Excess LIGHT Contributes to Placental Impairment, Increased Secretion of Vasoactive
Factors, Hypertension, and Proteinuria in Preeclampsia
Wei Wang, Nicholas F. Parchim, Takayuki Iriyama, Renna Luo, Cheng Zhao, Chen Liu,
Roxanna A. Irani, Weiru Zhang, Chen Ning, Yujin Zhang, Sean C. Blackwell, Lieping Chen,
Lijian Tao, M. John Hicks, Rodney E. Kellems and Yang Xia
Hypertension. 2014;63:595-606; originally published online December 9, 2013;
doi: 10.1161/HYPERTENSIONAHA.113.02458
Hypertension is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231
Copyright © 2013 American Heart Association, Inc. All rights reserved.
Print ISSN: 0194-911X. Online ISSN: 1524-4563
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://hyper.ahajournals.org/content/63/3/595
Data Supplement (unedited) at:
http://hyper.ahajournals.org/content/suppl/2013/12/09/HYPERTENSIONAHA.113.02458.DC1.html
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Hypertension can be obtained via RightsLink, a service of the Copyright Clearance Center, not the Editorial
Office. Once the online version of the published article for which permission is being requested is located,
click Request Permissions in the middle column of the Web page under Services. Further information about
this process is available in the Permissions and Rights Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Hypertension is online at:
http://hyper.ahajournals.org//subscriptions/
Downloaded from http://hyper.ahajournals.org/ at Houston Academy of Medicine on August 28, 2014
Preeclampsia
Excess LIGHT Contributes to Placental
Impairment, Increased Secretion of Vasoactive Factors,
Hypertension, and Proteinuria in Preeclampsia
Wei Wang, Nicholas F. Parchim, Takayuki Iriyama, Renna Luo, Cheng Zhao, Chen Liu,
Roxanna A. Irani, Weiru Zhang, Chen Ning, Yujin Zhang, Sean C. Blackwell, Lieping Chen,
Lijian Tao, M. John Hicks, Rodney E. Kellems, Yang Xia
Abstract—Preeclampsia, a prevalent hypertensive disorder of pregnancy, is believed to be secondary to uteroplacental ischemia.
Accumulating evidence indicates that hypoxia-independent mediators, including inflammatory cytokines and growth factors,
are associated with preeclampsia, but it is unclear whether these signals directly contribute to placental damage and disease
development in vivo. We report that LIGHT, a novel tumor necrosis factor superfamily member, is significantly elevated in
the circulation and placentas of preeclamptic women compared with normotensive pregnant women. Injection of LIGHT into
pregnant mice induced placental apoptosis, small fetuses, and key features of preeclampsia, hypertension and proteinuria.
Mechanistically, using neutralizing antibodies specific for LIGHT receptors, we found that LIGHT receptors herpes virus
entry mediator and lymphotoxin β receptor are required for LIGHT-induced placental impairment, small fetuses, and
preeclampsia features in pregnant mice. Accordingly, we further revealed that LIGHT functions through these 2 receptors to
induce secretion of soluble fms-like tyrosine kinase-1 and endothelin-1, 2 well-accepted pathogenic factors in preeclampsia,
and thereby plays an important role in hypertension and proteinuria in pregnant mice. Lastly, we extended our animal findings
to human studies and demonstrated that activation of LIGHT receptors resulted in increased apoptosis and elevation of soluble
fms-like tyrosine kinase-1 secretion in human placental villous explants. Overall, our human and mouse studies show that
LIGHT signaling is a previously unrecognized pathway responsible for placental apoptosis, elevated secretion of vasoactive
factors, and subsequent maternal features of preeclampsia, and reveal new therapeutic opportunities for the management of
the disease. (Hypertension. 2014;63:595-606.) Online Data Supplement
•
Key Words: endothelin-1 ◼ herpes virus entry mediator ◼ lymphotoxin-beta receptor ◼ preeclampsia ◼ receptors,
tumor necrosis factor, member 14 ◼ tumor necrosis factor ligand superfamily member 14
P
reeclampsia is a life-threatening pregnancy complication that affects ≈7% of first pregnancies and accounts
for >50 000 maternal deaths worldwide each year.1 The major
features of preeclampsia are hypertension, proteinuria, and
placenta and kidney damage.1,2 It is also a leading cause of
intrauterine growth restriction, a life-threatening condition that
puts the fetus at risk for many long-term cardiovascular disorders.3,4 Thus, preeclampsia is a leading cause of maternal and
neonatal mortality and morbidity and has acute and long-term
impact on both mothers and babies. Despite intense research
efforts, the underlying molecular mechanisms of preeclampsia are poorly understood, and the clinical management of
preeclampsia has been unsatisfactory, resulting from the lack
of presymptomatic screening, reliable diagnostic tests, and
effective therapy. Thus, the identification of specific factors
and signaling pathways involved in the pathogenesis of preeclampsia will facilitate the development of specific presymptomatic tests and effective mechanism-based preventative and
therapeutic strategies for the disease.
Disease symptoms generally abate after delivery, suggesting
that the placenta plays a central role in this disease. It is widely
accepted that hypoxia is an initial trigger to induce placenta
abnormalities, elevated secretion of vasoactive factors, and subsequent maternal features.5 This concept is strongly supported
by animal studies showing that experimentally reduced uterine
perfusion pressure in pregnant rats results in abnormal placentas, increased secretion of antiangiogenic factors, and key preeclamptic features including hypertension and kidney damage.2
However, recent studies have provided compelling evidence that
various factors other than uteroplacental hypoxia also promote
Received September 23, 2013; first decision October 7, 2013; revision accepted November 10, 2013.
From the Departments of Biochemistry and Molecular Biology (W.W., N.F.P., T.I., R.L., C.Z., C.L., R.A.I., W.Z., C.N., Y.Z., R.E.K., Y.X.) and Obstetrics
and Gynecology and Reproductive Sciences (S.C.B.), University of Texas Medical School at Houston, TX; Departments of Nephrology (W.W., W.Z.,
L.T., Y.X.) and Urology (C.N.), First Xiangya Hospital of Central South University, Changsha, Hunan, China; Graduate School of Biomedical Sciences,
University of Texas, Houston, TX (N.F.P., R.E.K., Y.X.); Department of Biological and Biomedical Sciences, Yale University, New Haven, CT (L.C.); and
Texas Children’s Hospital, Houston, TX (M.J.H.).
The online-only Data Supplement is available with this article at http://hyper.ahajournals.org/lookup/suppl/doi:10.1161/HYPERTENSIONAHA.
113.02458/-/DC1.
Correspondence to Yang Xia, Department of Biochemistry and Molecular Biology, University of Texas Medical School at Houston, TX 77030. E-mail
[email protected]
© 2013 American Heart Association, Inc.
Hypertension is available at http://hyper.ahajournals.org
DOI: 10.1161/HYPERTENSIONAHA.113.02458
Downloaded from http://hyper.ahajournals.org/ at595
Houston Academy of Medicine on August 28, 2014
596 Hypertension March 2014
placental abnormalities and disease progression; these include
inflammatory cytokines,6 growth factors,7 components of the
complement cascade,8 and autoantibodies.9 A growing body of
evidence indicates that an increased inflammatory response is
associated with preeclampsia and may contribute to disease.2,6
For example, previous in vitro studies showed that tumor necrosis
factor (TNF)-α and interferon-γ induce trophoblast apoptosis10
and that interferon-γ and interleukin-12 inhibit angiogenesis.11
Moreover, early in vitro studies indicated that TNF-α contributes to elevated secretion of the antiangiogenic factor, soluble
fms-like tyrosine kinase-1 (sFlt-1), from cultured human villous
explants.12 Elevated sFlt-1 likely leads to impaired placentation,
decreased uteroplacental perfusion, and subsequent hypertension
and kidney injury. Despite these accumulating data, the specific
hypoxia-independent mediators and mechanisms underlying placental apoptosis, enhanced secretion of vasoactive factors, and
progression of the disease have not been fully determined in vivo.
Therefore, this study aimed to identify the pathological role of
novel hypoxia-independent mediators in preeclampsia and the
underlying mechanisms of disease pathogenesis.
LIGHT, TNF superfamily member 14, is a type II transmembrane protein containing a C-terminal TNF homology domain
that folds into a β-sheet sandwich and assembles into a homotrimer.13 It is found on immature dendritic cells and activated
T-cells, and, similar to many TNF superfamily ligands, LIGHT
is not only anchored on the cell surface but is also secreted
from cells.14 In both humans and rodents, LIGHT is an immune
signaling molecule functioning via 2 specific cellular receptors, lymphotoxin β receptor (LTβR) and herpes virus entry
mediator (HVEM).15 Additionally, decoy receptor 3 (DcR3) is
a soluble form of LIGHT receptor, present in humans but not
in mice. Numerous studies indicated that DcR3 functions as
an immunesuppressor in cancer,16 inflammation,17 and transplantation.18 Importantly, LIGHT has emerged as a key factor
involved in multiple conditions, including hepatitis,19 asthma,20
atherosclerosis,21 rheumatoid arthritis,22 and Crohn disease.23
Although LIGHT and its receptors are expressed in placentas,
especially located in trophoblast cells and endothelial cells,24–26
nothing is known about the role of LIGHT in preeclampsia. In
the present study, we revealed that LIGHT is substantially elevated in the circulation and placentas of preeclamptic women,
and elevated LIGHT signaling via its receptors, LTβR and
HVEM, directly triggers placental apoptosis, secretion of vasoactive factors including sFlt-1 and endothelin-1 (ET-1), subsequent maternal symptom development, and small fetuses in
vivo. Additionally, we provide evidence that LIGHT-mediated
activation of its receptors directly induces apoptosis and secretion of sFlt-1 from cultured human placental villous explants.
These results reveal a previously unrecognized role of LIGHT
signaling in pathogenesis of preeclampsia and immediately
suggest novel therapeutic possibilities for the disease.
Materials and Methods
For additional Materials and Methods, see the online-only Data
Supplement.
Patients
Patients admitted to Memorial Hermann Hospital were identified by
the obstetrics faculty of the University of Texas Medical School at
Houston. Preeclamptic patients (n=36) were diagnosed with severe
disease on the basis of the definition set by the National High Blood
Pressure Education Program Working Group Report.27 The criteria
of inclusion, including no previous history of hypertension, have
been reported previously28–30 and include presence of blood pressure
≥160/110 mm Hg and urinary protein ≥300 mg in a 24-hour period
or a dipstick value of ≥1. Other criteria include presence of persistent
headache, visual disturbances, epigastric pain, or hemolysis, elevated
liver enzymes, and low platelets syndrome in women with blood pressure ≥140/90 mm Hg. Control pregnant women were selected on the
basis of having an uncomplicated, normotensive pregnancy with a
normal term delivery (n=34). The research protocol was approved by
the Institutional Committee for the Protection of Human Subjects.
