October 26, 2012
Cellular Biology
The Inflammatory Chemokine CXC Motif Ligand
16 Triggers Platelet Activation and Adhesion Via CXC
Motif Receptor 6–Dependent Phosphatidylinositide
3-Kinase/Akt Signaling
Oliver Borst,* Patrick Münzer,* Sergios Gatidis, Eva-Maria Schmidt, Tanja Schönberger, Evi Schmid,
Syeda T. Towhid, Konstantinos Stellos, Peter Seizer, Andreas E. May, Florian Lang, Meinrad Gawaz
Rationale: The recently discovered chemokine CXC motif ligand 16 (CXCL16) is highly expressed in atherosclerotic
lesions and is a potential pathogenic mediator in coronary artery disease.
Objective: The aim of this study was to test the role of CXCL16 on platelet activation and vascular adhesion, as well
as the underlying mechanism and signaling pathway.
Downloaded from http://circres.ahajournals.org/ by guest on June 18, 2017
Methods and Results: Reverse-transcriptase polymerase chain reaction, Western blotting, confocal microscopy,
and flow cytometry revealed that CXCL16-specific receptor, CXC motif receptor 6, is highly expressed in platelets.
According to flow cytometry and confocal microscopy, stimulation of platelets with CXCL16 induced platelet
degranulation, integrin αIIbβ3 activation, and shape change. CXCL16 increased Akt phosphorylation (Thr308/Ser473),
an effect abrogated by phosphatidylinositide 3-kinase inhibitors wortmannin (100 nmol/L) and LY294002
(25 µmol/L). The phosphatidylinositide 3-kinase inhibitors and Akt inhibitor SH-6 (20 µmol/L) further diminished
CXCL16-induced platelet activation. CXCL16-mediated platelet degranulation, integrin αIIbβ3 activation, and Akt
phosphorylation were blunted in platelets lacking CXCL16-specific receptor CXC motif receptor 6. CXCL16induced platelet activation was abrogated in Akt1- or Akt2-deficient platelets. CXCL16 enhanced platelet adhesion
to endothelium in vitro after high arterial shear stress (2000−s) and to injured vascular wall in vivo after carotid
ligation. CXCL16-induced stimulation of platelet adhesion again was prevented by phosphatidylinositide 3-kinase
and Akt inhibitors. Apyrase and antagonists of platelet purinergic receptors P2Y1 (MRS2179, 100 µmol/L) and
especially P2Y12 (Cangrelor, 10 µmol/L) blunted CXCL16-triggered platelet activation as well as CXCL16-induced
platelet adhesion under high arterial shear stress in vitro and after carotid ligation in vivo.
Conclusions: The inflammatory chemokine CXCL16 triggers platelet activation and adhesion via CXC motif
receptor 6–dependent phosphatidylinositide 3-kinase/Akt signaling and paracrine activation, suggesting a decisive
role for CXCL16 in linking vascular inflammation and thrombo-occlusive diseases. (Circ Res. 2012;111:1297-1307.)
Key Words: CXC motif ligand 16 ◼ CXC motif receptor 6 ◼ inflammation ◼ platelet activation
◼ phosphatidylinositide 3-kinase/Akt
P
latelet adhesion and activation are essential for primary
hemostasis at sites of vascular injury but also are critical
for the development of acute thrombotic occlusion at regions
of atherosclerotic plaque rupture, the major pathophysiological
mechanism underlying ischemic diseases such as myocardial
infarction or stroke.1 Platelet activation is triggered by various
agonists, including subendothelial collagens, ADP, or thrombin.2
The agonists lead to platelet degranulation, shape change, integrin
αIIbβ3 activation, and adhesion to the vascular wall.3 Apart from
thrombosis, there is increasing evidence that platelets are critically
involved in the pathogenesis of inflammatory diseases4,5 by
interacting with a variety of inflammatory cells.6 On inflammatory
stimulation, platelets rapidly adhere to the endothelium or to the
subendothelial extracellular matrix at sites of vascular endothelial
injury.4 Activated platelets release granule-stored cytokines (eg,
interleukin-1β)7 and chemokines (eg, CXC motif ligand [CXCL]
12/stromal cell–derived factor-1)8,9 into their microenvironment
and thereby modulate inflammatory mechanisms.
Original received August 30, 2011; revision received June 26, 2012; accepted August 27, 2012. In July 2012, the average time from submission to first
decision for all original research papers submitted to Circulation Research was 11.2 days.
From the Medizinische Klinik III, Department of Cardiology and Cardiovascular Medicine (O.B., T.S., K.S., P.S., A.E.M., M.G.) and Department of
Physiology (O.B., P.M., S.G., E-M.S., E.S., S.T.T., F.L.), University of Tübingen, Tübingen, Germany.
*These authors contributed equally to this work.
The online-only Data Supplement is available with this article at http://circres.ahajournals.org/lookup/suppl/doi:10.1161/CIRCRESAHA.112.
276444/-/DC1.
Correspondence to Meinrad Gawaz, Department of Cardiology/Cardiovascular Medicine, University of Tübingen, Otfried-Müller-St 10, 72076 Tübingen,
Germany. E-mail [email protected]
© 2012 American Heart Association, Inc.
Circulation Research is available at http://circres.ahajournals.org
DOI: 10.1161/CIRCRESAHA.112.276444
1297
1298 Circulation Research October 26, 2012
Non-standard Abbreviations and Acronyms
ACS
CXCL16
CXCR6
HUVEC
LY
PI3K
Wm
acute coronary syndrome
CXC motif ligand 16
CXC motif receptor 6
human umbilical vein endothelial cell
LY294002
phosphoinositide 3-kinase
wortmannin
Downloaded from http://circres.ahajournals.org/ by guest on June 18, 2017
Chemokines are a family of chemotactic cytokines that activate specific G-protein-coupled 7-transmembrane receptors.10
They are central players in processes of vascular inflammation by recruitment of leukocytes, leading to progression of
atherosclerosis and plaque destabilization.11,12 Accumulating
literature points to a delicate role of chemokines in thrombogenesis.13 Members of both the CC and CXC chemokine
families have been described to activate platelets via their
respective receptors.14 However, the exact signaling mechanisms of platelet activation by inflammatory chemokines are
still unknown.
The newly discovered chemokine of the CXC family,
CXCL16, has been proposed as an important pathogenic mediator in inflammatory diseases, including rheumatoid arthritis, glomerulonephritis, or prostate cancer.15 CXCL16 activates
its unique receptor CXC motif receptor 6 (CXCR6; originally
cloned as BONZO), which is expressed in numerous cells,
predominantly including leukocytes.16,17 CXCR6 promotes
atherosclerosis by supporting T-cell homing and macrophage
accumulation in the aortic wall as well as aortic smooth muscle cell proliferation.18,19 Intracellular signaling, followed by
an activation of CXCR6 by CXCL16, was shown to involve
phosphatidylinositide 3-kinase (PI3K) and its downstream effector Akt (protein kinase B).18,20
CXCL16 is produced by several inflammatory cells preferentially expressed within atherosclerotic plaques, including macrophages, dendritic cells, smooth muscle cells, or
lymphocytes.21 Unlike the majority of chemokines, which
are soluble and secreted, CXCL16 is expressed in 2 distinct forms. As surface-expressed transmembrane protein,
CXCL16 (also termed as scavenger receptor that binds phosphatidylserine and oxidized lipoprotein [SR-PSOX]) can
function as scavenger receptor for phosphatidylserine and
oxidized low-density lipoproteins.22–24
A soluble form of CXCL16, constitutively released by
proteolytic cleavage of the chemokine domain involving a
disintegrin and metalloproteinase 10 and a disintegrin and metalloproteinase 17,25 promotes directed migration of CXCR6+
inflammatory cells to atherosclerotic lesions.26
Recently, we found that CXCL16 is surface-expressed on
platelets and is released on platelet stimulation.27 Furthermore,
we could show that platelet surface expression of CXCL16
was significantly enhanced in platelets obtained from patients
with acute coronary syndrome (ACS) compared with platelets from patients with stable angina pectoris.27 Other recent
studies described CXCL16 as a positively associated marker
of inflammation and progression of coronary atherosclerosis,
particularly ACS.28,29 Furthermore, increased CXCL16 levels
were demonstrated to be associated with long-term mortality
in patients with ACS.10 Although platelets are known to be
the major players in the pathogenesis of atherothrombosis,5
nothing is known about the influence of CXCL16 on platelet
function.
The present study explored the functional significance of
CXCL16 for platelet activation. Furthermore, the role of PI3K/
Akt signaling, downstream of the CXCL16 receptor CXCR6,
in the regulation of CXCL16-sensitive platelet functions was
addressed, as well as the underlying mechanism of CXCL16induced platelet activation and adhesion was examined.
