy-regulated origins. Furthermore, a 2- to 10-fold increase
of single-strand nuclease sensitive regions was found in transformed cells, consistent with more origins being activated (24). In
addition, some mammalian replication origins, including the c-myc
origin, were approximately twice as active in HeLa cells as in
human normal skin fibroblasts (NSF; ref. 25). Although the relative
nascent DNA abundance across 12.5 kb of the human c-myc locus
had a similar distribution, a 2-fold higher abundance was found in
HeLa than in NSF cells at the majority of the initiation sites tested
across the c-myc locus (26). A comparison of origin activities
between the isogenic pair of normal human embryo lung
fibroblasts (WI38) and their SV40-transformed immortal variant
[WI38(SV40)] indicated a similar distribution of nascent DNA with
5094
www.aacrjournals.org
Downloaded from cancerres.aacrjournals.org on June 18, 2017. © 2006 American Association for Cancer
Research.
Origin Activity in Tumor versus Normal Cells
Table 1. Location of the 20 bp human consensus sequence in a f211 kb region of human chromosome 19q13
Version of 20 bp human
consensus sequence*
20mer1
20mer2
20mer3
20mer4
20mer5
20mer6
Nucleotide
sequence (5¶!3¶)
Genbank
accession no.
Nucleotide location (bp)
c
on (+) or () strand (5¶!3¶)
Length (bp)
Homology (%)
AAAATGGGGCTCCCATTTTC
TCTAAGCTTTTGAAATATCC
CAAAATGGGTTGCAAACAAC
CATAATCGCCTGCAAGCAGC
TAAAAGCCCCTGCATTTATC
TAGTTTGAGCTGCAATTTCC
ac010325.7
ac011523.3
ac011483.7
ac011483.7
ac010325.7
ac010325.7
113,308-113,289
37,059-37,040
61,229-61,210
57,436-57,455
82,499-82,518
77,885-77,904
20
20
20
20
20
20
90
90
90
90
90
90
NOTE: Degenerate nucleotide code is defined as follows: R, A/G; Y, C/T; M, A/C; K, G/T; W, A/T; S, C/G; B, C/G/T; D, A/G/T; H, A/C/T; V, A/C/G;
N, A/C/G/T.
*Human consensus sequence (20 bp): TMDAWKSGBYTSMAAWYWBC.
cNucleotide position 5¶!3¶ of each version of the 20 bp human consensus sequence (ascending numbers indicate presence on the + strand and
descending numbers indicate presence on the strand; strand labeling is arbitrary).
2-fold higher abundance in the transformed [WI38(SV40)] than in
the normal (WI38) cells at the majority of sites tested across the
c-myc locus, eliminating the possibility that cell type effects were
responsible for the observed differences in origin activities in HeLa
and NSF cells (27). Overall, these findings suggested that cellular
transformation might induce greater frequency of initiation of
origins in certain loci.
A polarity or position change of initiation of DNA replication was
also observed with malignant transformation (28). Fundamental
differences in the organization of DNA replication sites in normal
versus immortalized cell lines have been reported (29), but other
studies found no such differences (30, 31). Different chromatin
organization and rearrangements as well as different nuclease
sensitivity between normal and transformed cells taking place
during the progression of S phase cells have also been reported
(32, 33). Moreover, the replication timing of homologous loci was
found to be more asynchronous in samples derived from
transformed cells relative to their normal counterparts (34).
In this study, we searched for tumor-specific or tumor-activated
origins, using the 20mer as bait to identify replication origins, and
comparatively analyzed the nascent DNA abundance across these
sites in two normal and five tumor cell lines. We located six
versions of the 20mer in a region spanning f211 kb on human
chromosome 19q13 and tested their ability to act as replication
origins by ectopic and in situ replication assays. The results showed
that these six versions of the 20mer consensus were able to support
the ectopic autonomous replication of their respective plasmids
and also served as chromosomal replication origins in situ. Furthermore, tumor/transformed cells had an f2- to 3-fold higher origin
activity at the 20mer sites than normal cells.
Materials and Methods
Sequence analyses. A f211 kb region of chromosome 19q13 (Genbank
accession no. NT_011109) was scanned for the presence of a 20 bp
consensus sequence (5), using the program fuzznuc of the EMBOSS suite of
software, allowing two mismatches and no gaps (Table 1).3
3
http://bioweb.pasteur.fr/seqanal/interfaces/fuzznuc.html.
www.aacrjournals.org
Cloning and preparation of constructs. Plasmid constructs used in the
transient replication assays were prepared by annealing complementary
oligonucleotides (Table 2) into the BamHI and EcoRI sites of the
pBluescript vector (Stratagene, La Jolla, CA) using a standard protocol
(35). Supercoiled plasmid DNA of the resulting clones as well as the pM1
SEAP vector (Roche Molecular Biochemicals, Indianapolis, IN) was prepared
using the Qiagen Maxiprep kit (Qiagen, Mississauga, ON, Canada) according
to specifications of the manufacturer, and sequenced.
Cell culture. HeLa, NSF (primary NSFs), PC-3, HCT 116, LS174T,
WI38 (human lung embryo fibroblasts), and WI38 VA13 2RA (WI38
transformed with SV40 virus) were acquired from American Type Culture
Collection (Manassas, VA) and cultured in a-MEM supplemented with
penicillin (100 Ag/mL), streptomycin (100 Ag/mL), 1 mmol/L L-glutamine,
tylosin (8 Ag/mL), and 10% (v/v) fetal bovine serum. When the cells
reached 30% to 50% confluence, they were harvested for the isolation
of nascent DNA, whereas upon reaching 100% confluence, they were
serum-starved for 48 to 72 hours and harvested for the isolation of
genomic DNA.
Episomal DNA replication (DpnI resistance) assay. For transfections,
HeLa cells were seeded in six-well plates at a density of 3 104 per well, and
f16 hours later were transfected with 3 Ag supercoiled plasmid DNA (2 Ag
of each construct in Table 2 and 1 Ag pM1 SEAP), using FuGENE
6 transfection reagent (Roche Molecular Biochemicals) as per instructions
of the manufacturer. At 72 hours post-transfection, low molecular weight
DNA was isolated and digested with DpnI, the DpnI-digested and
undigested DNA were used to transform the DH5a strain of Escherichia
coli and the relative in vivo DNA replication of each transfected plasmid
was determined by counting the number of colonies in a bacterial
retransformation assay, as previously described (36–38). The levels of
secreted human placental alkaline phosphatase, determined by the SEAP
Reporter Gene Assay kit (Roche Molecular Biochemicals), as per
specifications of the manufacturer, were used to normalize the transfection
efficiency.