Detailed information of human subjects is summarized in Table 1.
Introduction of Recombinant Mouse LIGHT and
Neutralizing Antibodies Against LTβR or HVEM
Into Pregnant and Nonpregnant Mice
Pregnant C57Bl/6J mice (Harlan) were anesthetized with isofluorane,
and recombinant mouse LIGHT (2 ng; R&D Systems) or the same volume of saline was introduced into pregnant mice by retro-orbital sinus
injection on embryonic day (E) 13.5 and E14.5 (LIGHT, n=10; saline,
n=8). For neutralization experiments, either LTβR mAb (100 μg; n=6)
or HVEM mAb (100 μg; n=6) was simultaneously coinjected with
LIGHT. Some of the mice (n=5) were injected with IgG from rat as
control. This dosage was adapted from Anand et al.19 Moreover, blood
pressure and proteinuria of some of the pregnant mice with saline or
LIGHT injection were further monitored on postpartum day 5 and day
10 (n=5 or 6). The same amount of LIGHT and saline was also injected
into nonpregnant mice (LIGHT, n=8; saline, n=6). Some mice injected
with LIGHT were coinjected with LTβR mAb (100 μg; n=4) or HVEM
mAb (100 μg; n=4) as with pregnant mice. IgG from rat was also used
as control (n=4). All protocols involving animal studies were reviewed
and approved by the Institutional Animal Welfare Committee of the
University of Texas Health Science Center at Houston.
Human Placental Villous Explant Collection
and Culture
Human placentas were obtained from normotensive patients who
underwent an elective term cesarean section at Memorial Hermann
Hospital in Houston. The explant culture system was conducted as
described previously.7,11 On delivery, the placentas were placed on
Table 1. Clinical Characteristic Features of Human Subjects
Clinical Characteristics
NT
n
34
Age, y
29.6±5.8
Severe
preeclampsia
36
28.7±8.6
Race, %
Black
43
48
White
27
22
Hispanic
29
28
Other
Gravity
Body mass index
Weeks gestational age
Systolic BP, mm Hg
Diastolic BP, mm Hg
Proteinuria, mg/24 h
1
2
2.3±1.4
2.6±1.5
32.8±4.7
36.6±8.6
37.2±2.8
115.7±6
72.8±5.7
ND
31.9±6.4
174.2±7*
98.8±10.7*
1809±465*
The table illustrates that blood pressure (BP) and proteinuria are elevated
in severe preeclamptic women as compared with normotensive (NT) pregnant
women. The category mean is indicated (±SEM, where applicable). ND indicates
not determined.
*P<0.001 vs NT pregnant women.
Downloaded from http://hyper.ahajournals.org/ at Houston Academy of Medicine on August 28, 2014
Wang et al LIGHT Signaling and Preeclampsia 597
ice and submerged in phenol red–free DMEM containing 10% BSA
and 1.0% antibiotics. Five to 7 chorionic villous explant fragments
were carefully dissected from the placenta and transferred to 24-well
plates at 37°C and 5% CO2. All of the initial processing occurred <30
minutes following delivery. The explants were incubated with recombinant human LIGHT (100 pg/mL; R&D Systems) and cotreated
with recombinant human DcR3 (4 μg/mL; R&D Systems) or human
IgG1-Fc (4 μg/mL; R&D Systems).13 After 24 hours, the collection
medium was siphoned and stored at −80°C, and the villous explants
were lysed or fixed overnight in 10% formalin for embedding in paraffin wax for further analysis.
Statistical Analysis
Results are expressed as mean±SEM. All data were subjected to statistical analysis using 1-way ANOVA followed by the Newman–Keuls
post hoc test or Student t test to determine the significance of differences among groups. Statistical programs were run by GraphPad
Prism 5 statistical software (GraphPad, San Diego, CA). Statistical
significance was set at P<0.05.
Results
Circulating LIGHT Levels and Expression
Profiles of Its Receptors in Placental Tissue
of Preeclamptic Patients and Normotensive
Pregnant Women
To determine the levels of LIGHT in the circulation of normotensive pregnant women and those with preeclampsia, we used
a sensitive ELISA. We found that circulating LIGHT levels
were increased 36-fold in women with preeclampsia compared
with controls (Figure 1A). Additionally, we investigated the
expression of LIGHT in human placental tissue using immunohistochemistry and detected LIGHT in trophoblast cells and
endothelial cells, 2 major functional cell types of the placenta
(Figure 1B). Quantitative RT-PCR showed that LIGHT mRNA
was significantly elevated in the placentas from preeclampsia patients (Figure S1 in the online-only Data Supplement),
and Western blotting analysis indicated that LIGHT protein is
more abundant in placentas of preeclamptic patients compared
with controls (Figure 1C). Overall, we demonstrated that the
placental mRNA and protein of LIGHT and circulating LIGHT
were elevated in preeclamptic patients.
Next, we examined the localization and expression profiles
of all 3 receptors for LIGHT. Similar to LIGHT, we found
that all of these 3 receptors were expressed in human placenta
trophoblast cells and endothelial cells (Figure 1B). The protein levels of LTβR and HVEM were significantly increased
in placental tissue from preeclampsia patients compared with
normotensive pregnant women (Figure 1C). In contrast, the
level of DcR3, a decoy receptor for LIGHT, was decreased in
placenta tissue from preeclampsia patients relative to placenta
tissue from normotensive pregnant women (Figure 1C).
LIGHT Induces Placental Tissue Apoptosis and
Reduced Fetal Weight in Pregnant Mice Signaling
Via LTβR and HVEM
To evaluate the pathogenic role of elevated LIGHT in placental apoptosis, we injected recombinant mouse LIGHT
into C57/BL6 pregnant mice on E13.5 and E14.5 to achieve
an increase in blood concentrations of LIGHT similar to the
increase seen in preeclamptic women. At the end of pregnancy, we evaluated the circulating levels of LIGHT, placental size, and analyzed the histology of the placentas in the
LIGHT-injected and saline-injected pregnant mice. We used
an ELISA to accurately measure circulating LIGHT levels in
the pregnant mice on E18.5 after injection with LIGHT. We
found that the circulating level of LIGHT was ≈150 pg/mL
in LIGHT-injected pregnant mice versus 90 pg/mL in salineinjected pregnant mice on E18.5 (Figure S2).
Next, we found that the placentas from pregnant mice injected
with LIGHT were significantly smaller (0.0832±0.0026 g)
than placentas from control pregnant mice injected with the
same volume of saline (0.1016±0.0018 g; Table 2). Placenta
H&E staining showed that LIGHT-injected pregnant mice
had significant tissue damage, including increased calcification (Figure 2A, 2B, and 2F). To determine whether increased
Figure 1. Circulating levels of LIGHT
and placental expression profiles of
LIGHT and its receptors in women
with normotensive and preeclamptic
pregnancies. A, LIGHT levels
were significantly increased in the
circulation of preeclamptic patients
(n=36) compared with normotensive
pregnant women (n=34; P<0.0001).
B, Localization of LIGHT and its
receptors in the placentas was
determined by immunohistochemistry.
LIGHT and 3 receptors—lymphotoxin
β receptor (LTβR), herpes virus entry
mediator (HVEM), and decoy receptor
3 (DcR3)—were all present in human
placental tissue trophoblast cells (green
arrows) and endothelial cells (inset box).
Scale bar, 100 μm. C, Western blotting
revealed that protein levels of LIGHT
and its transmembrane receptors, LTβR
and HVEM, were elevated in placental
tissue from preeclamptic patients (n=4)
compared with normotensive pregnant
women (n=4). However, the protein level
of DcR3 was decreased in the placental
tissue of preeclamptic patients.
Downloaded from http://hyper.ahajournals.org/ at Houston Academy of Medicine on August 28, 2014
598 Hypertension March 2014
Table 2. Mouse Placenta and Fetal Weight
Variable
Placental weight, g
Fetal weight, g
Saline
0.1016±0.0018
1.02±0.02
LIGHT
0.0832±0.0026*
0.85±0.02*
LIGHT plus control IgG
0.0823±0.0024*
0.86±0.01*
LIGHT plus anti-LTβR
0.0914±0.0024†
0.92±0.04†
LIGHT plus anti-HVEM
0.0907±0.0025†
0.96±0.06†
The table illustrates that injection of mouse recombinant LIGHT resulted in
placentas and fetuses weighing less compared with pregnant mice injected with
saline. Only pups born in litters of 6 to 8 were analyzed, and those depicted in
Figure 3 were selected from the center of the uterine horn (n=51–60, collected
and analyzed in 4 independent experiments). HVEM indicates herpes virus entry
mediator; and LTβR, lymphotoxin β receptor.
*P<0.05 vs saline treatment.
†P<0.05 vs LIGHT treatment.
placental tissue apoptosis is a potential underlying mechanism
of LIGHT-induced small placental size and placental tissue
damage, we performed terminal deoxynucleotidyl transferase-­
mediated dUTP nick-end labeling to detect apoptotic cells and
demonstrated significantly increased apoptosis in the labyrinth zone of placentas from LIGHT-injected pregnant mice
compared with placentas from control mice (Figure 2B and
2G). Additionally, increased placental apoptosis in LIGHTinjected pregnant mice was accompanied by an elevated level
of Bax, a proapoptotic marker, and a decreased level of Bcl-2,
an antiapoptotic marker (Figure 2I and 2J).
Because DcR3 is not expressed in rodents, we investigated
the importance of LTβR and HVEM for LIGHT-induced placental damage featured with apoptosis in pregnant mice by
injecting neutralizing monoclonal antibodies to each receptor
into LIGHT-injected pregnant mice. We found that blocking
either LTβR or HVEM by specific neutralizing antibodies
restored placental size to 0.0914±0.0024 g and 0.0907±0.0025
g, respectively (Table 2). In addition, cotreatment of LIGHTinjected mice with either anti-LTβR mAb or anti-HVEM mAb
significantly attenuated LIGHT-induced placental tissue damage, apoptosis, and elevation of Bax and reduction of Bcl-2
(Figure 2A, 2B, 2F, 2I, and 2J).
Fetal development is dependent on normal placental formation; thus, we were not surprised to find that infusion of
LIGHT into pregnant mice resuted in reduced fetal weight
and that coinjection of neutralizing antibodies to HVEM or
LTβR improved fetal weight (Table 2). Taken together, these
findings provide in vivo evidence that elevated LIGHT is a
previously unrecognized factor underlying placental apoptosis
and reduced fetal weight in pregnant mice by activation of its
membrane receptors.