Methods
Chemicals and Antibodies
Platelets were activated using recombinant human or murine CXCL16
(R&D Systems), ADP (Sigma-Aldrich), thrombin (Calbiochem), or
collagen-related peptide (Richard Farndale). Fibrinogen (Enzyme
Research Laboratories) was used for aggregation studies. For pharmacological inhibition of PI3K and Akt signaling pathway, we used
wortmannin (Wm), LY294002 (LY), and SH-6 (all from Calbiochem),
as described previously.30 Purinergic receptors P2Y1 and P2Y12 were
antagonized with MRS2179 (Tocris Bioscience) and Cangrelor
(AR-C69931MX; The Medicines Company), thromboxane synthesis
was inhibited by indomethacin (Calbiochem), and apyrase (SigmaAldrich) was used for enzymatic degradation of extracellular ADP.
Preparation of Human Platelets
Human platelets were isolated as described previously.9 Blood from
healthy volunteers was collected in acid-citrate-dextrose buffer and
centrifuged at 200g for 20 minutes. The obtained platelet-rich plasma
was added to modified Tyrode-HEPES buffer (137 mmol/L NaCl,
2.8 mmol/L KCl, 12 mmol/L NaHCO3, 5 mmol/L glucose, 0.4
mmol/L Na2HPO4, 10 mmol/L HEPES, 0.1% bovine serum albumin,
pH 6.5). After centrifugation at 900g for 10 minutes and removal
of the supernatant, the resulting platelet pellet was resuspended in
Tyrode-HEPES buffer (pH 7.4, supplemented with 1 mmol/L CaCl2).
Mice
Gene-targeted mice lacking functional Akt1/protein kinase Bα
(akt1−/−) or Akt2/protein kinase Bβ (akt2−/−), as well as their wildtype littermates, were generated as described previously.31,32 For
intravital microscopy, C57BL/6J (Charles River) mice were used.
CXCR6-deficient mice (cxcr6−/−) and their respective wild-type littermates (cxcr6+/+) were purchased from Jackson Laboratories. All
animal experiments were conducted according to the German law for
the care and use of laboratory animals and were approved by local
authorities.
Preparation of Mouse Platelets
Platelets were obtained from 10- to 12-week-old akt1−/− and akt1+/+
mice as well as akt2−/− and akt2+/+ mice or cxcr6−/− and cxcr6+/+ mice
of either sex. The mice were anesthetized with ether, and blood was
drawn from the retro-orbital plexus into heparinized tubes. Blood
parameters were analyzed with pocH-100iv automatic hematology
analyzer (Sysmex). Platelet-rich plasma was obtained by centrifugation at 260g for 5 minutes. Platelet-rich plasma was then centrifuged
at 640g for 5 minutes to pellet the platelets. After 2 further washing steps, the pellet of washed platelets was resuspended in modified
Tyrode-HEPES buffer (pH 7.4, supplemented with 1 mmol/L CaCl2).
Reverse-Transcriptase Polymerase Chain
Reaction Analysis
CXCR6 mRNA expression in human platelets, as well as in murine
platelets of CXCR6- or Akt-deficient platelets and their wildtype littermates, was determined as described in the Online Data
Supplement Methods.
Borst et al CXCL16 in Platelet Activation 1299
Western Blot Analysis
Western blot analysis of CXCR6 expression, as well as activationdependent Akt phosphorylation in murine and human platelets, was
performed as described in the Online Data Supplement Methods.
Flow Cytometry
P-selectin expression was measured using a fluorescein isothiocyanate–labeled mouse anti-human P-selectin monoclonal antibody
(Clone AK-4; BD Biosciences). Activated integrin αIIbβ3 was quantified through binding of the fluorescein isothiocyanate–labeled
mouse anti-human monoclonal antibody PAC-1 (BD Biosciences).
Expression of CXCR6 was analyzed using a PE-labeled mouse antihuman CXCR6 monoclonal antibody (Clone 56811, R&D Systems).
Suitable isotype controls were used for each antibody.
Two-color analysis of mouse platelet activation was conducted
using fluorophore-labeled antibodies for P-selectin expression
(Wug.E9-FITC) and the active form of αIIbβ3 integrin (JON/A-PE), as
described previously.2
Immunofluorescence and Confocal Microscopy
Downloaded from http://circres.ahajournals.org/ by guest on June 18, 2017
CXCR6 expression and activation-dependent P-selectin exposure
in human platelets were determined as described in the Online Data
Supplement Methods.
Aggregometry
Light transmission aggregometry (Model 700; Chrono-Log) was performed with isolated human platelets (2.5×105/μL). After calibration,
agonists were added at the indicated concentrations and aggregation
was measured for 10 minutes with a stir speed of 1000 rpm at 37°C.
The extent of aggregation was quantified in percentage of light transmission. The data analysis was performed with AGGRO/LINK8 software (Chrono-Log).
Dynamic Platelet Adhesion In Vitro
Adhesion experiments under flow conditions were performed as
described previously.33 Human umbilical vein endothelial cells
(HUVECs) from an early passage of culture were grown to confluency, and 5×105 cells were attached on gelatin-coated glass slides
by overnight incubation in complete endothelial cell basal medium
(PAA). Washed human platelets were perfused over the HUVEC
monolayer in a flow chamber model (Oligene) at high arterial shear
rates (2000−s), and the cellular interaction events were recorded with
a charge-coupled device camera (Carl Zeiss) with ×40 magnification,
followed by analysis of the number of adherent platelets per highpower field.
Platelet Adhesion After Carotis Ligation In Vivo
Intravital fluorescence microscopy was performed as described previously.34 In brief, C57BL/6 mice were anesthetized by injection of
midazolame (5 mg/kg body weight; Ratiopharm), medetomidine
(0.5 mg/kg body weight, Pfizer), and fentanyl (0.05 mg/kg body
weight; CuraMed Pharma). The A. carotid com. was dissected free,
and diacetate carboxyfluorescein-labeled platelets treated as indicated were injected intravenously before carotid artery ligation. Before
and after injury, the platelet–vascular wall interactions were visualized by in vivo video microscopy.
Statistical Analysis
As indicated, data are provided as means±SD or SEM, and n represents the number of experiments. All data were tested for significance
using Student t test or 1-way ANOVA with the Dunnett post hoc test.
Only results with P<0.05 and P<0.01 were considered statistically
significant.
Results
In an initial experiment, platelet expression of CXCR6 was
analyzed. Reverse-transcriptase polymerase chain reaction
analysis, as well as confocal microscopy, Western blotting,
and flow cytometry of human and murine platelets, revealed
that the CXCL16-specific receptor CXCR6 (BONZO) is highly expressed in platelets (Figure 1). Because prostate cancer
cell lines are well-known for high CXCR6 expression,15,20,35
DU145 cells served as positive control.
According to flow cytometric analysis, stimulation of
platelets in vitro with CXCL16 (50, 100, and 200 ng/mL)
significantly enhanced the expression of P-selectin (200 ng/
mL: 92.8 ± 15.8 vs 27.6 ± 13.2; P<0.01) and activated integrin αIIbβ3 (200 ng/mL: 38.7 ± 8.9 vs 2.5 ± 2.3; P<0.01) at the
platelet surface (Figure 2A–2C). Confocal microscopy revealed degranulation as well as profound reorganization of
actin cytoskeleton and shape change of platelets treated with
increasing concentrations of CXCL16 (Figure 2B). In all
experiments described, stimulation with low-dose ADP (5
μmol/L) or thrombin (0.01 U/mL) was used as positive control. The extent of platelet stimulation triggered by CXCL16
was comparable with that found after treatment with ADP
(Figure 2A–2C).
To test the functional relevance of CXCL16-dependent
platelet stimulation for platelet adhesion to the vascular wall,
we performed in vitro flow chamber experiments and intravital microscopy after carotid artery ligation. In flow chamber experiments, we found a significantly enhanced platelet
adhesion to vascular endothelial cells (HUVEC) under conditions of high arterial shear rates (2000−s) after treatment
with increasing concentrations of CXCL16 up to 200 ng/mL
(53.9 ± 4.0 vs 24.1 ± 2.3; P<0.01; Figure 2D). Intravital microscopy after carotis ligation was used to study platelet adhesion under conditions of vascular injury in vivo. CXCL16
(200 ng/mL) was found to enhance platelet adhesion to
injured vascular wall after carotid ligation (1396 ± 122 vs
768 ± 79; P<0.01; Figure 2E). In flow chamber experiments,
as well as after carotis ligation, we again found a comparable
extent of adhesion after stimulation with ADP or CXCL16
(Figure 2D and 2E).