Isolation of genomic DNA. Genomic DNA was isolated using the
GenElute Mammalian Genomic DNA Miniprep kit (Sigma, Oakville, ON,
Canada), as per instructions of the manufacturer.
Isolation of nascent DNA. Nascent DNA was prepared using the E
exonuclease method, as previously described (26), with the following
modifications: The E exonuclease–digested samples were heated at 100jC
for 3 minutes, then immediately subjected to electrophoreses on a 2%
agarose gel. DNA was visualized by staining with 0.02% (w/v) methylene
blue (Sigma) and the origin-containing nascent DNA, ranging between 350
and 1,000 bp in size was excised from the gel, purified with the Sephaglas
BandPrep kit (GE Healthcare, Piscataway, NJ), as per instructions of the
manufacturer, and resuspended in TE.
5095
Cancer Res 2006; 66: (10). May 15, 2006
Downloaded from cancerres.aacrjournals.org on June 18, 2017. © 2006 American Association for Cancer
Research.
Cancer Research
Real-time PCR quantification analyses. PCRs were carried out in a
total volume of 20 AL with 5 AL genomic or nascent DNA, using the
LightCycler (Roche Diagnostics), as previously described (39, 40). The
sequences and amplification conditions for all primer sets are shown in
Table 3. Genomic DNA (1, 2, 3, and 4 ng) from NSF cells was used to
generate the standard curves needed for quantification of the PCR products.
A negative control without template DNA was included with each set of
reactions. PCR products were resolved on 2% agarose gels, visualized with
ethidium bromide, and photographed with an Eagle Eye apparatus (Speed
Light/BT Sciencetech-LT1000). No extraneous bands were generated with
any of the primer sets.
Results
Occurrence of 20mer homologues in a f211 kb region on
human chromosome 19q13 and in the lamin B2 locus. A
chromosomal region of f211 kb located on human chromosome
19q13 was scanned for the presence of the 20mer consensus (5),
using the program fuzznuc of the EMBOSS suite of software.
Setting the variables at two mismatches and no gaps, six 20mers
Table 2. Complementary oligonucleotides used to
prepare constructs to test versions of the 20 bp human
consensus sequence for autonomous replication in the
in vivo DNA replication assay
Name of
Strand
construct* orientation
p20mer1
p20mer2
p20mer3
p20mer4
p20mer5
p20mer6
p20merC
pA3/4
pLB2
pLB2C1
pBluescript
+
+
+
+
+
+
+
+
+
+
N/A
N/A
Sequence of the complementary
oligonucleotides (5¶!3¶)
GATCgaaaatgggagccccatttt
AATTaaaatggggctcccattttc
GATCggatatttcaaaagcttaga
AATTtctaagcttttgaaatatcc
GATCgttgtttgcaacccattttg
AATTcaaaatgggttgcaaacaac
GATCcataatcgcctgcaagcagc
AATTgctgcttgcaggcgattatg
GATCtaaaagcccctgcatttatc
AATTgataaatgcaggggctttta
GATCtagtttgagctgcaatttcc
AATTggaaattgcagctcaaacta
GATCtgtgagccaccatgcccggc
AATTgccgggcatggtggctcaca
GATCcctcaaatggtctccaattttcctttggcaaattcc
AATTggaatttgccaaaggaaaattggagaccatttgagg
GATCtccaatgatttgtaatatac
AATTgtatattacaaatcattgga
GATCtcctggggaccatcaccctg
AATTcagggtgatggtccccagga
Backbone vector (without insert)
*p20mer1-6 contains versions of the 20 bp human consensus sequence
located in the f211 kb region of human chromosome 19q13.
p20merC contains a sequence that is not a version of the 20 bp
human consensus sequence that serves as a negative control for the
f211 kb region of human chromosome 19q13. pA3/4 contains a
version of the 36 bp human consensus sequence that serves as a
positive control (5). pLB2 contains a version of the 20 bp human
consensus sequence included in the OBR of the lamin B2 locus.
pLB2C1 contains a sequence that is not a version of the 20 bp human
consensus sequence that serves as a negative control for the lamin B2
locus. pBluescript is a vector without insert (negative control).
Cancer Res 2006; 66: (10). May 15, 2006
were detected at a level of 90% homology (Table 1). The wellcharacterized lamin B2 origin region was also used as a control.
We located two different versions of the 20mer included in the
origin of bidirectional replication (OBR) of the lamin B2 locus, one
copy on the plus strand (M94363 nucleotides 3910-3929) and the
other on the minus strand (M94363 nucleotides 3953-3934), both
at a level of 75% homology. A diagram of the human lamin B2
locus and of the f211 kb region of chromosome 19q13 is shown
(Fig. 1A and B).
Autonomous replication activity of plasmids containing
the 20mer. The ability of the 20mer versions, found on human
chromosome 19q13 and in the lamin B2 origin region, to confer
autonomous replication activity when cloned into a plasmid was
analyzed by the DpnI resistance assay, which is an indicator
of semiconservative DNA replication, as previously described
(36–38).
HeLa cells were transfected with one of the following constructs
(Table 2): p20mer1-6, containing versions of the 20 bp consensus
sequence found in the f211 kb region of human chromosome
19q13; p20merC, containing genomic sequence found within
the f211 kb region of human chromosome 19q13 that does not
contain a version of the 20 bp consensus (negative control); pA3/4,
containing a version of the 36 bp consensus (positive control;
ref. 5); pLB2, containing a version of the 20 bp consensus included
in the OBR of the lamin B2 locus; pLB2C1, containing genomic
sequence found within the lamin B2 locus that does not contain
a version of the 20 bp consensus (negative control for the lamin
B2 locus; ref. 41); pBluescript vector without an insert (negative
control); pM1 SEAP vector was co-transfected with each construct
to normalize for the transfection efficiency; finally, a mock
transfection without a construct was done as an additional
negative control. At 72 hours post-transfection, plasmid DNA was
isolated, digested with DpnI, and the DpnI-digested DNA was
used to transform E. coli. After 18 hours, the number of colonies
produced was counted, corrected for the amount of DNA
recovered, and related to the positive control reaction of construct
pA3/4, which was taken as 100% (Fig. 1C). As expected of
mammalian replication origins, which are activated only once
per cell cycle, a relatively small number of colonies (ranging from
14 to 33) was produced, on average, by even the most efficiently
replicating plasmid (pA3/4, 33 colonies). Furthermore, the ‘‘low’’
signal would be the result of weaker replication activity by the
basal consensus replication element (20mer) alone than would be
expected if the insert contained additional sequences that would
increase replication efficiency. The plasmids containing the 20mers
1, 2, 4, 5, and 6 replicated almost as efficiently as pA3/4, which
displayed the most efficient replication, as before (5). On the
other hand, p20mer3 replicated at 40% efficiency by comparison to
pA3/4, suggesting that the 20mer3 version of the consensus was a
less efficient replication origin than 20mers 1, 2, 4, 5, or 6. In
contrast, 20merC was unable to confer autonomous replication to
its plasmid, suggesting that 20mers 1 to 6, representing versions of
the origin consensus sequence, could act as replication initiation
sites. This notion was corroborated by the result obtained with
pLB2, containing the peak origin region of the lamin B2 locus,
which was able to replicate autonomously at nearly the same
efficiency as p20mers 1, 2, 4, 5, and 6, unlike pLB2C1, which was
unable to confer autonomous replication to its plasmid. Similarly,
no bacterial colonies were obtained with DpnI-digested DNA
recovered when either the backbone vector (pBluescript) had been
transfected, as before (38), or from the mock transfections.