Injection of LIGHT Into Pregnant Mice
Induces Maternal Features of Preeclampsia Via
HVEM and LTβR Signaling
To evaluate the pathogenic role of elevated LIGHT in maternal disease development, we injected recombinant mouse
LIGHT into pregnant C57/BL6 mice on E13.5 and E14.5 as
described above. Blood pressure was monitored daily, and
24-hour urine was collected for urinary protein measurement before we euthanized the mice on E18.5. We found
that systolic blood pressure increased significantly in mice
injected with LIGHT (161±3 mm Hg) relative to control mice
injected with saline (125±2 mm Hg; P<0.001; Figure 3A).
Additionally, we examined the injected mice for proteinuria,
another major clinical feature of preeclampsia. The ratio of
urinary albumin to creatinine was significantly increased in
pregnant mice injected with LIGHT (68±9.9 μg albumin per
milligram of creatinine) compared with control mice (17±2.4
μg albumin per milligram of creatinine; P<0.01; Figure 3B).
Similar to women with preeclampsia, we found that on day 5
postpartum both hypertension and proteinuria were substantially reduced (Figure S3A and S3B). Furthermore, we found
that the decrease in blood pressure and proteinuria postpartum
is associated with reduced circulating LIGHT and sFlt-1 levles (Figure S3C and S3D). Thus, these results indicate that
increased circulating LIGHT contributes to hypertension and
proteinuria in pregnant mice, and decreased preeclampsia features postpartum is likely because of decreased LIGHT and
sFlt-1 secretion from placentas.
Next, we examined whether LIGHT-induced hypertension
and proteinuria are dependent on activation of its receptors in
pregnant mice by injecting neutralizing monoclonal antibodies to each receptor into LIGHT-injected pregnant mice. The
results (Figure 3A) show that the presence of anti-LTβR mAb
or anti-HVEM mAb significantly inhibited LIGHT-induced
hypertension (161±3 mm Hg in the LIGHT-injected group
versus 138±4 mm Hg in the LIGHT plus anti-LTβR–treated
group [P<0.01] and 134±5 mm Hg in the LIGHT plus antiHVEM–treated group [P<0.01]). Additionally, we found
that elevated urinary protein levels seen in LIGHT-injected
pregnant mice (68±9.9 μg albumin per milligram of creatine)
were significantly attenuated by infusion of anti-LTβR mAb
(25±5.2 μg albumin per milligram of creatinine; P<0.05) or
anti-HVEM mAb (25±3.3 μg albumin per milligram of creatinine; P<0.05; Figure 3B). Thus, we have provided in vivo evidence that elevated LIGHT, coupled with HVEM and LTβR
signaling, leads to key preeclamptic features, including hypertension and proteinuria.
Additionally, to determine whether LIGHT, via LTβR and
HVEM signaling, contributes to renal damage, kidneys were
harvested on E18.5 from LIGHT- and saline-injected pregnant mice for histological analysis. H&E staining revealed
narrowing of Bowman capsule and loss of capillary space
in the majority of glomeruli of LIGHT-injected pregnant
mice (Figure 2C). Periodic acid-Schiff staining further demonstrated that decreased capillary lumens and narrowed
Bowman capsule are caused by the extensive endothelial
cell swelling but not the thickening of basement membrane
(Figure 2D). The kidneys of pregnant mice injected with
saline rarely showed signs of glomerular damage. Blocking
LTβR or HVEM by neutralizing antibodies prevented renal
abnormalities in mice that resulted from injection with LIGHT
(Figure 2C and 2D). Histomorphometric analysis showed that
the extent of glomerular damage was significantly greater in
LIGHT-injected pregnant mice compared with saline-injected
pregnant mice, and that anti-LTβR or anti-HVEM treatment
resulted in improved renal histology in LIGHT-injected mice
(Figure 2H). Thus, LTβR and HVEM signaling both contribute to LIGHT-induced renal damage in pregnant mice.
Downloaded from http://hyper.ahajournals.org/ at Houston Academy of Medicine on August 28, 2014
Wang et al LIGHT Signaling and Preeclampsia 599
Figure 2.
Downloaded from http://hyper.ahajournals.org/ at Houston Academy of Medicine on August 28, 2014
600 Hypertension March 2014
To validate the kidney injury, we conducted electron
microscopic studies. Electron microscopic studies revealed
that kidney tissue from pregnant mice injected with LIGHT
displayed typical endotheliosis alterations as seen in preeclampsia patients, including markedly decreased luminal
space of capillary loops accompanied by enlarged and swollen endothelial cells. Thus, the narrowed capillaries tended
to be engorged with erythrocytes. However, the basement
membranes of the capillaries were not significantly thickened.
Additionally, the overlying podocyte foot processes were partially effaced and attenuated. There was no mesangial cell or
matrix hyperplasia (Figure 2E). In contrast, the kidney tissue
from mice injected with LIGHT and anti-LTβR, or LIGHT
and anti-HVEM, showed similar ultrastructural features as the
saline control group with unremarkable glomerular structure.
Bland endothelial cells lined the capillary loops with basement membranes of appropriate thickness. The capillary loops
were open and not engorged with erythrocytes. The podocytes
showed typical foot processes without effacement and showed
no evidence of hyperplasia. The mesangial cells and matrix
were not increased (Figure 2E). Overall, we showed here that
LIGHT signaling via both HVEM and LTβR contributes to
hypertension, proteinuria, and kidney injury in pregnant mice
as seen in preeclampsia patients.
LIGHT Signaling Via LTβR and HVEM
Induces Hypertension But Not Proteinuria in
Nonpregnant Mice
To determine whether pregnancy is required for LIGHTinduced features of preeclampsia, we injected LIGHT on 2
consecutive days into nonpregnant female mice. The results
(Figure 3C) show that LIGHT induced high blood pressure
in nonpregnant mice (153±3 mm Hg) compared with salineinjected control mice (122±8 mm Hg). Moreover, to validate
blood pressure measurement by tailcuff method, we determined
intracarotid mean arterial pressure31 (Figure S4). Additionally,
we coinjected anti-LTβR mAb or anti-HVEM mAb separately
into nonpregnant mice that were injected with LIGHT. As with
pregnant mice, blocking LTβR (131±6 mm Hg) or HVEM
(134±9 mm Hg) by neutralizing antibody significantly reduced
LIGHT-induced hypertension in nonpregnant mice (Figure 3C).
However, urinary protein levels in nonpregnant mice were not
significantly affected by LIGHT injection (Figure 3D), with
or without coinjection with neutralizing antibody to LTβR or
HVEM. These findings indicate that pregnancy is required for
LIGHT-induced proteinuria. However, LIGHT-induced hypertension is independent of pregnancy.
Circulating sFlt-1 Is a Downstream Mediator
Induced by LIGHT Via HVEM and LTβR
Activation in Pregnant Mice But Not
Nonpregnant Mice
In an effort to identify intracellular mediators functioning
downstream of HVEM and LTβR that contribute to LIGHTinduced preeclampsia in pregnant mice, we measured circulating sFlt-1, a well-accepted pathogenic factor thought to play
an important role in the pathogenesis of preeclampsia.7,32 We
found that circulating sFlt-1 levels were significantly increased
in LIGHT-injected pregnant mice (57.20±10.46 ng/mL) compared with control group (29.93±2.73 ng/mL). Moreover,
we observed that elevated sFlt-1 levels in the circulation of
LIGHT-injected pregnant mice were significantly downregulated by cotreatment with anti-LTβR mAb (43.53±3.15 ng/
mL) or anti-HVEM mAb (38.57±6.68 ng/mL; Figure 3E).
In contrast, there were no significant differences in the low
levels of circulating sFlt-1 between the LIGHT-injected nonpregnant mice with or without coinjection of anti-LTβR and
anti-HVEM (Figure 3F). These findings indicate that LIGHTmediated sFlt-1 induction is pregnancy-dependent and suggest that sFlt-1 induction by LIGHT signaling via LTβR and
HVEM contributes to proteinuria as seen in pregnant mice but
not in nonpregnant mice.
Circulating ET-1 Is a Common Downstream
Mediator Induced by LIGHT Via HVEM and LTβR
Activation in Pregnant and Nonpregnant Mice
Several studies suggest that increased levels of ET-1 contribute to the hypertensive features of preeclampsia.33,34 To determine whether LIGHT-induced hypertension is associated with
elevated ET-1, pregnant and nonpregnant mice were injected
with LIGHT in the presence or absence of neutralizing antibody to LTβR or HVEM and circulating ET-1 levels determined. The results (Figure 3G) show that LIGHT injection
resulted in elevated circulating ET-1 in pregnant (2.37±0.54
pg/mL) and nonpregnant mice (1.54±0.15 pg/mL) compared with saline-injected pregnant (0.42±0.13 pg/mL) and
Figure 2 (Continued). LIGHT-induced placental damage, apoptosis, and kidney injury in pregnant mice by activation of lymphotoxin
β receptor (LTβR) and herpes virus entry mediator (HVEM). A, Placentas assessed by H&E staining indicated that LIGHT-injected
pregnant mice had damaged placentas: calcifications (green arrows) and fibrotic areas (black arrows). Coinjection of neutralizing
antibodies to LTβR or HVEM significantly attenuated placental damage. Scale bar, 100 μm. B, Placental apoptosis was assessed by
terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL) staining (×10 magnification; green, TUNEL-positive
cells; blue, DAPI nuclear stain; scale bar, 1 mm). LIGHT-injected pregnant mice had increased apoptosis in the labyrinth zones of their
placentas as compared with saline-injected animals. C to E, Kidneys assessed by H&E staining (C), periodic acid-Schiff staining (D),
and electron microscopic studies (E) indicated that LIGHT-injected pregnant mice had damaged kidneys with typical endotheliosis with
decreased capillary lumens with swollen endothelial cells. Coinjection of neutralizing antibodies to LTβR or HVEM significantly attenuated
kidney injury, Scale bar, 100 μm. F, An arbitrary histological quantification of the number of calcifications obtained per field under ×10
magnification (12 placentas for each group). G, Quantification of the TUNEL assay indicated elevation of TUNEL-positive cells in the
placenta of the mice injected with LIGHT. Coinjection of neutralizing antibodies for LTβR or HVEM reduced TUNEL-positive cells in
the placentas as compared with LIGHT-injected animals (n=10 placentas per variable, from 5 different mice in each group). H, Kidney
histological score in pregnant mice was significantly increased with LIGHT injection. Coinjection of neutralizing antibodies to LTβR
or HVEM significantly reduced the kidney histological score. I and J, Western blot analysis of mouse placentas indicated that LIGHT
injection led to increased proapoptotic protein Bax (I) and decreased antiapoptotic protein Bcl-2 (J); n=5 for each variable collected over
4 independent experiments. Coinjection of neutralizing antibodies for LTβR or HVEM significantly reduced LIGHT-induced apoptotic
features. Data are expressed as mean±SEM. *P<0.05 vs saline-injected pregnant mice; **P<0.05 vs LIGHT-injected pregnant mice.