CXCL16 potentiates platelet activation in response to lowdose ADP stimulation (P-selectin: 95.4 ± 6.4 vs 46.2 ± 4.3;
P<0.01; PAC-1: 46.7 ± 6.9 vs 19.4 ± 2.1; P<0.01) but had no
further potentiating effect in response to stimulation with low
doses of thrombin or collagen-related peptide (Figure 3A).
CXCL16 alone does not induce platelet aggregation (even in
increasing concentrations up to 800 ng/mL; Online Figure I)
but significantly amplifies aggregation after stimulation with
low-dose ADP (51.1 ± 3.9 vs 29.3 ± 5.8; P<0.05), an effect that
was not found after stimulation with high-dose ADP and stimulation with other agonists such as collagen-related peptide or
thrombin (Figure 3B and 3C). Furthermore, we could show
that CXCL16 triggers fibrinogen-dependent platelet aggregation (Figure 3D and 3E). Preincubation of washed platelets
with CXCL16 (200 ng/mL) for 15 minutes was followed by
a significant induction of platelet aggregation after addition
of fibrinogen (100 μg/mL) compared with fibrinogen alone
(20.4 ± 2.4 vs 4.9 ± 1.8; P<0.01) or CXCL16 (20.4 ± 2.4 vs
3.5 ± 1.9; P<0.01) alone.
In Western blot analysis, CXCL16 significantly increased
phosphorylation of Akt at Thr308 and Ser473, which could
be prevented by preincubation with PI3K inhibitors Wm
(100 nmol/L) and LY (25 μmol/L) (Figure 4A). Consistent
1300 Circulation Research October 26, 2012
Downloaded from http://circres.ahajournals.org/ by guest on June 18, 2017
Figure 1. CXC motif receptor 6 (CXCR6) mRNA and protein expression in human platelets. A, Representative agarose gel electrophoresis
of CXCR6 mRNA level in human platelets (n=6) compared with prostate cancer cell line DU145 cells. GAPDH was used as loading control.
B, Representative Western blot of CXCR6 abundance in human platelets (n=4). DU145 cells serve as positive control and tubulin serve
as loading control. C, Arithmetic means±SEM (n=4) of mean fluorescence intensity (MFI) and representative overlay of flow cytometry
of CXCR6 membrane expression in human platelets. **P<0.01 indicates statistically significant difference. D, Representative confocal
microscopy of CXCR6 expression in human platelets (n=4). Prostate cancer cell line DU145 serves as positive control. Red, actin; green,
CXCR6. Scale bar, 10 μm. E, Arithmetic means±SEM (n=6) and representative agarose gel electrophoresis of CXCR6 mRNA level in cxcr6+/+
and cxcr6−/− platelets. GAPDH was used as loading control. **P<0.01 indicates statistically significant difference.
with these findings, the effect of CXCL16 on platelet
activation (degranulation, integrin αIIbβ3 activation) was
abolished after preincubation with the PI3K inhibitors
Wm (P-selectin: 126.0 ± 11.6 vs 52.6 ± 6.4; P<0.01; PAC1: 30.2 ± 6.6 vs 0.5 ± 0.5; P<0.01) and LY (P-selectin:
126.0 ± 11.6 vs 69.8 ± 10.6; P<0.05; PAC-1: 30.2 ± 6.6 vs
0.8 ± 0.5; P<0.01) as well as by the Akt inhibitor SH-6 (20
μmol/L) (P-selectin: 126.0 ± 11.6 vs 38.4 ± 8.0; P<0.01; PAC1: 30.2 ± 6.6 vs 1.7 ± 2.1; P<0.01) (Figure 4B). The CXCL16induced increase of platelet adhesion to vascular endothelium
in vitro after arterial shear stress (2000−s) or to injured
vascular wall in vivo after carotis ligation was similarly
prevented by preincubation with Wm (in vitro: 48.4 ± 4.5
vs 26.8 ± 1.8; P<0.01), LY (in vitro: 48.4 ± 4.5 vs 29.2 ± 3.1;
P<0.05; in vivo: 1446 ± 151 vs 783 ± 85; P<0.01), and SH-6
(in vitro: 48.4 ± 4.5 vs 25.9 ± 2.9; P>0.01; in vivo: 1446 ± 151
vs 707 ± 122; P<0.01) (Figure 4C–4E).
Furthermore, the upregulation of P-selectin (Akt1: 67.9 ± 13.2
vs 48.1 ± 5.4; P<0.05; Akt2: 67.9 ± 13.2 vs 24.3 ± 1.7; P<0.01)
and activated integrin αIIbβ3 (Akt1: 192.1 ± 23.8 vs 107.7 ± 14.4;
P<0.01; Akt2: 192.1 ± 23.8 vs 116.4 ± 15.2; P<0.01) by
CXCL16 (200 ng/mL) was significantly blunted in platelets
lacking either Akt1 (akt1−/−) or Akt2 (akt2−/−) compared with
platelets from corresponding wild-type mice (Figure 4F).
The CXCR6 expression was not found to be different in Aktdeficient platelets (Online Figure II).
For examining whether the effects of CXCL16 on platelet
activation attribute to activation and downstream signaling of
its receptor CXCR6, we analyzed CXCL16-dependent platelet degranulation and integrin αIIbβ3 activation as well as Akt
phosphorylation in cxcr6−/− and cxcr6+/+ platelets (Figure 5).
As shown in Figure 5A, CXCL16-dependent Akt
phosphorylation was abrogated in cxcr6−/− platelets compared
with cxcr6+/+ platelets. Consequentially, CXCL16-induced
platelet degranulation (71.1 ± 9.7 vs 16.9 ± 1.4; P<0.01) and integrin αIIbβ3 activation (169.0 ± 27.8 vs 42.3 ± 16.9; P<0.01) were
significantly reduced in cxcr6−/− platelets compared with cxcr6+/+
platelets, whereas ADP-dependent platelet activation was unaffected (Figure 5B).
To test the role of second-wave mechanisms in potentiating
CXCL16-mediated platelet activation, we used the ADPdegrading enzyme apyrase (1.5 U/mL) as well as antagonists of
purinergic receptors P2Y1 (MRS2179, 100 μmol/L) and P2Y12
(Cangrelor, 10 μmol/L). For inhibiting platelet thromboxane
synthesis, indomethacin (10 μmol/L) was used. As shown in
Figure 6A, antagonizing the purinergic receptors, especially
Borst et al CXCL16 in Platelet Activation 1301
Downloaded from http://circres.ahajournals.org/ by guest on June 18, 2017
Figure 2. Expression of P-selectin and activated integrin αIIbβ3 in human platelets after treatment with CXC motif ligand 16
(CXCL16) and adherence of CXCL16-stimulated platelets to the vascular wall under arterial high shear rates in vitro and after
carotis ligation in vivo. A, Flow cytometry of P-selectin expression in human platelets after CXCL16 stimulation (ng/mL). ADP (5 μmol/L)
and thrombin (0.01 U/mL) serve as positive control. Arithmetic means±SEM (n=8) of mean fluorescence intensity (MFI) are shown. *P<0.05
and **P<0.01 indicate statistically significant difference. B, Confocal microscopy of degranulation-dependent P-selectin abundance after
CXCL16 stimulation. ADP stimulation serves as positive control. Red, actin; green, P-selectin. Scale bar, 10 μm. C, Flow cytometry of
activated integrin αIIbβ3 (PAC-1) expression in human platelets after CXCL16 stimulation (ng/mL). ADP (5 μmol/L) and thrombin (0.01 U/
mL) serve as positive control. Arithmetic means±SEM (n=8) are shown. *P<0.05 and **P<0.01 indicate statistically significant difference.
D, Arithmetic means±SEM (n=11) of platelets adherent to human umbilical vein endothelial cells per high-power field under flow (high
shear rate, 2000−s) after stimulation with CXCL16 (ng/mL) or ADP. **P<0.01 indicates statistically significant difference. E, Arithmetic
means±SEM (n=6) per mm2 (left) and representative images (right) of firmly adherent platelets 10 minutes after carotid ligation. Platelets
were treated with Tyrode buffer (untreated), CXCL16 (200 ng/mL), or ADP as positive control. **P<0.01 indicates statistically significant
difference. Scale bar, 50 μm.