5096
www.aacrjournals.org
Downloaded from cancerres.aacrjournals.org on June 18, 2017. © 2006 American Association for Cancer
Research.
Origin Activity in Tumor versus Normal Cells
Table 3. Sequences and amplification conditions of primers used for real-time quantitative PCR on the LightCycler
Primer name*
L20mer1-F
L20mer1-R
M20mer1-F
M20mer1-R
R20mer1-F
R20mer1-R
L20mer2-F
L20mer2-R
M20mer2-F
M20mer2-R
R20mer2-F
R20mer2-R
L20mer3-F
L20mer3-R
M20mer3-F
M20mer3-R
R20mer3-F
R20mer3-R
L20mer4-F
L20mer4-R
M20mer4-F
M20mer4-R
R20mer4-F
R20mer4-R
L20mer5-F
L20mer5-R
M20mer5-F
M20mer5-R
R20mer5-F
R20mer5-R
L20mer6-F
L20mer6-R
M20mer6-F
M20mer6-R
R20mer6-F
R20mer6-R
20merC-F
20merC-R
20merC1-F
20merC1-R
20merC2-F
20merC2-R
20merC34-F
20merC34-R
20merC56-F
20merC56-R
LB2-F
LB2-R
LB2C1-F
LB2C1-R
Sequence (5¶!3¶)
TGGTTTGAGATGTTCCCAGC
CCGTGAGCATTGGAGATTAC
CCCTTTGCACATATACAGTC
TCTGAGGCGTTTTTGAGATC
CCCCATGTTTTGAGTCTTTG
CACTTAAACCACAAGGTCTG
TCTACCGTTATTCTACACCC
TTGATGTCAGAAGTAAGGGC
TACAGCTGATAGGCTGTAAC
GAGTGTGCAGTAAAGGATTC
CTGCAGAGAAATTATGGCTG
AAAGAGTTAGGTACTGTGGC
ACAGGTGTCTGTGAACAATC
TTGGTATTTTCCCTGTGCAC
AGGAGAATCGCTTGAACTTG
AAGCAACTGATGTCTAAAAG
GCTTGGTCCTATTCACAAAC
ACGCCAAGTTAATATCCAGC
TTAGTAGAGACGGGGTTCTC
CTTGGCTGTTACTGCTGTTG
AGAGCTTCAGGTAGTCACAC
GTGTTCACTGTGTGTTTGGC
CAGAGTTCTGGTTACCTGTG
TCCTTGTGGTTCCTCTCTAC
GTTTCACAAACTATGACCCACCGC
GTTGTGGGATGACGGAAGATTCAC
TAACTAGTGCAAGCTGACAC
TTTACAGAAGCAGAACAGGC
ATGTTGTCGCTGTCCTAATG
TGCCATTGACAGGTATGATG
TGATCTTGGCTCTCTGCAAC
CCTGTAATCCCAGCACTTTG
TTATCTGAGGGAAGAACGAG
ACGGCTCAAGTGGTTAAAAC
ATTCCCTGCGACAGAAATAG
AAGATCTTGTCTCTGTCACC
AGTAGCTAGGATTACAGTCG
TAAAATCGTGTCTGGCACTG
TCCAACAAATCCATGCCACAGTGC
TTCTGATGATTCTCGTGCCTGAGC
TGAACACCCAACACATAGCACTGG
TGCTTCTTCAAGCCAATCGTGAGC
AACAAGCTTAGCTGCCTGTACCTC
AGCATCTGGCTAATTGCTGGACAC
CAAGTGATTCTCAGCCTCCCGAATAC
AAGCAGAAGGACTGGATGAAGTCAGG
GGCTGGCATGGACTTTCATTTCAG
GTGGAGGGATCTTTCTTAGACATC
GTTAACAGTCAGGCGCATGGGCC
CCATCAGGGTCACCTCTGGTTCC
Genbank
accession no.
ac010325.7
ac010325.7
ac010325.7
ac011523.3
ac011523.3
ac011523.3
ac011483.7
ac011483.7
ac011483.7
ac011483.7
ac011483.7
ac011483.7
ac010325.7
ac010325.7
ac010325.7
ac010325.7
ac010325.7
ac010325.7
ac010325.7
ac010325.7
ac011523.3
ac011483.7
ac010325.7
M94363
M94363
Nucleotide location
(bp; 5¶!3¶)
Size of
amplicon (bp)
Quantitative PCR
annealing temperature (jC)
112,742-112,761
112,926-112,907
113,221-113,240
113,391-113,372
113,726-113,745
113,928-113,909
36,368-36,387
36,565-36,546
36,936-36,955
37,129-37,110
37,423-37,442
37,645-37,626
60,581-60,600
60,776-60,757
61,047-61,066
61,278-61,259
61,614-61,633
61,833-61,814
56,793-56,812
57,002-56,983
57,371-57,390
57,590-57,571
57,912-57,931
58,121-58,102
81,253-81,276
81,479-81,456
82,400-82,419
82,622-82,603
82,992-83,011
83,136-83,117
77,312-77,331
77,530-77,511
77,835-77,854
78,053-78,034
78,329-78,348
78,640-78,621
157,686-157,705
157,973-157,954
120,225-120,248
120,539-120,516
29,948-29,971
30,088-30,065
51,462-51,485
51,692-51,669
89,743-89,768
90,033-90,008
3,839-3,862
4,070-4,047
1-23
240-217
185
62
171
64
203
64
198
66
194
56
223
66
196
62
232
64
220
62
210
64
220
66
210
60
227
68
223
68
145
62
219
66
219
62
312
68
288
68
315
68
141
64
231
66
291
68
232
66
240
66
*F, forward primers; R, reverse primers; M, a primer set located in a region containing a version of the 20mer; L, a primer set located f300 to 400 bp 5¶
of the M region; R, a primer set located f300 to 400 bp 3¶ of the M region; 20merC: located at least 44 kb away from any of the six 20mers; 20merC1:
located f6 kb from 20mer1; 20merC2: located f6 kb from 20mer2; 20merC34: located at least 6 kb from 20mers 3 and 4; 20merC56: located at least
6 kb from 20mers 5 and 6; LB2 (peak region) and LB2C1 (control region f4 kb away) at the region of the lamin B2 locus (45).