Downloaded from http://hyper.ahajournals.org/ at Houston Academy of Medicine on August 28, 2014
Wang et al LIGHT Signaling and Preeclampsia 601
Figure 3. LIGHT signaling through lymphotoxin β receptor (LTβR) and herpes virus entry mediator (HVEM) induced hypertension
and proteinuria in the pregnant mice by increasing both soluble fms-like tyrosine kinase-1 (sFlt-1) and endothelin-1 (ET-1) secretion.
However, LIGHT only induced hypertension but not proteinuria in nonpregnant mice by increasing the secretion of ET-1 and not sFlt-1.
A and B, Pregnant mice were injected with saline or LIGHT with or without injection of neutralizing antibodies for LTβR and HVEM,
respectively. LIGHT injection resulted in hypertension (A) and proteinuria (B) in pregnant mice. Neutralizing antibodies for LTβR or HVEM
significantly reduced hypertension seen in these mice. *P<0.001 vs saline-injected mice; **P<0.01 vs LIGHT-injected mice. C and D,
LIGHT induced hypertension (C) but not proteinuria (D) in nonpregnant mice. Neutralizing antibodies for LTβR or HVEM significantly
attenuated hypertension in these mice (n=5–7). *P<0.01 vs saline-injected mice; **P<0.05 vs LIGHT-injected mice. E and F, Circulating
sFlt-1 level was significantly increased in LIGHT-injected pregnant mice (E) but not in nonpregnant mice (F). Neutralizing antibodies
for LTβR and HVEM significantly attenuated LIGHT-induced sFlt-1 production in pregnant mice (E) but had no effect on the low sFlt-1
levels in nonpregnant mice (F). G, Circulating ET-1 levels were remarkably elevated in LIGHT-injected pregnant and nonpregnant mice,
and LIGHT-mediated increase of circulating ET-1 in pregnant mice was significantly higher than that of nonpregnant mice (▲ P<0.05).
Neutralizing antibodies for LTβR or HVEM significantly attenuated LIGHT-induced ET-1 production in pregnant and nonpregnant mice.
*P<0.05 vs saline-injected pregnant mice; **P<0.05 vs LIGHT-injected pregnant mice; #P<0.05 vs saline-injected nonpregnant mice;
##P<0.05 vs LIGHT-injected nonpregnant mice. Control rat IgG had no effect on LIGHT-induced hypertension, proteinuria, or sFlt-1 and
ET-1 production.
nonpregnant mice 0.54±0.23 pg/mL). Coinjection with antiLTβR (pregnant mice, 1.11±0.13 pg/mL; nonpregnant mice,
1.04±0.19 pg/mL) or anti-HVEM (pregnant mice, 0.84±0.19
pg/mL; nonpregnant mice, 1.05±0.29 pg/mL) significantly
inhibited LIGHT-mediated induction of ET-1. These results
indicate that LIGHT-mediated induction of ET-1 is independent of pregnancy and likely an important factor responsible
for LIGHT-induced hypertension in both pregnant and nonpregnant mice.
DcR3 Inhibits LIGHT-Induced sFlt-1 Secretion and
Placental Apoptosis in Human Villous Explants
Mice and rats do not have a DcR3 gene.35 Thus, to explore the
biological function of soluble receptor DcR3 in LIGHT-induced
Downloaded from http://hyper.ahajournals.org/ at Houston Academy of Medicine on August 28, 2014
602 Hypertension March 2014
features of preeclampsia, we incubated human placental villous explants from healthy term pregnancies with recombinant human LIGHT in the presence or absence of recombinant
human DcR3. We measured the supernatant sFlt-1 levels by
ELISA and demonstrated a significant increase in sFlt-1
secretion by placenta villous explants incubated with LIGHT
(0.31±0.02 ng/mL per milligram) compared with placenta
villous explants incubated with saline (0.16±0.05 ng/mL per
milligram). However, elevated sFlt-1 secretion induced by
LIGHT was significantly inhibited by cotreatment with DcR3
(0.23±0.02 ng/mL per milligram; Figure 4B).
To determine whether placental tissue apoptosis is a downstream consequence of LIGHT treatment, we examined
human placental tissue explants for apoptotic cells by terminal
deoxynucleotidyl transferase-mediated dUTP nick-end labeling assay after incubation with LIGHT. Our results (Figure 4A
and 4C) demonstrate a significant increase in the abundance
of apoptotic cells in LIGHT-treated human placental tissue.
Additionally, we found that LIGHT treatment increased Bax
expression and reduced Bcl-2 expression in human placental
explants (Figure 4D and 4E). Furthermore, increased placenta
trophoblast cell apoptosis induced by LIGHT was significantly
attenuated by cotreatment with DcR3 (Figure 4). Altogether,
our results indicate that DcR3 can prevent LIGHT-induced
sFlt-1 secretion and placental trophoblast cell apoptosis in
human placenta explants.
Discussion
As a TNF superfamily member, LIGHT was initially discovered to be expressed in mature immune cells and involved
in multiple inflammatory diseases and autoimmune conditions.36 Although LIGHT and its receptors were subsequently
shown to be expressed in trophoblasts and endothelial cells of
human placentas25 and that an elevated inflammatory response
is a recognized feature of preeclampsia,6 nothing was known
about the role of LIGHT signaling in preeclampsia. Here,
we provide both in vivo animal studies and in vitro human
evidence that elevated LIGHT is a key contributor to hypertension, proteinuria, placental apoptosis, and small fetuses
in pregnant mice. Mechanistically, we determined that elevated LIGHT signaling via 2 membrane-anchored receptors,
HVEM and LTβR, contributes to placental apoptosis and disease development. We further revealed that LIGHT signaling
is a previously unrecognized immune cascade responsible not
only for the induction of the vasoconstrictive peptide, ET-1,
but also for the induction of the antiangiogenic factor, sFlt1, and thereby plays an important role in hypertension and
proteinuria in pregnant mice. Overall, both mouse and human
studies reported here provide strong evidence that LIGHTmediated receptor activation is an underlying mechanism for
placental damage, increased secretion of ET-1 and sFlt-1, and
subsequent maternal clinical manifestations and suggest that
these signaling pathways are novel therapeutic targets for disease management (Figure 4F).
LIGHT, as well as other TNF superfamily members, triggers
both cell death and survival signaling pathways.37,38 The functions of LIGHT are performed by the activation of 2 receptors,
HVEM and LTβR, expressed on the surface of specific target
cells. Biological activities of LIGHT–LTβR signaling include
the induction of apoptosis,13,16,39 generation and activation of
various cytokines,40 developmental organogenesis of lymph
nodes,41 and restoration of secondary lymphoid structure and
function.42,43 LIGHT signaling through HVEM is an important
costimulatory signal for activation and proliferation of T-cells.
LIGHT stimulates T-cell proliferation and induces interferon-γ
production, which can be inhibited by neutralizing antibodies
to HVEM.44 Although most studies indicate that HVEM works
principally as a prosurvival receptor for T-cells and LTβR activation contributes to LIGHT-induced apoptosis, there is also
evidence that HVEM, but not LTβR, plays a key role in LIGHTinduced tumor cell death in lymphoid malignancy.45 Although
LIGHT and its receptors are known to be expressed in the first
trimester and term placental tissues,24,25 the biological function
of LIGHT in normal pregnancy and pregnancy-related diseases
has not been extensively explored. Our study is the first to
show that LIGHT is significantly increased (>36-fold) in the
circulation of preeclamptic women compared with normotensive pregnant women. In vivo experiments using pregnant mice
and in vitro experiments using cultured human villous explants
demonstrated that LIGHT triggers placental damage characterized with placental apoptosis. These findings are strongly supported by early in vitro studies showing that LIGHT can induce
human placental trophoblast cell apoptosis.46 Mechanistically,
we demonstrated that both LTβR and HVEM are responsible
for LIGHT-induced placental cell apoptosis by increasing Bax
expression and reducing Bcl-2 levels in LIGHT-injected pregnant mice. Similarly, we provide human evidence that the soluble receptor, DcR3, inhibits LIGHT-induced sFlt-1 secretion
and apoptosis in human placental tissue explants, indicating a
potentially protective role for DcR3 in the initiation and progression of preeclampsia. Altogether, we revealed that elevated
LIGHT signaling via its receptors is responsible for placental
damage featured with placental apoptosis, an important mechanism in the pathogenesis of preeclampsia.29
We found that both LTβR and HVEM are expressed in human
placenta tissue, consistent with preliminary research reported
by Gill et al.25 To our surprise, not only was LIGHT expression
but also the levels of LTβR and HVEM were increased in preeclamptic placentas. Thus, the detrimental effects of elevated
LIGHT signaling through its receptors is further enhanced by
the increased placental expression of LIGHT and its receptors along with increased levels of LIGHT in the circulation.
Supporting this model, we used neutralizing antibodies for
LIGHT receptors to demonstrate that both HVEM and LTβR
function downstream of LIGHT and contribute to LIGHTinduced disease development, including small placentas and
fetuses in pregnant mice. It is possible that the combination
of neutralizing antibodies would have an even greater effect
compared with either one individually. Taken together, these
studies reveal a new function of LIGHT signaling via HVEM
and LTβR in the pathogenesis of preeclampsia and highlight
novel therapeutic approaches to prevent LIGHT-induced placental apoptosis and preeclampsia features.
It is a widely held view that increased secretion of vasoactive factors by the placenta into the maternal circulation is
responsible for systemic endothelial dysfunction, hypertension, and multiorgan damage.7,47 In this regard, numerous
recent studies showed that sFlt-1 is significantly elevated in
Downloaded from http://hyper.ahajournals.org/ at Houston Academy of Medicine on August 28, 2014
Wang et al LIGHT Signaling and Preeclampsia 603
Figure 4. LIGHT-mediated increase in placental
tissue apoptosis and soluble fms-like tyrosine
kinase-1 (sFlt-1) secretion from human placental
villous explants are inhibited by blocking
lymphotoxin β receptor (LTβR) or herpes virus
entry mediator (HVEM). Human placental
villous explants treated with saline or LIGHT in
the presence or absence of decoy receptor 3
(DcR3) or IgG1-Fc. A, Terminal deoxynucleotidyl
transferase-mediated dUTP nick-end labeling
(TUNEL)-stained cultured human villous explants
indicated that LIGHT increased apoptosis
(green, TUNEL-positive cells; blue, DAPI nuclear
stain; scale bars, 500 μm). B, sFlt-1 secretion
from cultured human villous explants was
significantly increased after 24-hour incubation
with LIGHT compared with saline-treated human
villous explants. DcR3 significantly reduced
sFlt-1 secretion induced by LIGHT (n=6 for
each group). C, Quantification of the increased
apoptosis is reflected in an increased apoptotic
index in the explants incubated with LIGHT.