P2Y12 (P-selectin: 110.3 ± 16.8 vs 36.8 ± 5.1; P<0.01; PAC-1:
35.6 ± 5.9 vs 3.0 ± 1.4; P<0.01), as well as preincubation with
apyrase (P-selectin: 110.3 ± 16.8 vs 27.7 ± 3.1; P<0.01; PAC1: 35.6 ± 5.9 vs 2.3 ± 1.1; P<0.01), which completely inhibits
ADP expression, significantly diminished CXCL16-triggered
enhancement of platelet degranulation and integrin αIIbβ3
activation, whereas blockage of thromboxane synthesis was
without any significant effect on CXCL16-mediated platelet
activation. Similar effects were found when we tested the
role of purinergic receptors and its ligand ADP for CXCL16mediated platelet adhesion to intact endothelium (HUVEC
monolayer) under arterial shear stress or to injured vascular
wall in vivo. As shown before in fluorescence-activated cell
sorter analysis, antagonists of purinergic receptors and apyrase
potentially inhibited CXCL16-induced platelet adhesion to
intact or injured vascular wall under arterial shear stress in vitro
(purinergic receptors: 48.2 ± 4.4 vs 26.9 ± 0.9; P<0.01; apyrase:
48.2 ± 4.4 vs 24.6 ± 1.6; P<0.01) and after carotis ligation in vivo
(purinergic receptors: 1180 ± 55 vs 428 ± 38; P<0.01; apyrase:
1180 ± 55 vs 811 ± 78; P<0.05), whereas indomethacin again
was found to be without effect (Figure 6B and 6C).
Discussion
It becomes increasingly evident that platelets are important
bidirectional inflammatory effectors linking vascular inflamma­
tion, thrombosis, and atherogenesis.5,6,36 Activated platelets
present, secrete, and deposit chemokines, thereby exacerbating
atherogenesis by inducing recruitment of mononuclear cells
to inflammatory lesions of the vascular wall.7,14,37 However
chemokines can stimulate platelet activation and adhesion,
1302 Circulation Research October 26, 2012
Downloaded from http://circres.ahajournals.org/ by guest on June 18, 2017
Figure 3. Effect of CXC motif ligand 16 (CXCL16) on potentiating platelet degranulation, integrin αIIbβ3 activation, and
aggregation in response to different agonists. A, Flow cytometry of P-selectin (left) and activated integrin αIIbβ3 (PAC-1; right)
expression in human platelets after preincubation with or without CXCL16 (200 ng/mL) followed by stimulation with ADP (2.5 μmol/L),
thrombin (Thr; 0.001 U/mL), or collagen-related peptide (CRP; 0.1 μg/mL). Arithmetic means±SEM (n=6) are shown. *P<0.05 and **P<0.01
indicate statistically significant difference compared with resting platelets, ##P<0.01 statistically significant difference compared with
platelets pretreated with Tyrode buffer instead of CXCL16. B, Arithmetic means±SEM (n=6) of platelet aggregation after preincubation
with or without CXCL16 (200 ng/mL) followed by stimulation with ADP (2.5 μmol/L and 10 μmol/L), Thr (0.001 U/mL), or CRP (0.1 μg/mL)
are shown. *P<0.05 indicates statistically significant difference compared with platelets pretreated with Tyrode buffer instead of CXCL16.
C, Representative tracings of platelet aggregation after stimulation with CXCL16 (200 ng/mL; light gray line) and after preincubation
with (dark gray line) or without (black line) CXCL16 followed by stimulation with ADP (2.5 μmol/L). D, Arithmetic means±SEM (n=6) of
platelet aggregation in the presence or absence of pretreatment with CXCL16 (200 ng/mL) for 15 minutes (stir speed of 1000 rpm at
37°C) followed by addition of fibrinogen (100 μg/mL) or solvent control for further 15 minutes. **P<0.01 indicates statistically significant
difference of fibrinogen-induced platelet aggregation of platelets pretreated with CXCL16 (black bar) compared with platelets pretreated
with Tyrode buffer instead of CXCL16 (dark gray bar). ##P<0.01 indicates statistically significant difference between adding fibrinogen
(black bar) or solvent control (light gray bar) to CXCL16-pretreated platelets. E, Representative tracings of platelet aggregation before and
after addition of fibrinogen (100 μg/mL) to platelets pretreated with CXCL16 (200 ng/mL; black line) or Tyrode buffer (200 ng/mL; dark gray
line) and platelet aggregation of CXCL16-pretreated platelets before and after addition of solvent control for fibrinogen (light gray line).
amplifying the activation-dependent release of proatherogenic
and prothrombotic proteins from platelet granula.6,36 CXCL16
was shown to be expressed by macrophages, dendritic cells, and
lymphocytes in atherosclerotic lesions.38 Presence of platelet
antigens in atherosclerotic lesions raises the possibility that
persistent platelet activation may contribute to the progression
of atherosclerosis and result in thrombotic complications.13
Although the role of CXCL16 in atherogenesis is not wellunderstood, increased levels of CXCL16 were found in
inflammatory diseases as well as in ACS.27,28 Furthermore, high
levels of soluble CXCL16 in ACS, usually associated with
acute coronary thrombosis, are associated with an increased
long-term mortality.10 Nevertheless, the pathophysiological role
of CXCL16 for thrombotic diseases remained unclear. In the
present study, we could show for the first time that CXCL16
triggers platelet activation, enhances platelet adhesion, and
potentiates platelet aggregation (Figures 2 and 3), which are
major mechanisms underlying thrombotic artery occlusions.1
CXCL16 binds to its receptor, the 7-transmembrane
domain chemokine receptor CXCR6 (BONZO).16,19 Recent
studies defining CXCL16/CXCR6 as a unique receptor
ligand pair excluded unspecific binding of CXCL16 to other
receptors.39 CXCR6 participates in T-cell homing during
inflammation, adhesion processes of inflammatory cells, as
well as proliferation and invasion of tumor cells,19,40 but has
not been described in platelets so far. We could now show that
Borst et al CXCL16 in Platelet Activation 1303
Downloaded from http://circres.ahajournals.org/ by guest on June 18, 2017
Figure 4. Involvement of the
phosphatidylinositide 3-kinase (PI3K)/Akt
pathway in CXC motif ligand 16 (CXCL16)–
dependent platelet activation. A, Arithmetic
means±SEM (n=4) and representative Western blot
of Akt phosphorylation at Thr308 (left) and Ser473
(right) after stimulation with CXCL16 (200 ng/mL)
in the presence or absence of the PI3K inhibitors
LY294002 (LY; 25 μmol/L) and Wortmannin (Wm;
100 nmol/L). Dimethyl sulfoxide (DMSO; vehicle)
was added as solvent control. **P<0.01 indicates
statistically significant difference compared with
resting platelets. ##P<0.01 indicates statistically
significant difference compared with CXCL16stimulated platelets in the absence of PI3K inhibitor.
B, Arithmetic means±SEM (n=8) of flow cytometry
of P-selectin (left) and activated integrin αIIbβ3 (PAC1; right) expression in platelets after stimulation
with CXCL16 (200 ng/mL) in the presence or
absence of LY (25 μmol/L), Wm (100 nmol/L), SH-6
(20 μmol/L), or DMSO (vehicle) as solvent control.
**P<0.01 indicates statistically significant difference
compared with resting platelets. #P<0.05 and
##P<0.01 indicate statistically significant difference
compared with CXCL16-stimulated platelets in
the absence of PI3K or Akt inhibitor. C, Arithmetic
means±SEM (n=17) of CXCL16-stimulated platelets
(200 ng/mL) adherent to human umbilical vein
endothelial cells per high-power field under flow
(high shear rate, 2000−s) after preincubation with
PI3K inhibitors LY (25 μmol/L), Wm (100 nmol/L), or
Akt inhibitor SH-6 (20 μmol/L). **P<0.01 indicates
statistically significant difference compared with
resting platelets. #P<0.05 and ##P<0.01 indicate
statistically significant difference compared with
CXCL16-stimulated platelets in the absence of PI3K
or Akt inhibitor. D, Arithmetic means±SEM (n=6) of
firmly adherent platelets per mm2 10 minutes after
carotid ligation. CXCL16-stimulated platelets (200
ng/mL) were preincubated with LY (25 μmol/L),
SH-6 (20 μmol/L), or DMSO (vehicle) as solvent
control. **P<0.01 indicates statistically significant
difference compared with resting platelets.
##P<0.01 indicates statistically significant difference
compared with CXCL16-stimulated platelets in the
absence of PI3K or Akt inhibitor. E, Representative
images of firmly adherent platelets 10 minutes after
carotid ligation. Scale bar, 50 μm. F, Arithmetic
means±SEM (n=8) of P-selectin expression (left)
and integrin αIIbβ3 activation (right) in akt1+/+/
akt2+/+ (black bars), akt1−/−/akt2+/+ (dark gray bars),
and akt1+/+/akt2−/− (light gray bars) platelets after
stimulation with murine CXCL16 (200 ng/mL).