Copy number of 20mer sites. To assess the copy number per
haploid genome at all regions examined in this study, equal
amounts of genomic DNA from each cell line was amplified by
real-time PCR. Figure 2A, top, shows a representative ethidium
www.aacrjournals.org
bromide–stained 2% agarose gel of the expected amplification
product of 194 bp obtained with the M20mer2 primer set. The
results (Fig. 2A, bottom) were normalized by making NSF equal to
one copy per haploid genome and show that in all cell lines
5097
Cancer Res 2006; 66: (10). May 15, 2006
Downloaded from cancerres.aacrjournals.org on June 18, 2017. © 2006 American Association for Cancer
Research.
Cancer Research
M20mer2 was present at approximately one copy per haploid
genome. Similar results were obtained for all primer sets (data not
shown), indicating that the primer sets amplifying all the regions
examined in this study were present at one copy per haploid
genome in each cell line.
Nascent DNA abundance. The above results allowed quantitative comparisons between the nascent DNA abundance among the
various cell lines, thus permitting measurements of replication
origin activity.
The E exonuclease digests the 5¶ phosphorylated parental and
broken DNA strands, but the nascent DNA strands bearing 5¶ RNA
primers are resistant to digestion by this enzyme (42). Figure 2B is
representative of all nascent DNA preparations done for each cell
line. Total cellular DNA (together with total RNA) was isolated and
sheared with a fine needle. The average size of the sheared total
cellular DNA was f30 kb, seen as a band on a 1% agarose gel,
whereas the smear of lower molecular weight represented RNA
(Fig. 2B, lane 2). Phosphorylation and E-exonuclease digestion were
monitored by an internal control of dephosphorylated linear
plasmid (Fig. 2B, lane 3; refs. 26, 27); the plasmid DNA was
completely phosphorylated and digested by E exonuclease (Fig. 2B,
lane 3 versus lane 4), and residual RNA (Fig. 2B, lane 4) was
removed by RNase A digestion (Fig. 2B, lane 5).
To eliminate any Okazaki fragments that might contaminate the
nascent DNA preparations, the samples were subjected to
electrophoresis on agarose gel, stained with methylene blue, and
only nascent DNA ranging between 350 to 1,000 bp was excised
and purified.
Figure 1. A, loci map of the lamin B2 locus (horizontal black line ) showing the lamin B2 and PpvI genes, from left to right, respectively (gray arrows pointing to
the direction of transcription ). The position of primer sets LB2 and LB2C1 used in real-time PCR is indicated (black arrows pointing upwards ). The location of the lamin
B2 origin (L, light gray circle ) and of a negative control region located f4 kb upstream of the origin are shown (C, dark gray circle ). From the first to last primer set, the
region shown is represented by nucleotides 1 to 4,070 (accession no. M94363). B, loci map of an f211 kb region on human chromosome 19q13 (horizontal
black line ), showing the location of the six 20mers with matches to the 20 bp consensus sequences (90% homology; refer to Table 1). Gray arrows, genes pointing to
the direction in which they are transcribed (GPR32P, GPR32, ACPT, MGC13170, MGC45922, KLK1, KLK15, KLK3, KLK2, KLK4, LOC390956, KLK5 , and KLK6
genes from left to right). Black arrows pointing upwards, primer sets used for real-time PCR. Light gray circles (1-6), location of their respective 20mers (containing a
version of the 20 bp consensus sequence); dark gray circles (C, C1, C2, C34, C56), negative control regions (at least 6 kb away from any of the six 20mers). From
the first to last primer set, the region shown is represented by nucleotides 23,516,094-23,727,937 (accession no. NT_011109). C, episomal replication activity of
the various versions of the 20 bp consensus sequences (20mers 1-6). Histogram plot of the number of bacterial colonies produced after transformation of E. coli with
DpnI-digested Hirt extracts of HeLa cells transfected for 72 hours with one of the following plasmids (refer to Table 2): pA3/4, p20mer1-6, p20merC, pLB2, pLB2C1, and
pBluescript. The average number of Dpn I-resistant colonies per plate was corrected for the amount of DNA recovered and normalized to the number of colonies
obtained with pA3/4 (positive control), which was taken as 100%. The number at the bottom of each column denotes the average number of colonies obtained from
three experiments. Columns, average of three experiments done in triplicate; bars, SD.
Cancer Res 2006; 66: (10). May 15, 2006
5098
www.aacrjournals.org
Downloaded from cancerres.aacrjournals.org on June 18, 2017. © 2006 American Association for Cancer
Research.
Origin Activity in Tumor versus Normal Cells
Figure 2. A, copy number per haploid genome of 20mer2 within the f211 kb region on human chromosome 19q13 in several normal and transformed cell lines. Top,
PCR amplification product (194 bp) produced by the M20mer2 primer set. Template DNA was as follows: lanes 1 to 3, genomic DNA from NSF [1, 2, and 3 ng,
respectively; necessary to build the standard curve used for quantification of DNA at M20mer2 by real-time PCR; positive control (+ve )]; lanes 4 to 10, 10 ng genomic
DNA from HeLa (H ), NSF (N ), PC-3 (P ), HCT 116 (HC ), LS174T (L ), WI38 (W ), WI38(SV40) (WS ); lane 11, water [no template DNA added, which is necessary
to check for contamination; negative control (ve )]. All bands were 194 bp in size. Bottom, histogram plot of copy number/haploid genome of the cell lines used in the
study. The results were normalized by making NSF equal to one copy/haploid genome. Columns, average of at least two experiments done in triplicate; bars, SD.