Coincubation of the explants with LIGHT and
DcR3 partially attenuated the increase in cell
death. D and E, Western blot analysis of explant
proteins demonstrated increased Bax (D) and
decreased Bcl-2 (E), indicating a proapoptotic
state. Explants of placentas from 2 different
women were cultured, and each variable was
examined 6 times per placenta (n=12). IgG1Fc had no effect on LIGHT-induced placental
apoptosis or sFlt-1 secretion from human
placental villous explants. Data are expressed as
mean±SEM. *P<0.05 vs saline-incubated group;
**P<0.05 vs LIGHT-incubated group. F, Working
model: Circulating LIGHT level is increased
in preeclamptic patients. Elevated LIGHT
functioning via activation of 2 transmembrane
receptors, LTβR and HVEM, contributes to
placental damage featured with apoptosis,
secretion of vasoactive factors including sFlt1 and endothelin-1 (ET-1), and subsequent
disease development including hypertension and
proteinuria in pregnant mice. However, LIGHT
signaling via LTβR and HVEM only induces
hypertension, but not proteinuria, in nonpregnant mice. LIGHT-mediated sFlt-1 production is a key mechanism underlying placenta tissue
damage and preeclampsia development. Elevated ET-1 is a common factor mediating LIGHT-induced hypertension in both pregnant and
nonpregnant mice. Decoy receptor 3 can attenuate sFlt-1 secretion and placenta apoptosis stimulated by LIGHT. Thus, LIGHT signaling is
a novel pathway contributing to pathogenesis of preeclampsia and serves as a potential therapeutic target for the disease.
the circulation of women with preeclampsia compared with
women with normotensive pregnancy.32 More importantly,
the introduction of viral vectors encoding sFlt-1 into pregnant
rats resulted in proteinuria and hypertension, the key features
of preeclampsia.7 These studies highlighted the role of sFlt-1
as a placenta-derived factor contributing to preeclampsia.48
Here, we showed that LIGHT injection into pregnant mice
and LIGHT treatment of cultured human villous explants
induced sFlt-1 production. Moreover, we have shown that
LIGHT can also induce apoptosis in mouse placentas and
in cultured human villous explants. Overall, our studies provide both human and mouse evidence that elevated LIGHT
can induce placental apoptosis and sFlt-1 secretion. Of note,
elevated sFlt-1 is known to contribute to pathophysiology of
preeclampsia, including abnormal placentation, hypertension, and kidney injury.7 Thus, it is possible that circulating
LIGHT induces sFlt-1 secretion and placental apoptosis.
Elevated sFlt-1 functions as downstream mediator to further
impair placental development. As such, without interference,
LIGHT–sFlt-1–placental impairment leads to progression of
the disease and symptom development. Thus, these studies
support our working model that LIGHT is a detrimental factor
contributing to placental damage, increased placental secretion of vasoactive factors, and disease development.
Because preeclampsia is a pregnancy-specific disease, the
placenta has been considered to play an indispensable role
in the initiation and progression of the disease. To assess the
importance of placentas in LIGHT-induced hypertension and
proteinuria, we injected LIGHT into nonpregnant as well as
pregnant mice. In contrast to pregnant mice, LIGHT only
induced hypertension, but not proteinuria, in nonpregnant mice.
Mechanistically, we further revealed that LIGHT signaling via
both HVEM and LTβR led to the elevation of circulating ET-1,
but not sFlt-1, in nonpregnant mice. A possible explanation for
these results could be our finding that LIGHT is capable of
inducing ET-1 production in both pregnant and nonpregnant
mice, a feature that likely accounts for the increased blood
pressure in each case. However, LIGHT-induced proteinuria
Downloaded from http://hyper.ahajournals.org/ at Houston Academy of Medicine on August 28, 2014
604 Hypertension March 2014
was only observed in pregnant animals and was correlated
with the induction of sFlt-1 only in pregnant animals. LIGHTmediated proteinuria in pregnant mice may be attributable to
renal damage caused by increased sFlt-1 generation and secretion from placenta. In contrast to our findings with LIGHTinduced hypertension in nonpregnant mice, LaMarca and
colleagues found that TNF-α, interleukin-6, and interleukin-17
can induce high blood pressure in pregnant rats, not in nonpregnant rats.49–51 However, these cytokine effects are presumably
concentration-dependent, and it is possible that lower doses of
LIGHT may be unable to induce hypertension in nonpregnant
mice but still have effects in pregnant mice. Nevertheless, our
studies provide a molecular basis underlying LIGHT-mediated
differential effects between pregnant and nonpregnant mice:
(1) LIGHT-mediated elevation of circulating ET-1 alone is
enough to induce hypertension in nonpregnant mice; (2) the
lack of renal pathology in LIGHT-injected nonpregnant mice is
correlated with the lack of elevated sFlt-1 in these animals; and
(3) a major source of sFlt-1 during pregnancy is the placenta,
where LIGHT-mediated induction of sFlt-1 is likely to contribute to renal pathology.
In contrast to other members of the TNF receptor superfamily, the gene encoding DcR3 does not include a transmembrane
domain and results in the production of an obligate secreted
protein of 300 amino acids.35 As a soluble receptor, DcR3 is
capable of neutralizing the biological effects of 3 members of
the TNF superfamily: Fas ligand (FasL/TNFSF6),52 LIGHT
(TNFSF14),53 and TNF-like molecule 1A (TL1A/TNFSF15).54
The infusion of DcR3 ameliorates the autoimmune kidney
diseases, namely, crescentic glomerulonephritis55 and IgA56
nephropathy, in mouse models. The therapeutic potential of
DcR3 has also been demonstrated for experimental rheumatoid arthritis,38 multiple sclerosis,57 and inflammatory bowel
disease.58 The underlying mechanisms include modulation
of T-cell activation/proliferation or B-cell activation, protection against apoptosis, suppression of mononuclear leukocyte
infiltration, and diminished TNF-α, interferon-γ, and interleukin-17 expression.35 DcR3 orthologs have not been identified
in the mouse or rat genomes, indicating a crucial difference
between the human and rodent immune systems.35 Thus, we
took advantage of human placenta explants to investigate
the biological function of DcR3 in LIGHT-induced features
of preeclampsia and demonstrated that DcR3 successfully
attenuated LIGHT-induced sFlt-1 secretion and trophoblast
cell apoptosis in human placenta explants. In contrast to the
elevated expression levels of HVEM and LTβR, the expression levels of DcR3 in the placentas of preeclamptic women
are significantly reduced compared with normal individuals.
These results suggest that reduction of placental expression of
DcR3, a soluble decoy receptor, coupled with elevated placental expression of membrane-anchored receptors, HVEM and
LTβR, are additional mechanisms to amplify elevated LIGHTinduced placental damage and sFlt-1 secretion. Thus, DcR3,
as an endogenous soluble receptor, is likely a safe and effective therapy to prevent LIGHT-induced impaired angiogenesis
and placenta tissue damage and, therefore, has potential as a
treatment for human preeclampsia.
Because of its strong proinflammatory properties and
immunestimulatory activities, excessive LIGHT is associated
with several pathological conditions.36 In particular, LIGHT contributes to pathophysiology associated with several autoimmune
diseases, including rheumatoid arthritis, Crohn disease, chronic
arthritis, and psoriatic arthritis.37 The use of soluble DcR3 receptor or neutralizing antibodies for its membrane receptors has
become important therapeutic strategies for the treatment of
these autoimmune disorders in multiple animal models.38 preeclampsia may also benefit from this therapeutic approach.
Perspectives
The work reported here is the first to show that elevated
LIGHT, coupled with enhanced LTβR and HVEM receptor
activation, promotes placental damage and triggers release
of potent vasoactive factors (sFlt-1 and ET-1) in both human
and murine pregnancy, as well as suggest that LIGHT signaling is likely an important mediator of pathogenesis associated with preeclampsia. Therefore, the use of HVEM/LTβR
neutralizing antibodies, or the soluble form of LIGHT receptor, DcR3, to blunt the effects of elevated LIGHT may represent a novel treatment for preeclampsia. The current findings
significantly advanced our understanding of pathogenesis of
preeclampsia by revealing the pathogenic role of LIGHT signaling in preeclampsia and also provided a strong foundation
for future translational studies to determine whether circulating LIGHT is elevated before symptoms and in this way
serves as a presymptomatic biomarker and therapeutic target
for preeclampsia.
Sources of Funding
This work was supported by National Institutes of Health grants
RC4HD067977 and HD34130 (to Y.X and R.E.K.), by American
Heart Association grant 10GRNT3760081 (to Y.X.), and by China
National Science Foundation 81228004 (to Y.X.).
Disclosures
None.
References
1.Roberts JM, Cooper DW. Pathogenesis and genetics of preeclampsia.
Lancet. 2001;357:53–56.
2.Granger JP, Alexander BT, Llinas MT, Bennett WA, Khalil RA.
Pathophysiology of preeclampsia: linking placental ischemia/hypoxia
with microvascular dysfunction. Microcirculation. 2002;9:147–160.
3. Godfrey KM, Barker DJ. Fetal nutrition and adult disease. Am J Clin Nutr.
2000;71(5 suppl):1344S–1352S.
4. Barker DJ. In utero programming of chronic disease. Clin Sci (Lond).
1998;95:115–128.
5. Saito S, Sakai M. Th1/Th2 balance in preeclampsia. J Reprod Immunol.
2003;59:161–173.
6. Lamarca B. The role of immune activation in contributing to vascular dysfunction and the pathophysiology of hypertension during preeclampsia.
Minerva Ginecol. 2010;62:105–120.
7. Maynard SE, Min JY, Merchan J, Lim KH, Li J, Mondal S, Libermann
TA, Morgan JP, Sellke FW, Stillman IE, Epstein FH, Sukhatme VP,
Karumanchi SA. Excess placental soluble fms-like tyrosine kinase 1
(sFlt1) may contribute to endothelial dysfunction, hypertension, and proteinuria in preeclampsia. J Clin Invest. 2003;111:649–658.
8. Girardi G, Yarilin D, Thurman JM, Holers VM, Salmon JE. Complement
activation induces dysregulation of angiogenic factors and causes fetal
rejection and growth restriction. J Exp Med. 2006;203:2165–2175.