**P<0.01 indicates statistically significant difference
compared with resting akt1+/+/akt2+/+ platelets.
#P<0.05 and ##P<0.01 indicate statistically
significant difference compared with CXCL16stimulated akt1+/+/akt2+/+ platelets.
CXCR6 is strongly expressed at mRNA and protein level of
human and murine platelets (Figure 1). By examinations in
cxcr6−/− platelets, we found that CXCL16-dependent platelet
activation critically depends on binding to and signaling via
the platelet CXCR6 receptor (Figure 5).
CXCR6-dependent signaling involves the PI3K and Akt
pathway.18,20 PI3K, as well as its downstream effector Akt,
plays a decisive role in the regulation of platelet function.41
Two isoforms of Akt, Akt1 and Akt2, are expressed in platelets and are described to have similar overlapping functions in
platelet activation.42 Phosphorylation of both Thr308 and Ser473
is required for full enzymatic activity.43 In the present study,
we could show that CXCL16 significantly increases phosphorylation of Akt, an effect completely abrogated in CXCR6deficient platelets (Figure 5A) and by preincubation of human
platelets with LY or Wm (Figure 4A), indicating that CXCL16
1304 Circulation Research October 26, 2012
Downloaded from http://circres.ahajournals.org/ by guest on June 18, 2017
Figure 5. CXC motif receptor 6 (CXCR6) dependency of CXC motif ligand 16 (CXCL16)–induced platelet Akt phosphorylation and
activation. A, Arithmetic means±SEM (n=4) and representative Western blot of Akt phosphorylation at Thr308 (left) and Ser473 (right) in
cxcr6+/+ (black bars) and cxcr6−/− (gray bars) platelets after stimulation with CXCL16 (200 ng/mL) or ADP (10 μmol/L). **P<0.01 indicates
statistically significant difference compared with resting cxcr6+/+ platelets. ##P<0.01 indicates statistically significant difference compared
with CXCL16-stimulated cxcr6+/+ platelets. B, Arithmetic means±SEM (n=8) of flow cytometry of P-selectin expression (left) and integrin
αIIbβ3 activation (right) in cxcr6+/+ (black bars) and cxcr6−/− (gray bars) platelets after stimulation with CXCL16 (200 ng/mL) or ADP
(10 μmol/L). **P<0.01 indicates statistically significant difference compared with resting cxcr6+/+ platelets. ##P<0.01 indicates statistically
significant difference compared with CXCL16-stimulated cxcr6+/+ platelets.
activates Akt in platelets in a CXCR6- and PI3K-dependent
manner. Furthermore, we found a significant reduction of
CXCL16-induced platelet degranulation and integrin αIIbβ3
activation after preincubation with the PI3K inhibitors LY (25
μmol/L) and Wm (100 nmol/L), as well as with the Akt inhibitor SH-6 (20 μmol/L) (Figure 4B).
Akt1 and Akt2 have been shown to be central regulators
of platelet secretion and integrin inside-out signaling.44,45
Consistent with these findings, platelet activation triggered
by CXCL16 was blunted in platelets from mice lacking either Akt1 (akt1−/−) or Akt2 (akt2−/−) (Figure 4F), apparently
indicating that both platelet Akt isoforms are involved in
downstream signaling of CXCR6. Thus, knockout of 1 of the
2 kinases does not fully abrogate platelet activation induced
by CXCR6 ligand CXCL16 (Figure 4F). CXCR6 expression
itself was not found to be different in Akt-deficient platelets
(Online Figure II).
Enhanced CXCL16 expression has been found in atherosclerotic lesions in apolipoprotein E–deficient mice.46
Furthermore, it could be shown that CXCL16 appears initially
in the endothelium at sites predisposed to atherosclerotic lesion formation without visible lesions promoting monocyte
recruitment during early atherogenesis.47 The finding that
CXCL16 induces activation (degranulation and integrin αIIbβ3
activation) of circulating platelets, which in turn could promote
release of platelet-derived inflammatory mediators, resulting
in enhanced leukocyte recruitment,48 suggests a vicious circle
that potentially aggravates progression of atherogenesis. Mice
lacking platelet P-selectin or integrin αIIb have been shown to
be protected against development of atherosclerotic lesions,
indicating the predominant role of platelets in the initiation
of atherogenesis.34,49 Activated platelets are able to adhere to
intact endothelium,50 a mechanism that is critically involved
in the initiation of early atherosclerotic lesion formation and,
moreover, in promoting thrombotic processes dependent on
platelet recruitment to the vascular wall.51 In the present study,
we could show that CXCL16 increased platelet adhesion to
an HUVEC monolayer under arterial shear stress (2000−s) in a
PI3K-dependent manner (Figures 2D and 4C).
Late stages of atherosclerosis often are associated with
thrombotic complications caused by vascular injury and compromised endothelial integrity.13 Therefore, we investigated
the role of CXCL16 in platelet adhesion to injured vascular
wall after carotis ligation. As shown in Figure 2E, we found
a significant CXCL16-induced upregulation of platelet adhesion after vascular injury. Our results let us speculate that
CXCL16 expression in atherosclerotic lesions and release
from inflammatory cells could be an additional local proadhesive stimulus for circulating platelets, resulting in increased
platelet adhesion at sites of vascular injury.
Platelets express different chemokine receptors, and some
chemokines already have been demonstrated to activate platelets.14,52–55 Partly, the activation occurs only in combination
with a weak platelet agonist;53,54 partly, the activation is independently from costimulation or prestimulation.52,55 Although
there is evolving evidence that chemokines expressed in atherosclerotic plaques and released from mononuclear cells involved in inflammatory diseases can induce a prothrombotic
Borst et al CXCL16 in Platelet Activation 1305
Downloaded from http://circres.ahajournals.org/ by guest on June 18, 2017
Figure 6. Involvement of the purinergic receptors P2Y1 and P2Y12 to the CXC motif ligand 16 (CXCL16)–mediated platelet
activation. A, Flow cytometry of P-selectin (left) and activated integrin αIIbβ3 (PAC-1; right) expression in platelets after stimulation
with CXCL16 (200 ng/mL) in the presence or absence of purinergic receptors P2Y1 and P2Y12 antagonists MRS2179 (MRS; 100 μmol/L),
Cangrelor (Cgr; 10 μmol/L), or the combination MRS/Cgr, the ADP-degrading enzyme apyrase (Apy; 1.5 U/mL), or indomethacin (Indo;
10 μmol/L). Arithmetic means±SEM (n=8) are shown. **P<0.01 indicates statistically significant difference compared with resting platelets.
#P<0.05 and ##P<0.01 compared with CXCL16-stimulated platelets in the absence of purinergic receptors antagonists, Apy or Indo.
B, Arithmetic means±SEM (n=19) of CXCL16-stimulated platelets (200 ng/mL) adherent to human umbilical vein endothelial cells per
high-power field under flow (at high shear rates, 2000−s) in the presence or absence of purinergic receptors P2Y1 and P2Y12 inhibitors
MRS2179 (100 μmol/L)/Cgr (10 μmol/L) (MRS/Cgr), as well as Apy (1.5 U/mL) or Indo (10 μmol/L). **P<0.01 indicates statistically
significant difference compared with resting platelets. ##P<0.01 indicates statistically significant difference compared with CXCL16stimulated platelets in the absence of purinergic receptors antagonists, Apy or Indo. C, Arithmetic means±SEM (n=6) per mm2 (left) and
representative images (right) of firmly adherent platelets 10 minutes after carotid ligation. Platelets were treated with CXCL16 (200 ng/mL)
in the presence or absence of purinergic receptors P2Y1 and P2Y12 antagonists MRS2179 (100 μmol/L)/Cgr (10 μmol/L) (MRS/Cgr), as well
as Apy (1.5 U/mL) or Indo (10 μmol/L). **P<0.01 indicates statistically significant difference compared with resting platelets. #P<0.05 and
##P<0.01 indicates statistically significant difference compared with CXCL16-stimulated platelets in the absence of purinergic receptors
antagonists, Apy or Indo. Scale bar, 50 μm; n.s indicates nonsignificant.
state via platelet activation, only little is known about signaling pathways and mechanisms mediating these effects.
Although CXCL16 is associated with occurrence and severity
of thrombotic diseases such as ACS, nothing was known about
the role of CXCL16 in platelet activation.