(Note that this is a representative graph; the copy number of all the primer sets used in this study was measured; see Table 3.) B, nascent DNA preparation. Lane 1,
1 kb Plus DNA Ladder; lane 2, f600 ng total cellular (DNA + RNA) sheared with a fine needle (26G3/8); lane 3, f1,200 ng sheared and denatured total cellular
(DNA + RNA); the single band was the internal control, linear pCR-XL-TOPO (f50 ng); lane 4, sheared total cellular (DNA + RNA) and internal linear control digested
by E exonuclease; lane 5, the nascent DNA sample after further treatment with RNase A; lane 6, Hin dIII-digested E phage DNA marker. The nucleic acids were
separated on 1% agarose native gel. C, assessment of quality of nascent DNA, exemplified by the lamin B2 origin, in the cell lines shown [HeLa, NSF, PC-3, HCT 116,
LS174T, WI38, and WI38(SV40)]. Histogram plot of the nascent DNA abundance (ng), measured by real-time PCR, at the lamin B2 peak (dark gray ) and a
non–origin-containing (control) region, located f4 kb downstream (light gray). Columns, average of at least two experiments done in triplicate; bars, SD.
www.aacrjournals.org
5099
Cancer Res 2006; 66: (10). May 15, 2006
Downloaded from cancerres.aacrjournals.org on June 18, 2017. © 2006 American Association for Cancer
Research.
Cancer Research
To assess the quality of nascent DNA samples, the distribution of
nascent DNA from an origin region associated with the lamin B2
locus was quantified. This origin was shown to be active in a
number of different proliferating human cells (26, 27, 41, 43, 44).
Nascent DNA was measured at two reference points, one located at
the center of the origin (LB2 primer set = peak activity), the other
located f4 kb away (LB2C1 primer set = background activity),
using the primer sets described by Ladenburger et al. (45). The
ratio of highest to lowest abundance in the region to be studied is
indicative of the quality of the nascent DNA preparation and
signal-to-noise estimates (26, 27, 44). Moreover, a ratio of signals
from the initiation site to distant sites in noninitiation regions of
z10 is indicative of good quality nascent DNA (46). The ratio of
highest abundance at the lamin B2 peak region to lowest
abundance at the lamin B2 control region ranged from 10.5 to
21.0, indicating good quality nascent DNA preparations for all cell
lines (Fig. 2C), and thus suitable for mapping replication origins
in vivo. These samples were used to measure the nascent DNA
abundance across the f211 kb region of human chromosome
19q13, in each of the tumor/transformed and normal cell lines.
Similar results were obtained when these experiments were done
using sheared and sonicated genomic DNA, yielding a distribution
of fragment lengths similar to that in the population of originproximal nascent DNA, verifying that the efficiency of the different
primer sets was the same as when tested with template DNA of
high molecular weight (used to construct the standard curves; data
not shown).
Origin activities at 20mer sites across a f211 kb region of
human chromosome 19q13 in tumor/transformed and normal
cell lines. Origin activity in vivo was measured in five tumor/
transformed and two normal cell lines, by quantification of the
nascent DNA abundance across the f211 kb region on human
chromosome 19q13 (Fig. 3). Each of the 23 primer sets used
amplified a fragment of f150 to 300 bp in size. Each of the six
20mers (Fig. 3, top, light gray circles labeled 1-6) that represent
putative replication initiation sites were amplified using three
primer sets: M amplifies a region containing a version of the 20 bp
consensus sequence; L amplifies a region located 5¶ (upstream)
of the M region; and R amplifies a region located 3¶ (downstream)
of the M region. In addition, five negative control regions (Fig. 3,
top, dark gray circles labeled C, C1, C2, C34, C56) were used,
representing regions not containing replication origins, thus
allowing us to measure the lowest abundance of nascent DNA
in the f211 kb region being examined. C1 designates a region
located f6 kb from 20mer1, C2 one located f6 kb from 20mer2,
C34 one located at least 6 kb from 20mer3 and 20mer4, C56 one
located at least 6kb from 20mer5 and 20mer6, and C designates a
region located at least 44 kb away from any 20mer. Within the
lamin B2 locus, besides the positive region (LB2) containing two
versions of the 20 bp consensus sequence at 75% homology, the
negative region (LB2C1) also contains one at 75% homology, but it
is not at an origin site, suggesting that the presence of a 20mer is
not sufficient for origin activity. To further assess whether all
20mers with homology to the 20 bp consensus correlated with
origin activity in our region of interest, two of the negative control
regions (20merC2 and 20merC34) were designed to contain
versions of the 20 bp consensus with 75% homology, compared
with 20mers 1 to 6, containing versions of the 20 bp consensus with
90% homology; the remaining negative control regions (20merC,
20merC1, and 20merC56) did not contain any version of the 20 bp
consensus.
Cancer Res 2006; 66: (10). May 15, 2006
The nascent strand abundance across the f211 kb region of
human chromosome 19q13 was determined in the same preparation of short nascent DNA and normalized to that of an internal
reference, the lamin B2 locus, to control for the possibility of a
greater recovery of nascent DNA from the transformed cells
compared to the normal ones. Specifically, amplification of nascent
DNA with primer set LB2C1 (background activity compared with
lamin B2 peak region, primer set LB2) gave baseline values that
were used to normalize results from all the nascent DNA
preparations of all cell lines, permitting comparison of data
between different preparations and different cell lines.
Histogram plots of the nascent DNA abundance measured at the
various regions in the cell lines used (Fig. 3, bottom) show a peak of
origin activity at each of the six 20mers (20mers 1-6), diminishing
(75-25% less origin activity) at regions immediately flanking the
20mers and reaching background levels (V10% origin activity) at
the five negative regions (C, C1, C2, C34, and C56) located at least
6 kb away from any of the six 20mers. These data indicate that
20mers 1 to 6 are located at sites of initiation (origins) of DNA
replication. Taken together with the observation that two of the
negative regions (20merC2 and 20merC34) with 75% homology to
the consensus sequence contained background amounts of nascent
DNA, the data suggest that the 20 bp consensus sequence
designates the location of potential chromosomal replication
origins.
The results also indicated a 2- to 3-fold higher origin activity in
the tumor/transformed cell lines compared with the normal ones,
suggesting a tumor-related activation of these origins located on
human chromosome 19q13. Use of the isogenic pair of WI38 and
WI38(SV40) showed that the origins were at least twice as active in
the transformed compared to the normal cell line, ruling out the
possibility that the observed increased frequency of initiation in
tumor/transformed cell lines might be due to cell type. In all the
cell lines examined, the highest abundance of nascent DNA was
located at the position of primer set M20mer1, suggesting that
20mer1 coincided with the major initiation start site within
the f211 kb region located on human chromosome 19q13. Also,
the lowest abundance was located at the position of primer set
20merC, which is most distant from any 20mer, indicating that no
origin was located at that region (Fig. 3). Throughout the entire
region, the ratio of highest abundance at primer set M20mer1 to
lowest abundance at 20merC for all cell lines ranged from 21.2 to
36.6, confirming the good quality of the nascent DNA preparations.