9. Zhou CC, Ahmad S, Mi T, Abbasi S, Xia L, Day MC, Ramin SM, Ahmed
A, Kellems RE, Xia Y. Autoantibody from women with preeclampsia
induces soluble Fms-like tyrosine kinase-1 production via angiotensin
type 1 receptor and calcineurin/nuclear factor of activated T-cells signaling. Hypertension. 2008;51:1010–1019.
Downloaded from http://hyper.ahajournals.org/ at Houston Academy of Medicine on August 28, 2014
Wang et al LIGHT Signaling and Preeclampsia 605
10.Yui J, Garcia-Lloret M, Wegmann TG, Guilbert LJ. Cytotoxicity of
tumour necrosis factor-alpha and gamma-interferon against primary
human placental trophoblasts. Placenta. 1994;15:819–835.
11. Hayakawa S, Nagai N, Kanaeda T, Karasaki-Suzuki M, Ishii M, Chishima F,
Satoh K. Interleukin-12 augments cytolytic activity of peripheral and decidual lymphocytes against choriocarcinoma cell lines and primary culture
human placental trophoblasts. Am J Reprod Immunol. 1999;41:320–329.
12.Ahmad S, Ahmed A. Elevated placental soluble vascular endothelial
growth factor receptor-1 inhibits angiogenesis in preeclampsia. Circ Res.
2004;95:884–891.
13.Rooney IA, Butrovich KD, Glass AA, Borboroglu S, Benedict CA,
Whitbeck JC, Cohen GH, Eisenberg RJ, Ware CF. The lymphotoxin-beta
receptor is necessary and sufficient for LIGHT-mediated apoptosis of
tumor cells. J Biol Chem. 2000;275:14307–14315.
14.Granger SW, Butrovich KD, Houshmand P, Edwards WR, Ware CF.
Genomic characterization of LIGHT reveals linkage to an immune
response locus on chromosome 19p13.3 and distinct isoforms generated
by alternate splicing or proteolysis. J Immunol. 2001;167:5122–5128.
15. Zhai Y, Guo R, Hsu TL, et al. LIGHT, a novel ligand for lymphotoxin beta
receptor and TR2/HVEM induces apoptosis and suppresses in vivo tumor
formation via gene transfer. J Clin Invest. 1998;102:1142–1151.
16. Chen C, Zhang C, Zhuang G, Luo H, Su J, Yin P, Wang J. Decoy receptor
3 overexpression and immunologic tolerance in hepatocellular carcinoma
(HCC) development. Cancer Invest. 2008;26:965–974.
17. Mueller AM, Pedré X, Killian S, David M, Steinbrecher A. The Decoy
Receptor 3 (DcR3, TNFRSF6B) suppresses Th17 immune responses
and is abundant in human cerebrospinal fluid. J Neuroimmunol.
2009;209:57–64.
18. Li Q, Ge C, Liu R, Zhang K, Wu G, Huo W. Administration of dendritic
cells dual expressing DcR3 and GAD65 mediates the suppression of T
cells and induces long-term acceptance of pancreatic-islet transplantation.
Vaccine. 2010;28:8300–8305.
19. Anand S, Wang P, Yoshimura K, Choi IH, Hilliard A, Chen YH, Wang
CR, Schulick R, Flies AS, Flies DB, Zhu G, Xu Y, Pardoll DM, Chen L,
Tamada K. Essential role of TNF family molecule LIGHT as a cytokine in
the pathogenesis of hepatitis. J Clin Invest. 2006;116:1045–1051.
20. Wynn TA, Ramalingam TR. Shedding LIGHT on severe asthma. Nat Med.
2011;17:547–548.
21. Sandberg WJ, Halvorsen B, Yndestad A, Smith C, Otterdal K, Brosstad
FR, Frøland SS, Olofsson PS, Damås JK, Gullestad L, Hansson GK, Oie
E, Aukrust P. Inflammatory interaction between LIGHT and proteinaseactivated receptor-2 in endothelial cells: potential role in atherogenesis.
Circ Res. 2009;104:60–68.
22.Pierer M, Brentano F, Rethage J, Wagner U, Hantzschel H, Gay RE,
Gay S, Kyburz D. The TNF superfamily member LIGHT contributes
to survival and activation of synovial fibroblasts in rheumatoid arthritis.
Rheumatology (Oxford). 2007;46:1063–1070.
23. Wang J, Anders RA, Wang Y, Turner JR, Abraham C, Pfeffer K, Fu YX.
The critical role of LIGHT in promoting intestinal inflammation and
Crohn’s disease. J Immunol. 2005;174:8173–8182.
24.Gill RM, Coleman NM, Hunt JS. Differential cellular expression of
LIGHT and its receptors in early gestation human placentas. J Reprod
Immunol. 2007;74:1–6.
25. Gill RM, Ni J, Hunt JS. Differential expression of LIGHT and its receptors in human placental villi and amniochorion membranes. Am J Pathol.
2002;161:2011–2017.
26. Phillips TA, Ni J, Hunt JS. Death-inducing tumour necrosis factor (TNF)
superfamily ligands and receptors are transcribed in human placentae,
cytotrophoblasts, placental macrophages and placental cell lines. Placenta.
2001;22:663–672.
27.Roberts JM, Pearson G, Cutler J, Lindheimer M; NHLBI Working
Group on Research on Hypertension During Pregnancy. Summary of the
NHLBI Working Group on Research on Hypertension During Pregnancy.
Hypertension. 2003;41:437–445.
28. Zhou CC, Zhang Y, Irani RA, Zhang H, Mi T, Popek EJ, Hicks MJ, Ramin
SM, Kellems RE, Xia Y. Angiotensin receptor agonistic autoantibodies
induce preeclampsia in pregnant mice. Nat Med. 2008;14:855–862.
29. Irani RA, Zhang Y, Blackwell SC, Zhou CC, Ramin SM, Kellems RE,
Xia Y. The detrimental role of angiotensin receptor agonistic autoantibodies in intrauterine growth restriction seen in preeclampsia. J Exp Med.
2009;206:2809–2822.
30.Siddiqui AH, Irani RA, Blackwell SC, Ramin SM, Kellems RE,
Xia Y. Angiotensin receptor agonistic autoantibody is highly prevalent in preeclampsia: correlation with disease severity. Hypertension.
2010;55:386–393.
31.Zhang W, Wang W, Yu H, Zhang Y, Dai Y, Ning C, Tao L, Sun H,
Kellems RE, Blackburn MR, Xia Y. Interleukin 6 underlies angiotensin II-induced hypertension and chronic renal damage. Hypertension.
2012;59:136–144.
32.Levine RJ, Maynard SE, Qian C, Lim KH, England LJ, Yu KF,
Schisterman EF, Thadhani R, Sachs BP, Epstein FH, Sibai BM, Sukhatme
VP, Karumanchi SA. Circulating angiogenic factors and the risk of preeclampsia. N Engl J Med. 2004;350:672–683.
33. Jain A. Endothelin-1: a key pathological factor in preeclampsia? Reprod
Biomed Online. 2012;25:443–449.
34. George EM, Granger JP. Endothelin: key mediator of hypertension in preeclampsia. Am J Hypertens. 2011;24:964–969.
35. Lin WW, Hsieh SL. Decoy receptor 3: a pleiotropic immunomodulator
and biomarker for inflammatory diseases, autoimmune diseases and cancer. Biochem Pharmacol. 2011;81:838–847.
36. Mauri DN, Ebner R, Montgomery RI, Kochel KD, Cheung TC, Yu GL,
Ruben S, Murphy M, Eisenberg RJ, Cohen GH, Spear PG, Ware CF.
LIGHT, a new member of the TNF superfamily, and lymphotoxin alpha
are ligands for herpesvirus entry mediator. Immunity. 1998;8:21–30.
37.Ware CF. Network communications: lymphotoxins, LIGHT, and TNF.
Annu Rev Immunol. 2005;23:787–819.
38. Tamada K, Shimozaki K, Chapoval AI, Zhai Y, Su J, Chen SF, Hsieh SL,
Nagata S, Ni J, Chen L. LIGHT, a TNF-like molecule, costimulates T cell
proliferation and is required for dendritic cell-mediated allogeneic T cell
response. J Immunol. 2000;164:4105–4110.
39. Dejardin E, Droin NM, Delhase M, Haas E, Cao Y, Makris C, Li ZW,
Karin M, Ware CF, Green DR. The lymphotoxin-beta receptor induces
different patterns of gene expression via two NF-kappaB pathways.
Immunity. 2002;17:525–535.
40. Degli-Esposti MA, Davis-Smith T, Din WS, Smolak PJ, Goodwin RG,
Smith CA. Activation of the lymphotoxin beta receptor by cross-linking
induces chemokine production and growth arrest in A375 melanoma cells.
J Immunol. 1997;158:1756–1762.
41. Scheu S, Alferink J, Pötzel T, Barchet W, Kalinke U, Pfeffer K. Targeted
disruption of LIGHT causes defects in costimulatory T cell activation and
reveals cooperation with lymphotoxin beta in mesenteric lymph node genesis. J Exp Med. 2002;195:1613–1624.
42. Gommerman JL, Browning JL. Lymphotoxin/light, lymphoid microenvironments and autoimmune disease. Nat Rev Immunol. 2003;3:642–655.
43. Wang J, Foster A, Chin R, Yu P, Sun Y, Wang Y, Pfeffer K, Fu YX. The
complementation of lymphotoxin deficiency with LIGHT, a newly discovered TNF family member, for the restoration of secondary lymphoid
structure and function. Eur J Immunol. 2002;32:1969–1979.
44.Harrop JA, Reddy M, Dede K, Brigham-Burke M, Lyn S, Tan KB,
Silverman C, Eichman C, DiPrinzio R, Spampanato J, Porter T, Holmes
S, Young PR, Truneh A. Antibodies to TR2 (herpesvirus entry mediator),
a new member of the TNF receptor superfamily, block T cell proliferation,
expression of activation markers, and production of cytokines. J Immunol.
1998;161:1786–1794.
45. Pasero C, Barbarat B, Just-Landi S, Bernard A, Aurran-Schleinitz T, Rey
J, Eldering E, Truneh A, Costello RT, Olive D. A role for HVEM, but
not lymphotoxin-beta receptor, in LIGHT-induced tumor cell death and
chemokine production. Eur J Immunol. 2009;39:2502–2514.
46.Gill RM, Hunt JS. Soluble receptor (DcR3) and cellular inhibitor of
apoptosis-2 (cIAP-2) protect human cytotrophoblast cells against LIGHTmediated apoptosis. Am J Pathol. 2004;165:309–317.
47. Venkatesha S, Toporsian M, Lam C, et al. Soluble endoglin contributes to
the pathogenesis of preeclampsia. Nat Med. 2006;12:642–649.