Although classified as a CXC chemokine, CXCL16 shares
close structural similarities with CX3CL1 (fractalkine).20 In
recent studies, fractalkine was shown to induce platelet activation, leading to enhanced platelet adhesion in vitro. The
authors speculated that ADP or thromboxane synthesis could
be involved in fractalkine-dependent platelet stimulation, an
effect prevented by apyrase.55
Platelet activation by ADP is mediated by its 2 purinergic
receptors, P2Y1 and P2Y12,43 which are furthermore described to
participate in mechanisms of platelet adhesion.56–58 As shown
in Figure 6, CXCL16-triggered platelet degranulation and integrin αIIbβ3 activation, as well as CXCL16-induced platelet
adhesion to vascular wall, were diminished after preincubation
with the ADP-degrading enzyme apyrase or the purinergic receptor antagonists MRS2179 and Cangrelor (AR-C69931MX),
1306 Circulation Research October 26, 2012
Downloaded from http://circres.ahajournals.org/ by guest on June 18, 2017
indicating that ADP has a potentiating effect on CXCL16mediated platelet stimulation. Apparently, both P2Y1 and P2Y12
receptors are involved in CXCL16-dependent platelet activation, in which P2Y12 plays the more important role (Figure 6A),
which is consistent with findings of other studies.59 However,
thromboxane synthesis was not found to be involved because
CXCL16-triggered platelet activation was not affected by coincubation with indomethacin (Figure 6). Through purinergic
receptor signaling, ADP activates the PI3K/Akt signaling pathway,60 an effect that could aggravate CXCL16-mediated platelet
activation. Akt is a possible candidate for mediating further second-wave signaling by regulating platelet secretory pathways.42
The second-wave signaling could potentiate CXCL16-induced
Akt-dependent triggering of platelet activation. In this way, the
phosphorylation of Akt could underlie synergistic effects of
CXCL16 and ADP in paracrine/autocrine platelet activation.
In conclusion, the inflammatory chemokine CXCL16 triggers
platelet CXCR6-dependent PI3K/Akt signaling, leading to degranulation and integrin αIIbβ3 activation. CXCL16-dependent
platelet activation involves ADP-mediated paracrine/autocrine
stimulation and fosters platelet adhesion to intact as well as to
injured endothelium. Thus, CXCL16 could play a decisive role
in linking inflammatory vascular diseases and thrombosis.
Acknowledgments
The authors thank Y. Riexinger for providing outstanding technical
assistance.
Sources of Funding
This work has been supported, in part, by grants from the Deutsche
Forschungsgemeinschaft (Transregio SFB19 and the Klinische
Forschergruppe KFO274), a Fortüne Fellowship to O. Borst (19340-0), and the Tuebingen Platelet Investigative Consortium (TuePIC).
Disclosures
None.
References
1.Ruggeri ZM. Platelets in atherothrombosis. Nat Med. 2002;8:
1227–1234.
2. Borst O, Schmidt EM, Münzer P, Schönberger T, Towhid ST, Elvers M,
Leibrock C, Schmid E, Eylenstein A, Kuhl D, May AE, Gawaz M, Lang
F. The serum- and glucocorticoid-inducible kinase 1 (SGK1) influences
platelet calcium signaling and function by regulation of Orai1 expression
in megakaryocytes. Blood. 2012;119:251–261.
3. Varga-Szabo D, Braun A, Nieswandt B. Calcium signaling in platelets.
J Thromb Haemost. 2009;7:1057–1066.
4. Langer HF, Choi EY, Zhou H, et al. Platelets contribute to the pathogenesis of experimental autoimmune encephalomyelitis. Circ Res.
2012;110:1202–1210.
5. Gawaz M, Langer H, May AE. Platelets in inflammation and atherogenesis.
J Clin Invest. 2005;115:3378–3384.
6. May AE, Seizer P, Gawaz M. Platelets: inflammatory firebugs of vascular
walls. Arterioscler Thromb Vasc Biol. 2008;28:s5–10.
7. Gawaz M, Brand K, Dickfeld T, Pogatsa-Murray G, Page S, Bogner C,
Koch W, Schömig A, Neumann F. Platelets induce alterations of chemotactic and adhesive properties of endothelial cells mediated through
an interleukin-1-dependent mechanism. Implications for atherogenesis.
Atherosclerosis. 2000;148:75–85.
8. Massberg S, Konrad I, Schürzinger K, et al. Platelets secrete stromal
cell-derived factor 1alpha and recruit bone marrow-derived progenitor
cells to arterial thrombi in vivo. J Exp Med. 2006;203:1221–1233.
9. Stellos K, Langer H, Daub K, et al. Platelet-derived stromal cell-derived
factor-1 regulates adhesion and promotes differentiation of human CD34+
cells to endothelial progenitor cells. Circulation. 2008;117:206–215.
10. Jansson AM, Aukrust P, Ueland T, Smith C, Omland T, Hartford M,
Caidahl K. Soluble CXCL16 predicts long-term mortality in acute coronary syndromes. Circulation. 2009;119:3181–3188.
11.Aukrust P, Halvorsen B, Yndestad A, Ueland T, Øie E, Otterdal
K, Gullestad L, Damås JK. Chemokines and cardiovascular risk.
Arterioscler Thromb Vasc Biol. 2008;28:1909–1919.
12.Zernecke A, Weber C. Chemokines in the vascular inflammatory response of atherosclerosis. Cardiovasc Res. 2010;86:192–201.
13. Lambert MP, Sachais BS, Kowalska MA. Chemokines and thrombogenicity. Thromb Haemost. 2007;97:722–729.
14. Gleissner CA, von Hundelshausen P, Ley K. Platelet chemokines in
vascular disease. Arterioscler Thromb Vasc Biol. 2008;28:1920–1927.
15. Darash-Yahana M, Gillespie JW, Hewitt SM, Chen YY, Maeda S, Stein I,
Singh SP, Bedolla RB, Peled A, Troyer DA, Pikarsky E, Karin M, Farber
JM. The chemokine CXCL16 and its receptor, CXCR6, as markers and
promoters of inflammation-associated cancers. PLoS ONE. 2009;4:e6695.
16. Matloubian M, David A, Engel S, Ryan JE, Cyster JG. A transmembrane
CXC chemokine is a ligand for HIV-coreceptor Bonzo. Nat Immunol.
2000;1:298–304.
17. Sheikine Y, Sirsjö A. CXCL16/SR-PSOX–a friend or a foe in atherosclerosis? Atherosclerosis. 2008;197:487–495.
18. Chandrasekar B, Bysani S, Mummidi S. CXCL16 signals via Gi, phosphatidylinositol 3-kinase, Akt, I kappa B kinase, and nuclear factorkappa B and induces cell-cell adhesion and aortic smooth muscle cell
proliferation. J Biol Chem. 2004;279:3188–3196.
19.Galkina E, Harry BL, Ludwig A, Liehn EA, Sanders JM, Bruce A,
Weber C, Ley K. CXCR6 promotes atherosclerosis by supporting T-cell
homing, interferon-gamma production, and macrophage accumulation
in the aortic wall. Circulation. 2007;116:1801–1811.
20. Wang J, Lu Y, Wang J, Koch AE, Zhang J, Taichman RS. CXCR6 induces prostate cancer progression by the AKT/mammalian target of
rapamycin signaling pathway. Cancer Res. 2008;68:10367–10376.
21. Petit SJ, Wise EL, Chambers JC, Sehmi J, Chayen NE, Kooner JS, Pease
JE. The CXCL16 A181V mutation selectively inhibits monocyte adhesion to CXCR6 but is not associated with human coronary heart disease.
Arterioscler Thromb Vasc Biol. 2011;31:914–920.
22. Minami M, Kume N, Shimaoka T, Kataoka H, Hayashida K, Akiyama
Y, Nagata I, Ando K, Nobuyoshi M, Hanyuu M, Komeda M, Yonehara
S, Kita T. Expression of SR-PSOX, a novel cell-surface scavenger receptor for phosphatidylserine and oxidized LDL in human atherosclerotic lesions. Arterioscler Thromb Vasc Biol. 2001;21:1796–1800.
23. Shimaoka T, Kume N, Minami M, Hayashida K, Kataoka H, Kita T,
Yonehara S. Molecular cloning of a novel scavenger receptor for oxidized low density lipoprotein, SR-PSOX, on macrophages. J Biol Chem.
2000;275:40663–40666.
24.Borst O, Abed M, Alesutan I, Towhid ST, Qadri SM, Föller M,
Gawaz M, Lang F. Dynamic adhesion of eryptotic erythrocytes to endothelial cells via CXCL16/SR-PSOX. Am J Physiol Cell Physiol.
2012;302:C644–C651.