Furthermore, all six 20mers exhibited ratios of highest (peak
activity) to lowest (background activity) abundance of >10,
confirming that these are true start sites of DNA replication (46).
Discussion
Homologues of the mammalian 20 bp consensus sequence
on human chromosome 19q13 support autonomous replication of plasmids and coincide with chromosomal replication
origins. In this study, we located six versions of the 20mer (at a
level of 90% homology) on human chromosome 19q13 as well as
a version of it included in the OBR of the lamin B2 locus (at a level
of 75% homology) and tested them for both ectopic and
endogenous (in situ) replication activity. These versions of the
20mer alone were sufficient for autonomous replication of their
respective plasmids after transfection into HeLa cells, although not
all versions replicated as efficiently as A3/4, a version of the original
36 bp consensus sequence (5) that was used as a positive control.
5100
www.aacrjournals.org
Downloaded from cancerres.aacrjournals.org on June 18, 2017. © 2006 American Association for Cancer
Research.
Origin Activity in Tumor versus Normal Cells
Figure 3. Nascent DNA abundance at the f211 kb region of human chromosome 19q13 containing the 20mers. Histogram plots of the quantification by real-time PCR
of nascent DNA abundance (ng) across the f211 kb region of human chromosome 19q13 (horizontal black line ) of five tumor/transformed cell lines (gray columns )
and two normal cell lines (white columns ). The location of the primers (see Table 3) used for the amplification of 20mers 1 to 6 (light gray circles numbered 1-6 )
and the control regions (dark gray circles labeled C, C1, C2, C34, C56 ) are indicated (black arrows pointing upwards ). The distances between the 20mer primer sets are
as follows: 20mer6 to 20mer5, 4.6 kb; 20mer5 to 20mer1, 30.8 kb; 20mer1 to 20mer2, 87.9 kb; 20mer2 to 20mer4, 83.5 kb; 20mer4 to 20mer3, 3.8 kb; and those
of the control regions are: 20merC1 to 20mer1, f6 kb; 20merC2 to 20mer2 f6 kb; 20merC34 to 20mer3 and 20mer4, at least 6 kb; 20merC56 to 20mer5 and 20mer6,
at least 6 kb; finally, 20merC, at least 44 kb from any 20mer. Each of the 23 primer sets amplifies a region of f150 to 300 bp in size: M, a region containing the
20mer; L, a region located f300 to 400 bp 5¶ (upstream) of the M region; R, a region located f300 to 400 bp 3¶ (downstream) of the M region. Columns, average of at
least two experiments done in triplicate; bars, SD.
www.aacrjournals.org
5101
Cancer Res 2006; 66: (10). May 15, 2006
Downloaded from cancerres.aacrjournals.org on June 18, 2017. © 2006 American Association for Cancer
Research.
Cancer Research
In contrast, random 20 bp genomic sequences were unable to
support autonomous replication. Using real-time PCR to quantify
the abundance of nascent DNA, in five tumor/transformed and
two normal cell lines, we found that the six 20mers on human
chromosome 19q13 corresponded to chromosomal origins of
DNA replication in situ, as does the 20mer present in the wellcharacterized lamin B2 origin, in all cell lines. A peak of origin
activity at each of the six 20mers was observed, whereas less
activity was found at regions immediately flanking them and
background levels of origin activity were found at five negative
regions located at least 6 kb away from any of the six 20mers.
Furthermore, these origins were 2- to 3-fold more active in the
tumor/transformed cells compared with the normal cells.
The replication origin associated with 20mer1 had a consistently higher signal-to-noise ratio than those associated with the
other five 20mers in all cell lines examined, suggesting that the
frequency of origin usage at the region of 20mer1 was higher
than those at the other 20mer sites. Potentially, the origin at
20mer1 may be activated in more cells per population compared
with the origins located at 20mers 2 to 6. Alternatively, there
may be other potential initiation sites in the vicinity of the
origins associated with 20mers 2 to 6, hence producing a broader
and flatter peak by comparison to the origin associated with
20mer1. The latter might apply to the origins located at 20mers
3 and 4 and 20mers 5 and 6, due to their relatively close
proximity to one another. As for the origin located at 20mer2,
the possibility that additional initiation sites exist cannot be
ruled out. Interestingly, these 20mer origins are not as active as
the lamin B2 origin, which seems to be used in more cells per
population than the six 20mer origins, possibly due to the former
lying in a constitutively expressed gene domain, coding for a
housekeeping protein (47).
Comparison of the ectopic and endogenous replication data
(Figs. 1C and 3, respectively) revealed differences in the replication
efficiencies of the six 20mers and suggested that the surrounding
chromosomal sequence may be involved in regulating replication
origin activity. Specifically, the episomal assay showed that 20mers
1, 2, 4, 5, and 6 conferred autonomous replication to their
respective plasmids with approximately equal efficiency, whereas
the plasmid bearing 20mer3 replicated with approximately half of
that efficiency, suggesting that additional enhancing sequences
may be required. The in situ chromosomal assay, on the other
hand, showed that 20mer1 exhibited a 2-fold higher origin activity
than 20mers 2 to 6, whose activities were all approximately equal.
Overall, the data indicate that the presence of a 20mer designates a
potential start site of DNA replication, but the determinant of
whether it acts as one may be its accessibility for the assembly of
a pre-replication complex.
The fact that although there are examples of the 20mer with 75%
homology elsewhere in the f211 kb region as well as in the lamin
B2 negative region (LB2C1) that do not represent initiation sites
suggests that the presence of the 20mer alone is not sufficient
for determining replication origin activity in mammalian cells. It
rather designates the location of potential origins and only when all
the conditions are optimal and the configuration of the chromatin
is appropriate does it lead to the licensing and activation of the
origin.
Origin activities in normal versus tumor cells. Comparative
analysis of the activity of chromosomal replication origins
corresponding to the six versions of the 20 bp consensus sequence
between five tumor/transformed cell lines and two normal cell
Cancer Res 2006; 66: (10). May 15, 2006
lines confirmed that these 20mers were active initiation sites in all
cell lines and also revealed a 2- to 3-fold higher origin activity in the
tumor/transformed cells by comparison to the normal ones, across
the f211 kb region on human chromosome 19q13, corroborating
the findings of previous studies (25–27). Furthermore, use of the
isogenic pair of WI38 and WI38(SV40) confirmed these results,
ruling out the possibility that the observed increase in origin
activity was due to cell type effects. Use of these isogenic cell
lines also indicated that the unregulated increase in replication
initiation occurs at the transformation stage, before further
advancement to cancer, causing replication stress, which may lead
to DNA double-strand breaks and activation of the DNA damage
checkpoint, increased genomic instability, and tumor progression
(48, 49). Thus, increased origin firing may be an early event in the
stepwise progression to cancer.