48. Venkatesha S, Toporsian M, Lam C, et al. Soluble endoglin contributes to
the pathogenesis of preeclampsia. Nat Med. 2006;12:642–649.
49. LaMarca BB, Cockrell K, Sullivan E, Bennett W, Granger JP. Role of
endothelin in mediating tumor necrosis factor-induced hypertension in
pregnant rats. Hypertension. 2005;46:82–86.
50. Gadonski G, LaMarca BB, Sullivan E, Bennett W, Chandler D, Granger
JP. Hypertension produced by reductions in uterine perfusion in the pregnant rat: role of interleukin 6. Hypertension. 2006;48:711–716.
51. Dhillion P, Wallace K, Herse F, Scott J, Wallukat G, Heath J, Mosely J,
Martin JN Jr, Dechend R, LaMarca B. IL-17-mediated oxidative stress is
an important stimulator of AT1-AA and hypertension during pregnancy.
Am J Physiol Regul Integr Comp Physiol. 2012;303:R353–R358.
52. Pitti RM, Marsters SA, Lawrence DA, et al. Genomic amplification of a decoy
receptor for Fas ligand in lung and colon cancer. Nature. 1998;396:699–703.
53. Yu KY, Kwon B, Ni J, Zhai Y, Ebner R, Kwon BS. A newly identified
member of tumor necrosis factor receptor superfamily (TR6) suppresses
LIGHT-mediated apoptosis. J Biol Chem. 1999;274:13733–13736.
Downloaded from http://hyper.ahajournals.org/ at Houston Academy of Medicine on August 28, 2014
606 Hypertension March 2014
54. Migone TS, Zhang J, Luo X, et al. TL1A is a TNF-like ligand for DR3 and TR6/
DcR3 and functions as a T cell costimulator. Immunity. 2002;16:479–492.
55. Ka SM, Sytwu HK, Chang DM, Hsieh SL, Tsai PY, Chen A. Decoy receptor 3 ameliorates an autoimmune crescentic glomerulonephritis model in
mice. J Am Soc Nephrol. 2007;18:2473–2485.
56. Ka SM, Hsieh TT, Lin SH, Yang SS, Wu CC, Sytwu HK, Chen A. Decoy
receptor 3 inhibits renal mononuclear leukocyte infiltration and apoptosis
and prevents progression of IgA nephropathy in mice. Am J Physiol Renal
Physiol. 2011;301:F1218–F1230.
57. Chen SJ, Wang YL, Kao JH, Wu SF, Lo WT, Wu CC, Tao PL, Wang CC,
Chang DM, Sytwu HK. Decoy receptor 3 ameliorates experimental autoimmune encephalomyelitis by directly counteracting local inflammation
and downregulating Th17 cells. Mol Immunol. 2009;47:567–574.
58. Bamias G, Kaltsa G, Siakavellas SI, Gizis M, Margantinis G, Zampeli
E, Vafiadis-Zoumboulis I, Michopoulos S, Daikos GL, Ladas SD.
Differential expression of the TL1A/DcR3 system of TNF/TNFR-like
proteins in large vs. small intestinal Crohn’s disease. Dig Liver Dis.
2012;44:30–36.
Novelty and Significance
What Is New?
• The tumor necrosis factor family member LIGHT is substantially elevated in
the circulation and placentas of women with preeclampsia.
activation of its receptors, lymphotoxin β receptor
(LTβR) and herpes virus entry mediator (HVEM), induces apoptosis and
increases soluble fms-like tyrosine kinase-1 (sFlt-1) secretion by cultured human placental explants.
• The introduction of LIGHT in pregnant mice stimulates placental apoptosis and increases production of sFlt-1 and endothelin-1 (ET-1) and
is accompanied with hypertension and proteinuria via activation of its
receptors.
• LIGHT-mediated
What Is Relevant?
• Our results reveal a previously unrecognized role of LIGHT signaling in
the pathogenesis of preeclampsia and reveal potential therapeutic opportunities.
Summary
We report that LIGHT, a novel tumor necrosis factor superfamily
member, is significantly elevated in the circulation and placentas of
preeclamptic women compared with normotensive pregnant women. A pathological role for LIGHT in preeclampsia is indicated by
the results of experiments showing that the infusion of LIGHT into
pregnant mice directly induced placental apoptosis, small fetuses,
and key features of preeclampsia, hypertension and proteinuria.
Mechanistically, using neutralizing antibodies specific for LIGHT
receptors, we found that LIGHT transmembrane receptors, HVEM
and LTβR, are required for LIGHT-induced placental impairment,
small fetuses, and preeclampsia features in pregnant mice. Accordingly, we further revealed that LIGHT functions through these
2 receptors to induce secretion of sFlt-1 and ET-1, 2 well-accepted
pathogenic factors in preeclampsia, and thereby plays an important
role in hypertension and proteinuria in pregnant mice. Lastly, we
extended our animal findings to human studies and demonstrated
that activation of LIGHT receptors resulted in increased apoptosis
and elevation of sFlt-1 secretion in human placental villous explants. Overall, both human and mouse studies revealed a novel
role of LIGHT in pathophysiology of preeclampsia and potential
therapeutic targets.
Downloaded from http://hyper.ahajournals.org/ at Houston Academy of Medicine on August 28, 2014
ONLINE SUPPLEMENT
For
Excess LIGHT contributes to placental impairment, secretion of vasoactive
factors, hypertension and proteinuria in preeclampsia
by
Wei Wang1&2, Nicholas Parchim1&4, Takayuki Iriyama1, Renna Luo1, Cheng Zhao1, Chen Liu1,
Roxanna A. Irani1, Weiru Zhang1&2, Chen Ning1&5, Yujin Zhang1, Sean C. Blackwell3, Lieping Chen6,
Lijian Tao2, John Hicks7, Rodney E. Kellems1&4 and Yang Xia1,2&4
Departments of 1Biochemistry and Molecular Biology and 3Obstetrics & Gynecology and
Reproductive Sciences, The University of Texas Medical School at Houston, Houston, TX, 77030;
Departments of 2Nephrology & 5Urology, the First Xiangya Hospital of Central South University,
Changsha, Hunan 410013, P.R.China; 4Graduate School of Biomedical Sciences, The University of
Texas, Houston, USA; 6Department of Biological and Biomedical Sciences, Yale University; 7Texas
Children’s Hospital, Houston, TX, USA
Running title: LIGHT Signaling and Preeclampsia
*Correspondence: Yang Xia, Department of Biochemistry & Molecular Biology, University of Texas
Medical School at Houston. Email: [email protected]
MATERIALS AND METHODS
Generation and purification of neutralizing antibodies specific for LTβR and HVEM
Hybridoma cells that specifically secrete rat anti–mouse HVEM mAb or rat anti–mouse LTβR
mAb were originally prepared and characterized by Dr. Lieping Chen (Yale University). These
antibodies effectively blunt activation of these two receptors1, 2. Hybridoma cells were grown in
DMEM/F12 supplemented with 10% low-IgG FBS (Life Technologies Inc.) and 25 mM HEPES.
Supernatant was harvested and mAb purified using G–Sepharose column chromatography (GE
Healthcare)1-3. Rat IgG Abs (Santa Cruz.) were used as controls.
Blood pressure measurement and quantification of proteinuria
The systolic blood pressure was non-invasively measured by determining the tail blood volume with
a volume pressure recording sensor and an occlusion tail-cuff (CODA System, Kent Scientific). This
method shows good agreement with radiotelemetry measurements of blood pressure5. Blood
1
pressure was measured at the same time daily (±1 hour) while the mice were kept warm using a
warming pad. Twenty-four hour urine was collected for analysis using metabolic cages (Nalgene).
Mice were trained in metabolic cages for 2 days prior to urine collection. All of the mice were
euthanized on GD18.5 before delivery when their serum and organs, including placentas and kidneys
were collected. We quantified urinary albumin by ELISA (Exocell) and measured urinary creatinine
by a picric acid colorimetric assay kit (Exocell). We used the ratio of urinary albumin to urinary
creatinine as an index of urinary protein6-10. All of the animal protocols were reviewed and
approved by the institutional animal welfare committee at the University of Texas at Houston Health
Science Center.
Mean Arterial Pressure Measurement
Mean arterial pressure (MAP) was monitored by cannulating the right carotid artery with a mouse
jugular catheter connected to a pressure transducer and an amplifier unit. The amplifier was linked to
a data acquisition module and MAP was recorded on a personal computer by Chart 5 Software (AD
Instruments Inc.)
Hematoxylin and eosin (H&E) staining and quantification in kidneys and placenta.
Kidneys and placentas were harvested from the mice on E18.5, fixed in 4% formaldehyde,
dehydrated, and embedded in paraffin. Sections of 4 μm were cut, stained with H&E using standard
techniques and analyzed by light microscopy11,12. The extent of renal damage was assessed by
quantifying the glomeruli that showed characteristic features of damage in PE: decreased Bowman’s
space and occlusion of capillary loop spaces. To examine those features, the glomeruli were counted
in 6–9 fields of randomized and blinded slides (×10 magnification), with each field having at least
16–22
glomeruli. The glomeruli in each field were given a score based on the amount of capillary space
evident within the Bowman’s capsule. A highest score of 5 was accorded to glomeruli with a normal
amount of capillary space within Bowman’s capsule. A score of 1 was assigned to the glomeruli that
showed complete loss of capillary space and an intermediate score of 3 was assigned to the glomeruli
that displayed reduced, but not completely obliterated, capillary space. The scores for each field were
divided by the number of glomeruli to get an average score per glomerulus for each field. Similarly
placental histological quantification was carried by quantifying the number of calcifications/field
under ×10 magnification. Placental sections were examined under the microscope and the number of
calcifications was counted in each field and then plotted as number of calcifications recorded per
field.
Transmission electron microscopy (TEM)
Upon sacrifice, kidneys were immediately removed. Tissue samples were cut into 1mm3 cubes and
subsequently fixed in 3% glutaraldehyde overnight. The samples were then rinsed and exposed to
1% osmium tetroxide, dehydrated and embedded in an araldite-epon mixture. Semi-thin tissue
sections were prepared (0.6mm) and stained with uranyl acetate and lead citrate. The prepared
samples were examined with a JEOL 1210 transmission electron microscope (JEOL Corporation)6.