25. Abel S, Hundhausen C, Mentlein R, Schulte A, Berkhout TA, Broadway
N, Hartmann D, Sedlacek R, Dietrich S, Muetze B, Schuster B, Kallen
KJ, Saftig P, Rose-John S, Ludwig A. The transmembrane CXCchemokine ligand 16 is induced by IFN-gamma and TNF-alpha and
shed by the activity of the disintegrin-like metalloproteinase ADAM10.
J Immunol. 2004;172:6362–6372.
26.Aslanian AM, Charo IF. Targeted disruption of the scavenger receptor and chemokine CXCL16 accelerates atherosclerosis. Circulation.
2006;114:583–590.
27. Seizer P, Stellos K, Selhorst G, Krämer BF, Lang MR, Gawaz M, May
AE. CXCL16 is a novel scavenger receptor on platelets and is associated
with acute coronary syndrome. Thromb Haemost. 2011;105:1112–1114.
28. Lehrke M, Millington SC, Lefterova M, Cumaranatunge RG, Szapary P,
Wilensky R, Rader DJ, Lazar MA, Reilly MP. CXCL16 is a marker of
inflammation, atherosclerosis, and acute coronary syndromes in humans.
J Am Coll Cardiol. 2007;49:442–449.
29. Mitsuoka H, Toyohara M, Kume N, Hayashida K, Jinnai T, Tanaka M,
Kita T. Circulating soluble SR-PSOX/CXCL16 as a biomarker for acute
coronary syndrome -comparison with high-sensitivity C-reactive protein. J Atheroscler Thromb. 2009;16:586–593.
30. Yin H, Stojanovic A, Hay N, Du X. The role of Akt in the signaling
pathway of the glycoprotein Ib-IX induced platelet activation. Blood.
2008;111:658–665.
31. Cho H, Thorvaldsen JL, Chu Q, Feng F, Birnbaum MJ. Akt1/PKBalpha
is required for normal growth but dispensable for maintenance of glucose homeostasis in mice. J Biol Chem. 2001;276:38349–38352.
Borst et al CXCL16 in Platelet Activation 1307
Downloaded from http://circres.ahajournals.org/ by guest on June 18, 2017
32.Cho H, Mu J, Kim JK, Thorvaldsen JL, Chu Q, Crenshaw EB 3rd,
Kaestner KH, Bartolomei MS, Shulman GI, Birnbaum MJ. Insulin resistance and a diabetes mellitus-like syndrome in mice lacking the protein
kinase Akt2 (PKB beta). Science. 2001;292:1728–1731.
33.Langer H, May AE, Daub K, Heinzmann U, Lang P, Schumm M,
Vestweber D, Massberg S, Schönberger T, Pfisterer I, Hatzopoulos AK,
Gawaz M. Adherent platelets recruit and induce differentiation of murine
embryonic endothelial progenitor cells to mature endothelial cells in vitro. Circ Res. 2006;98:e2–10.
34. Massberg S, Schürzinger K, Lorenz M, Konrad I, Schulz C, Plesnila N,
Kennerknecht E, Rudelius M, Sauer S, Braun S, Kremmer E, Emambokus
NR, Frampton J, Gawaz M. Platelet adhesion via glycoprotein IIb integrin
is critical for atheroprogression and focal cerebral ischemia: an in vivo
study in mice lacking glycoprotein IIb. Circulation. 2005;112:1180–1188.
35. Lu Y, Wang J, Xu Y, Koch AE, Cai Z, Chen X, Galson DL, Taichman RS,
Zhang J. CXCL16 functions as a novel chemotactic factor for prostate
cancer cells in vitro. Mol Cancer Res. 2008;6:546–554.
36. Weber C. Platelets and chemokines in atherosclerosis: partners in crime.
Circ Res. 2005;96:612–616.
37. Koenen RR, von Hundelshausen P, Nesmelova IV, Zernecke A, Liehn
EA, Sarabi A, Kramp BK, Piccinini AM, Paludan SR, Kowalska MA,
Kungl AJ, Hackeng TM, Mayo KH, Weber C. Disrupting functional interactions between platelet chemokines inhibits atherosclerosis in hyperlipidemic mice. Nat Med. 2009;15:97–103.
38. Zernecke A, Shagdarsuren E, Weber C. Chemokines in atherosclerosis:
an update. Arterioscler Thromb Vasc Biol. 2008;28:1897–1908.
39. Wilbanks A, Zondlo SC, Murphy K, Mak S, Soler D, Langdon P, Andrew
DP, Wu L, Briskin M. Expression cloning of the STRL33/BONZO/
TYMSTRligand reveals elements of CC, CXC, and CX3C chemokines.
J Immunol. 2001;166:5145–5154.
40.Shimaoka T, Nakayama T, Fukumoto N, Kume N, Takahashi S,
Yamaguchi J, Minami M, Hayashida K, Kita T, Ohsumi J, Yoshie O,
Yonehara S. Cell surface-anchored SR-PSOX/CXC chemokine ligand
16 mediates firm adhesion of CXC chemokine receptor 6-expressing
cells. J Leukoc Biol. 2004;75:267–274.
41. Stojanovic A, Marjanovic JA, Brovkovych VM, Peng X, Hay N, Skidgel
RA, Du X. A phosphoinositide 3-kinase-AKT-nitric oxide-cGMP signaling pathway in stimulating platelet secretion and aggregation. J Biol
Chem. 2006;281:16333–16339.
42.Woulfe DS. Akt signaling in platelets and thrombosis. Expert Rev
Hematol. 2010;3:81–91.
43. Kim S, Jin J, Kunapuli SP. Akt activation in platelets depends on Gi
signaling pathways. J Biol Chem. 2004;279:4186–4195.
44. Chen J, De S, Damron DS, Chen WS, Hay N, Byzova TV. Impaired
platelet responses to thrombin and collagen in AKT-1-deficient mice.
Blood. 2004;104:1703–1710.
45.Woulfe D, Jiang H, Morgans A, Monks R, Birnbaum M, Brass LF.
Defects in secretion, aggregation, and thrombus formation in platelets
from mice lacking Akt2. J Clin Invest. 2004;113:441–450.
46. Wuttge DM, Zhou X, Sheikine Y, Wågsäter D, Stemme V, Hedin U,
Stemme S, Hansson GK, Sirsjö A. CXCL16/SR-PSOX is an interferongamma-regulated chemokine and scavenger receptor expressed in atherosclerotic lesions. Arterioscler Thromb Vasc Biol. 2004;24:750–755.
47. Hofnagel O, Engel T, Severs NJ, Robenek H, Buers I. SR-PSOX at
sites predisposed to atherosclerotic lesion formation mediates monocyte-endothelial cell adhesion. Atherosclerosis. 2011;217:371–378.
48. Huo Y, Schober A, Forlow SB, Smith DF, Hyman MC, Jung S, Littman
DR, Weber C, Ley K. Circulating activated platelets exacerbate
atherosclerosis in mice deficient in apolipoprotein E. Nat Med.
2003;9:61–67.
49. Burger PC, Wagner DD. Platelet P-selectin facilitates atherosclerotic lesion development. Blood. 2003;101:2661–2666.
50.Bombeli T, Schwartz BR, Harlan JM. Adhesion of activated platelets to endothelial cells: evidence for a GPIIbIIIa-dependent bridging
mechanism and novel roles for endothelial intercellular adhesion molecule 1 (ICAM-1), alphavbeta3 integrin, and GPIbalpha. J Exp Med.
1998;187:329–339.
51. Massberg S, Brand K, Grüner S, Page S, Müller E, Müller I, Bergmeier
W, Richter T, Lorenz M, Konrad I, Nieswandt B, Gawaz M. A critical
role of platelet adhesion in the initiation of atherosclerotic lesion formation. J Exp Med. 2002;196:887–896.
52.Abi-Younes S, Sauty A, Mach F, Sukhova GK, Libby P, Luster
AD. The stromal cell-derived factor-1 chemokine is a potent platelet agonist highly expressed in atherosclerotic plaques. Circ Res.
2000;86:131–138.
53. Gear AR, Suttitanamongkol S, Viisoreanu D, Polanowska-Grabowska
RK, Raha S, Camerini D. Adenosine diphosphate strongly potentiates
the ability of the chemokines MDC, TARC, and SDF-1 to stimulate
platelet function. Blood. 2001;97:937–945.
54. Kowalska MA, Ratajczak MZ, Majka M, Jin J, Kunapuli S, Brass L,
Poncz M. Stromal cell-derived factor-1 and macrophage-derived chemokine: 2 chemokines that activate platelets. Blood. 2000;96:50–57.