A possible explanation for the differential origin activities
observed between the tumor/transformed and normal cells might
be that some origins fire more than once. It has been speculated
that the early events of genomic instability in a cancer cell might
entail unregulated origin firing, providing substrates for genetic
recombination and further amplification (50). Alternatively, the
differential origin activities might be due to the six initiation
sites not always being used in normal cells, but used in a higher
percentage of tumor/transformed cells. It is conceivable that in
normal cells, at least during some S phases, the DNA across this
f211 kb region on human chromosome 19q13 might be replicated
by upstream or downstream origins flanking this region.
Previous studies have suggested that there are at least two types
of changes in the activation of replication origins during cell
transformation and malignancy: an increase in origin activity at
some loci (25–27) and the activation of origins that are silent in
normal cells (22, 23). The origins examined in this study fall under
the category of those whose activity is increased in tumor/
transformed cells by comparison to normal ones. Thus, it seems
that there are at least three subsets of origins: those that are
normal and remain unchanged, those with increased origin activity
in transformed/immortalized or malignant cells, and those that are
activated uniquely in tumor cells.
In summary, we have found six versions of the 20 bp consensus
in a region of f211 kb of chromosome 19q13, which confer
autonomous replication of a plasmid and act as chromosomal
origins of DNA replication. We also found a differential
origin activity between normal and transformed cells at the
chromosomal sites that contain these 20mer sequences. Thus, the
20mer seems to be an important variable in designating the
location of replication origins. There may be other potential
initiation regions marked by the presence of a 20mer with less
homology to the consensus, as observed with the lamin B2 origin.
Furthermore, the possibility of the existence of an entirely
different subset of origins that are devoid of the consensus
sequence cannot be ruled out.
Acknowledgments
Received 11/2/2005; revised 3/8/2006; accepted 3/17/2006.
Grant support: National Cancer Institute of Canada-Canadian Prostate Cancer
Research Initiative (M. Zannis-Hadjopoulos), Cancer Research Society (G.B. Price), and
a studentship from the McGill University Cancer Consortium Training Grant in Cancer
Research of the Canadian Institutes of Health Research (STP-53888, D. Di Paola).
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
5102
www.aacrjournals.org
Downloaded from cancerres.aacrjournals.org on June 18, 2017. © 2006 American Association for Cancer
Research.
Origin Activity in Tumor versus Normal Cells
References
1. Edenberg HJ, Huberman JA. Eukaryotic chromosome
replication. Annu Rev Genet 1975;9:245–84.
2. Hand R. Eucaryotic DNA: organization of the genome
for replication. Cell 1978;15:317–25.
3. Zannis-Hadjopoulos M, Price GB. Regulatory parameters of DNA replication. Crit Rev Eukaryot Gene Expr
1998;8:81–106.
4. Zannis-Hadjopoulos M, Price GB. Eukaryotic DNA
replication. J Cell Biochem 1999;Supplements 32/33:1–14.
5. Price GB, Allarakhia M, Cossons N, et al. Identification
of a cis-element that determines autonomous DNA
replication in eukaryotic cells. J Biol Chem 2003;278:
19649–59.
6. Dutta A, Bell SP. Initiation of DNA replication in
eukaryotic cells. Annu Rev Cell Dev Biol 1997;13:
293–332.
7. Bell SP, Dutta A. DNA replication in eukaryotic cells.
Annu Rev Biochem 2002;71:333–74.
8. Bell SP. The origin recognition complex: from simple
origins to complex functions. Genes Dev 2002;16:659–72.
9. DePamphilis ML. How transcription factor regulate
origins of DNA replication in eukaryotic cells. Trends
Cell Biol 1993;3:161–7.
10. Ohba R, Matsumoto K, Ishimi Y. Induction of DNA
replication by transcription in the region upstream of
the human c-myc gene in a model replication system.
Mol Cell Biol 1996;16:5754–63.
11. Dhar V, Mager D, Iqbal A, Schildkraut C. The
coordinate replication of the human h-globin gene
domain reflects its transcriptional activity and nuclease
hypersensitivity. Mol Cell Biol 1988;8:4958–65.
12. Hatton K, Dhar V, Brown E, et al. Replication
program of active and inactive multigene families in
mammalian cells. Mol Cell Biol 1988;8:2148–58.
13. Melendy T, Li R. Chromatin remodeling and initiation of DNA replication. Front Biosci 2001;6:D1048–53.
14. Gerbi SA, Bielinsky AK. DNA replication and
chromatin. Curr Opin Genet Dev 2002;12:243–8.
15. Taddei A, Hediger F, Neumann FR, Gasser SM. The
function of nuclear architecture: a genetic approach.
Annu Rev Genet 2004;38:305–45.
16. Rein T, Zorbas H, DePamphilis ML. Active mammalian replication origins are associated with a highdensity cluster of mCpG dinucleotides. Mol Cell Biol
1997;17:416–26.
17. Delgado S, Gómez M, Bird A, Antequera F. Initiation
of DNA replication at CpG islands in mammalian
chromosomes. EMBO J 1998;17:2426–35.
18. Vogelauer M, Rubbi L, Lucas I, Brewer BJ, Grunstein
M. Histone acetylation regulates the time of replication
origin firing. Mol Cell 2002;10:1223–33.
19. Anglana M, Apiou F, Bensimon A, Debatisse M.
Dynamics of DNA replication in mammalian somatic
cells: nucleotide pool modulates origin choice and
interorigin spacing. Cell 2003;114:385–94.
www.aacrjournals.org
20. DePamphilis ML. Replication origins in metazoan
chromosomes: fact or fiction? BioEssays 1999;21:5–16.
21. DePamphilis ML. Eukaryotic DNA replication origins:
reconciling disparate data. Cell 2003;114:274–5.
22. Martin RG, Oppenheim A. Initiation points for DNA
replication in nontransformed and simian virus 40transformed Chinese hamster lung cells. Cell 1977;11:
859–69.
23. Oppenheim A, Martin RG. Initiation points for DNA
replication in nontransformed and simian virus 40transformed BALB/c 3T3 cells. J Virol 1978;25:450–2.