Immunostaining in mouse placentas and kidneys and human placentas
Mouse placentas and kidneys were harvested on GD18.5 and human placentas were isolated
2
immediately after delivery. Tissues were fixed in 4% formaldehyde, dehydrated, and embedded in
paraffin. Sections of 4μm were cut and stained with antibody against LIGHT (1:50, Santa Cruz),
LTβR (1:100, Santa Cruz), HVEM (1:100, Santa Cruz), DcR3 (1:200, Abcam) in a humidified
chamber at 4 °C overnight. Following the primary antibody incubation, anti-mouse IgG HRP
detection kit (cat. no. 551011, BD Pharmingen, San Diego, CA), anti-rabbit ABC Staining System
(cat. no. sc-2018, Santa Cruz) or anti-goat ABC Staining System (Santa Cruz) were used to detect
the primary antibody. The immunohistochemical staining (brown) was quantified by Image-Pro Plus
software (Media Cybernetics, Bethesda, MD).
RT-PCR to measure LIGHT mRNA in human placentas
RNA was extracted using total RNA isolation reagent (Invitrogen,Carls-View, CA) from the
placentas of normal pregnant women and preeclamptic women. Genomic DNA contamination was
eliminated by DNase treatment with RNeasy Micro Kit (Qiagen GmbH, Hidden, Germany). PCR
was performed on an ABI Prism 7700 sequence Detector (Applied Biosystems). The condition is:
95℃10min; 95℃ 30s, 60℃30s, 72℃ 1min, 40 cycles; 95℃ 1min, 60℃30s, 95℃30s. For each gene,
the fold changes were calculated as difference in placentas gene expression. P<0.05 is considered
significant. LIGHT human forward:5'CAAGAGCGAAGGTCTCACGAG3'; LIGHT huamn
reverse:5'TCACACCATGAAAGCCCCGAA3'.
β-actin
human
forward:
5'AAATCTGGCACCACACCTTC3'; β−actin human reverse:5'GGGGTGTTGAAGGTCTCAAA3'.
Western blot analysis
Protein in human and mice placentas was analyzed by western blotting analysis. Frozen tissues
were used for protein extraction. Proteins were run on 8% SDS-PAGE gels and transferred the gels
to a polyvinylidene fluoride membrane. Membranes were incubated with commercially available
antibody to LIGHT (1:50, Santa Cruz, Catalog#:SC-7767), LTβR (1:100, Santa Cruz, Catalog#:
SC-8376), HVEM (1:100, Santa Cruz, Catalog#: SC-7766), DcR3 (1:1000, Santa Cruz: SC-23464),
Bax (1:100, Santa Cruz) and Bcl-2 (1:1000, Cell Signaling) as the primary antibody.
Enzyme-linked immunosorbent assays for LIGHT, sFlt-1 and ET-1
The concentrations of LIGHT in mouse plasma and human plasma were determined using
commercial ELISA kits (Uscn Life Science Inc; cat. # SEA827Mu for mouse and SEA827Hu for
human). Sensitivity for each kit is approximately 6.3 and 11.5 pg/mL, respectively. The intra- and
inter-assay variabilities are less than 10%. The concentrations of sFlt-1 in mouse plasma and
human placenta explants supernatant were determined using commercial ELISA kits (R&D Systems;
cat. # MVR100 for mouse and DVR100B for human)6-8. Sensitivity for each kit is approximately 15
pg/mL and the intra- and inter-assay variability is less than 10%. To measure circulating ET-1 levels,
plasma was collected from pregnant and non-pregnant mice. Considering high level of other proteins
in plasma, sample extraction was required by using Solid Phase Extraction (SPE) column (Octadecyl
C18; 500 mg/6 mL; Honeywell Burdick & Jackson) before ELISA measurement. 200μl plasma from
each mouse was used for sample extraction. After evaporating extracted samples to dryness using a
centrifugal concentrator under vacuum, we reconstituted samples with 200 μL of the assay buffer and
measured ET-1immediately by commercial ELISA Kit (Enzo Life Sciences, cat. # ADI-900-020A).
Sensitivity is approximately 0.4 pg/mL.
3
TUNEL assay and index. Human placental tissue collected from the experiments described above
were permanently fixed onto a glass slide, deparaffinized, and rehydrated through an alcohol
gradient by standard techniques. Tissues were permeabilized using cold, fresh 0.1% Triton X-100 in
0.1% sodium citrate and stained by TUNEL using a commercial kit (Roche) according to the
manufacturer’s protocol. TUNEL positive cells were identified by cellular morphology (cell
shrinkage, membrane blebbing, and nuclear fragmentation) and positive green staining under
515–565 nm of fluorescent light. Negative control sections were treated in a similar fashion but
lacking the terminal deoxynucleotidyl transferase enzyme. To identify healthy cells with normal
nuclear morphology, after TUNEL staining was complete, a DAPI nuclear stain was added and
visualized as blue when excited at 360 nm of fluorescent light (Vector Laboratories). For each
TUNEL and DAPI-stained cell or tissue section, green apoptotic and blue healthy nuclei were
blindly counted in 10 random microscopic fields. Quantification of the apoptotic index (the number
of apoptotic nuclei per total nuclei × 100) was assessed blindly in 10 random microscopic fields per
sample using Image Pro Plus 6.3 software (Media Cybernetics).
References
1.
Tamada K, Shimozaki K, Chapoval AI, Zhai Y, Su J, Chen SF, Hsieh SL, Nagata S, Ni J,
Chen L. Light, a tnf-like molecule, costimulates t cell proliferation and is required for
dendritic cell-mediated allogeneic t cell response. J Immunol. 2000;164:4105-4110.
2.
Tamada K, Shimozaki K, Chapoval AI, Zhu G, Sica G, Flies D, Boone T, Hsu H, Fu YX,
Nagata S, Ni J, Chen L. Modulation of t-cell-mediated immunity in tumor and
graft-versus-host disease models through the light co-stimulatory pathway. Nat Med.
2000;6:283-289.
3.
Wilcox RA, Flies DB, Zhu G, Johnson AJ, Tamada K, Chapoval AI, Strome SE, Pease LR,
Chen L. Provision of antigen and cd137 signaling breaks immunological ignorance,
promoting regression of poorly immunogenic tumors. J Clin Invest. 2002;109:651-659.
4.
Anand S, Wang P, Yoshimura K, Choi IH, Hilliard A, Chen YH, Wang CR, Schulick R, Flies
AS, Flies DB, Zhu G, Xu Y, Pardoll DM, Chen L, Tamada K. Essential role of tnf family
molecule light as a cytokine in the pathogenesis of hepatitis. J Clin Invest.
2006;116:1045-1051.
5.
Feng M, Whitesall S, Zhang Y, Beibel M, D'Alecy L, DiPetrillo K. Validation of
volume-pressure recording tail-cuff blood pressure measurements. Am J Hypertens. 2008;
21:1288-1291.
6.
Zhou CC, Zhang Y, Irani RA, Zhang H, Mi T, Popek EJ, Hicks MJ, Ramin SM, Kellems RE,
Xia Y. Angiotensin receptor agonistic autoantibodies induce pre-eclampsia in pregnant mice.
Nat Med. 2008;14:855-862.
7.
Zhou CC, Irani RA, Zhang Y, Blackwell SC, Mi T, Wen J, Shelat H, Geng YJ, Ramin SM,
Kellems RE, Xia Y. Angiotensin receptor agonistic autoantibody-mediated tumor necrosis
factor-alpha induction contributes to increased soluble endoglin production in preeclampsia.
Circulation. 2011;121:436-444.
8.
Zhou CC, Irani RA, Dai Y, Blackwell SC, Hicks MJ, Ramin SM, Kellems RE, Xia Y.
Autoantibody-mediated il-6-dependent endothelin-1 elevation underlies pathogenesis in a
mouse model of preeclampsia. J Immunol. 2011;186:6024-6034.
9.
Zhang Y, Dai Y, Wen J, Zhang W, Grenz A, Sun H, Tao L, Lu G, Alexander DC, Milburn MV,
4
10.
11.
12.
13.
Carter-Dawson L, Lewis DE, Zhang W, Eltzschig HK, Kellems RE, Blackburn MR, Juneja
HS, Xia Y. Detrimental effects of adenosine signaling in sickle cell disease. Nat Med.
2011;17:79-86.
Maynard SE, Min JY, Merchan J, Lim KH, Li J, Mondal S, Libermann TA, Morgan JP, Sellke
FW, Stillman IE, Epstein FH, Sukhatme VP, Karumanchi SA. Excess placental soluble
fms-like tyrosine kinase 1 (sflt1) may contribute to endothelial dysfunction, hypertension,
and proteinuria in preeclampsia. J Clin Invest. 2003;111:649-658.
Irani RA, Zhang Y, Zhou CC, Blackwell SC, Hicks MJ, Ramin SM, Kellems RE, Xia Y.
Autoantibody-mediated angiotensin receptor activation contributes to preeclampsia through
tumor necrosis factor-alpha signaling. Hypertension. 2010;55:1246-1253.
Irani RA, Zhang Y, Blackwell SC, Zhou CC, Ramin SM, Kellems RE, Xia Y. The detrimental
role of angiotensin receptor agonistic autoantibodies in intrauterine growth restriction seen in
preeclampsia. J Exp Med. 2009;206:2809-2822.
Gill RM, Hunt JS. Soluble receptor (dcr3) and cellular inhibitor of apoptosis-2 (ciap-2)
protect human cytotrophoblast cells against light-mediated apoptosis. Am J Pathol.
2004;165:309-317.
5
S1. Gene expression levels of LIGHT in the placental tissues of normal pregnancy
individuals (NT) and preeclampsia patients (PE). Placental mRNA of LIGHT expression was
quantified by RT-PCR. Data are expressed as means ± SEM. *P < 0.05 compared to NT group.
N=5-7.
S2. Circulating LIGHT levels in the pregnant mice with saline or LIGHT-injected
pregnant mice. LIGHT and saline were injected to pregnant mice on gestation E13.5 and E14.5
twice. Then Blood was withdrawn and serum was collected on gestation E18.5. Circulating
LIGHT levels were measured by ELISA. Data are expressed as means ± SEM. *P < 0.05
compared to saline-injected group. N=8-10.
S3. LIGHT-induced increased blood pressure and proteinuria were significantly reduced
and associated with decreased circulating LIGHT and sFlt-1 levels in pregnant mice
postpartum. Pregnant mice were injected with saline or LIGHT. LIGHT injection resulted in
hypertension (A) and proteinuria (B) in pregnant mice. Both hypertension and proteinuria
significantly reduced in the mice postpartum day 5. Additionally, circulating LIGHT and sFlt-1
also were significantly reduced in the pregnant mice postpartum day 5. Data are expressed as
means ± SEM. * P < 0.001 versus saline injected pregnant mice; ** P < 0.01 versus LIGHT
injected pregnant mice).
S4. Intra-carotid mean arterial blood pressure (MAP) was measured in non-pregnant mice
with injection of saline or LIGHT on day 5. Data are expressed as means ± SEM. *P < 0.05
compared to saline-injected group. n=-5-8/group.