55. Schäfer A, Schulz C, Eigenthaler M, Fraccarollo D, Kobsar A, Gawaz M,
Ertl G, Walter U, Bauersachs J. Novel role of the membrane-bound chemokine fractalkine in platelet activation and adhesion. Blood. 2004;103:
407–412.
56. Andre P, Delaney SM, LaRocca T, Vincent D, DeGuzman F, Jurek M,
Koller B, Phillips DR, Conley PB. P2Y12 regulates platelet adhesion/
activation, thrombus growth, and thrombus stability in injured arteries.
J Clin Invest. 2003;112:398–406.
57. Léon C, Hechler B, Freund M, Eckly A, Vial C, Ohlmann P, Dierich A,
LeMeur M, Cazenave JP, Gachet C. Defective platelet aggregation and
increased resistance to thrombosis in purinergic P2Y(1) receptor-null
mice. J Clin Invest. 1999;104:1731–1737.
58. Remijn JA, Wu YP, Jeninga EH, IJsseldijk MJ, van Willigen G, de Groot
PG, Sixma JJ, Nurden AT, Nurden P. Role of ADP receptor P2Y(12) in
platelet adhesion and thrombus formation in flowing blood. Arterioscler
Thromb Vasc Biol. 2002;22:686–691.
59. Cosemans JM, Munnix IC, Wetzker R, Heller R, Jackson SP, Heemskerk
JW. Continuous signaling via PI3K isoforms beta and gamma is required
for platelet ADP receptor function in dynamic thrombus stabilization.
Blood. 2006;108:3045–3052.
60.Kim S, Mangin P, Dangelmaier C, Lillian R, Jackson SP, Daniel
JL, Kunapuli SP. Role of phosphoinositide 3-kinase beta in glycoprotein VI-mediated Akt activation in platelets. J Biol Chem.
2009;284:33763–33772.
Novelty and Significance
What Is Known?
• Platelets represent an important linkage between inflammation and
thrombosis.
• Specific chemokines are released by inflammatory processes that can
influence platelet properties and function, which in turn propagate
inflammation.
What New Information Does This Article Contribute?
• The chemokine CXC motif ligand 16 (CXCL16) is critically involved in
inflammation-triggered platelet activation and thrombus formation.
• The signaling pathway triggered by CXCL16 involves signaling via the
CXCL16-sepcific receptor CXC motif receptor 6 and the downstream
signal cascade via phosphoinositide 3-kinase and Akt.
• CXCL16 induces the release of granule constituents into the microenvironment of activated platelets.
There is growing evidence that platelets play a critical role in the
linkage between inflammation and thrombosis; however, the exact
underlying mechanisms remain unclear. The present study provides
strong evidence that the inflammatory chemokine CXCL16 mediates
platelet activation and is a critical link between inflammation and
thrombosis. We report for the first time that the functional CXCL16specific receptor CXC motif receptor 6 is strongly expressed on platelet surface, and we elucidated the signaling cascade downstream
of the CXC motif receptor 6 receptor involving phosphoinositide 3kinase and Akt. Furthermore, the present study shows that paracrine
activation via purinergic receptors is involved in chemokine-triggered
platelet activation. Understanding the interaction of CXCL16 with
platelets in the milieu of inflammatory diseases may open new avenues for diagnostic and therapeutic strategies for treating cardiovascular disease and other inflammatory disorders
Downloaded from http://circres.ahajournals.org/ by guest on June 18, 2017
The Inflammatory Chemokine CXC Motif Ligand 16 Triggers Platelet Activation and
Adhesion Via CXC Motif Receptor 6−Dependent Phosphatidylinositide 3-Kinase/Akt
Signaling
Oliver Borst, Patrick Münzer, Sergios Gatidis, Eva-Maria Schmidt, Tanja Schönberger, Evi
Schmid, Syeda T. Towhid, Konstantinos Stellos, Peter Seizer, Andreas E. May, Florian Lang
and Meinrad Gawaz
Circ Res. 2012;111:1297-1307; originally published online August 27, 2012;
doi: 10.1161/CIRCRESAHA.112.276444
Circulation Research is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231
Copyright © 2012 American Heart Association, Inc. All rights reserved.
Print ISSN: 0009-7330. Online ISSN: 1524-4571
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://circres.ahajournals.org/content/111/10/1297
Data Supplement (unedited) at:
http://circres.ahajournals.org/content/suppl/2012/08/27/CIRCRESAHA.112.276444.DC1
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Circulation Research can be obtained via RightsLink, a service of the Copyright Clearance Center, not the
Editorial Office. Once the online version of the published article for which permission is being requested is
located, click Request Permissions in the middle column of the Web page under Services. Further information
about this process is available in the Permissions and Rights Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Circulation Research is online at:
http://circres.ahajournals.org//subscriptions/
Supplemental Materials and Methods
Borst et al.
The inflammatory chemokine CXCL16 triggers platelet activation and adhesion via CXCR6dependent PI3K/Akt signaling
RT-PCR analysis: To determine CXCR6 mRNA expression in freshly isolated human platelets and
DU145 cells RNA was isolated using TriFastTM reagent (Peqlab) and 2 µg of total RNA was reverse
transcribed to cDNA using random hexamer primers (0.1 mM, Roche), 1st strand buffer (Invitrogen),
DTT (10 mM, Invitrogen) and SuperScript II Reverse Transcriptase (200 U, Invitrogen) for 1 h at
42°C. Quantitative real-time PCR was applied utilizing the CFX96 Real-Time System® C1000
Thermal Cycler (Biorad) and the following primer pairs (5’-3` orientation): CXCR6 forward
TCTGGAACAAACTGGCAAAGC and CXCR6 reverse TGGTAATCATGCTCTGCCATC. The
transcript levels of the house-keeping gene GAPDH were determined for each sample using the
following primers (5’–3` orientation): forward ATGACAACTTTGGCATCGTG and reverse
GAATGGGAGTTGCTGTTGAAG. Amplification of the house-keeping gene GAPDH was
performed to standardize the amount of sample RNA. Transcript reliability was controlled by 1%
agarose gel electrophoresis.
Western blot analysis: Platelets or DU145 cells were resuspended in lysis buffer (50 mM Tris-HCl,
pH 7.4, 150 mM NaCl, 1% Trion-X, 0.5% Na2HPO4, 0.4% β-Mercaptoethanol) containing protease
inhibitor cocktail (Sigma-Aldrich). Subsequently a 30 minutes centrifugation with 16000 g at 4°C the
supernatant was taken for Bradford assay (Biorad) to determine the protein concentration. After
boiling the samples for 10 minutes at 95°C in Roti®-Load1 (Roth) cell lysates were separated by 10%
SDS-PAGE and blotted on nitrocellulose or PVDF membrane. Membranes were blocked for 1 hour
with 10% nonfat-milk or 5% BSA in TBS-0.1% Tween 20 (TBST). Then membranes were incubated
with primary antibody against CXCR6 (1:500; Abcam) or Thr308 or Ser473 pAkt (1:1000; Cell
Signaling) at 4°C overnight. After washing with TBST the blots were incubated with the adequate
secondary antibody conjugated with horse radish peroxidase (HRP) (1:2000; Cell Signaling) for at
least 1 hour. Antibody binding was detected with the ECL detection reagent (Amersham) and bands
were quantified with Quantity One Software (Biorad).
Immunofluorescence and confocal microscopy: Freshly isolated human platelets were allowed to
adhere to a fibrinogen surface (20 µg/ml) on a chamber slide, DU145 cells were seeded for 24 hours
before using. The adherent platelets or DU-145 cells were fixed with paraformaldehyde (2%), washed
and blocked with 2% bovine serum albumin for 30 minutes, followed by incubation with the primary
antibody against P-selectin (CD62P, 1:250, Abcam) or CXCR6 (Bonzo, 1: 250, Abcam) for 2 hours at
room temperature (RT). Chamber slides were washed and incubated with a Cy5- or Cy3-conjugated
secondary antibody (Invitrogen). The actin cytoskeleton was stained with rhodamine-phalloidin
(Invitrogen). The slides were mounted with ProLong Gold antifade reagent (Invitrogen). Confocal
microscopy was performed using a Zeiss LSM5 EXCITER Confocal Laser Scanning Microscope
(Carl Zeiss Micro Imaging, Jena, Germany) with an A-Plan 63x ocular.
Supplemental Figures and Results
Borst et al.
The inflammatory chemokine CXCL16 triggers platelet activation and adhesion via CXCR6dependent PI3K/Akt signaling
Supplemental figure ,:
Platelet aggregation in presence of 200, 400 and 800 ng/ml CXCL16.
Supplemental figure ,,:
CXCR6 expression in Akt1- or Akt2-deficient platelets.