24. Collins J, Glock M, Chu A. Nuclease S1 sensitive
sites in potential deoxyribonucleic acid of cold- and
temperature-sensitive mammalian cells. Biochemistry
1982;21:3414–9.
25. Tao L, Nielsen T, Friedlander P, Zannis-Hadjopoulos
M, Price GB. Differential DNA replication origin
activities in human normal skin fibroblast and HeLa
cell lines. J Mol Biol 1997;273:509–18.
26. Tao L, Dong Z, Leffak M, Zannis-Hadjopoulos M,
Price GB. Major DNA replication initiation sites in the
c-myc locus in human cells. J Cell Biochem 2000;78:
442–57.
27. Tao L, Dong Z, Zannis-Hadjopoulos M, Price GB.
Immortalization of human WI38 cells is associated with
differential activation of the c-myc origins. J Cell
Biochem 2001;82:522–34.
28. Itoh-Lindstrom Y, Leffak M. Alteration of in vitro
DNA synthesis in the a globin locus of embryo
fibroblasts due to in vivo activity of Rous Sarcoma
Virus. Nucleic Acids Res 1994;22:498–508.
29. Kennedy BK, Barbie DA, Classon M, Dyson N, Harlow
E. Nuclear organization of DNA replication in primary
mammalian cells. Genes Dev 2000;14:2855–68.
30. Dimitrova DS, Berezney R. The spatio-temporal
organization of DNA replication sites is identical in
primary, immortalized and transformed mammalian
cells. J Cell Sci 2002;115:4037–51.
31. Panning MM, Gilbert DM. Spatio-temporal organization of DNA replication in murine embryonic stem,
primary, and immortalized cells. J Cell Biochem 2005;95:
74–82.
32. de Campos Vidal B, Russo J, Mello ML. DNA content
and chromatin texture of benzo(a)pyrene-transformed
human breast epithelial cells as assessed by image
analysis. Exp Cell Res 1998;244:77–82.
33. Takaha N, Hawkins AL, Griffin CA, Isaacs WB, Coffey
DS. High mobility group protein I(Y): a candidate
architectural protein for chromosomal rearrangements
in prostate cancer cells. Cancer Res 2002;62:647–51.
34. Amiel A, Litmanovitch T, Lishner M, et al.
Temporal differences in replication timing of homologous loci in malignant cells derived from CML and
lymphoma patients. Genes Chromosomes Cancer
1998;22:225–31.
35. Sambrook J, Fritsch EF, Maniatis T. Molecular
5103
cloning. 2nd ed. New York: Cold Spring Harbor
Laboratory Press; 1989.
36. Landry S, Zannis-Hadjopoulos M. Classes of autonomously replicating sequences are found among earlyreplicating monkey DNA. Biochim Biophys Acta 1991;
1088:234–44.
37. Matheos D, Ruiz MT, Price GB, Zannis-Hadjopoulos
M. Ku antigen, an origin-specific binding protein that
associates with replication proteins, is required for
mammalian DNA replication. Biochim Biophys Acta
2002;1578:59–72.
38. Matheos D, Novac O, Price GB, Zannis-Hadjopoulos
M. Analysis of the DNA replication competence of the
xrs-5 mutant cells defective in Ku86. J Cell Sci 2003;116:
111–24.
39. Novac O, Matheos D, Araujo FD, Price GB, ZannisHadjopoulos M. In vivo association of Ku with
mammalian origins of DNA replication. Mol Biol Cell
2001;12:3386–401.
40. Novac O, Alvarez D, Pearson CE, Price GB, ZannisHadjopoulos M. The human cruciform binding protein,
CBP, is involved in DNA replication and associates
in vivo with mammalian replication origins. J Biol Chem
2002;277:11174–83.
41. Giacca M, Zentilin L, Norio P, et al. Fine mapping of a
replication origin of human DNA. Proc Natl Acad Sci
U S A 1994;91:7119–23.
42. Gerbi S, Bielinsky AK. Replication initiation point
mapping. Methods Enzymol 1997;13:271–80.
43. Biamonti G, Perini G, Weighardt F, et al. A human
DNA replication origin: localization and transcriptional
characterization. Chromosoma 1992;102:S24–31.
44. Kumar S, Giacca M, Norio G, Biamonti G, Riva S,
Falaschi A. Utilization of the same DNA replication
origin by human cells of different derivation. Nucleic
Acids Res 1996;24:3289–94.
45. Ladenburger EM, Keller C, Knippers R. Identification
of a binding region for human origin recognition
complex proteins 1 and 2 that coincides with an origin
of DNA replication. Mol Cell Biol 2002;22:1036–48.
46. DePamphilis ML. The search for origins of DNA
replication. Methods 1997;13:211–9.
47. Biamonti G, Giacca M, Perini G, et al. The gene for a
novel human lamin maps at a highly transcribed locus
of chromosome 19 which replicates at the onset of
S-phase. Mol Cell Biol 1992;12:3499–506.
48. Bartkova J, Horejsi Z, Koed K, et al. DNA damage
response as a candidate anti-cancer barrier in early
human tumorigenesis. Nature 2005;434:864–70.
49. Gorgoulis VG, Vassiliou LV, Karakaidos P, et al.
Activation of the DNA damage checkpoint and genomic
instability in human precancerous lesions. Nature 2005;
434:907–13.
50. Bandura JL, Calvi BR. Duplication of the genome in
normal and cancer cell cycles. Cancer Biol Ther 2002;1:
8–13.
Cancer Res 2006; 66: (10). May 15, 2006
Downloaded from cancerres.aacrjournals.org on June 18, 2017. © 2006 American Association for Cancer
Research.
Differentially Active Origins of DNA Replication in Tumor
versus Normal Cells
Domenic Di Paola, Gerald B. Price and Maria Zannis-Hadjopoulos
Cancer Res 2006;66:5094-5103.
Updated version
Cited articles
Citing articles
E-mail alerts
Reprints and
Subscriptions
Permissions
Access the most recent version of this article at:
http://cancerres.aacrjournals.org/content/66/10/5094
This article cites 49 articles, 18 of which you can access for free at:
http://cancerres.aacrjournals.org/content/66/10/5094.full.html#ref-list-1
This article has been cited by 4 HighWire-hosted articles. Access the articles at:
/content/66/10/5094.full.html#related-urls
Sign up to receive free email-alerts related to this article or journal.
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Department at [email protected].
To request permission to re-use all or part of this article, contact the AACR Publications
Department at [email protected].
Downloaded from cancerres.aacrjournals.org on June 18, 2017. © 2006 American Association for Cancer
Research.