NF-κB and STAT5 Play Important Roles in
the Regulation of Mouse Toll-Like Receptor 2
Gene Expression
This information is current as
of June 18, 2017.
Tipayaratn Musikacharoen, Tetsuya Matsuguchi, Takeshi
Kikuchi and Yasunobu Yoshikai
J Immunol 2001; 166:4516-4524; ;
doi: 10.4049/jimmunol.166.7.4516
http://www.jimmunol.org/content/166/7/4516
Subscription
Permissions
Email Alerts
This article cites 36 articles, 21 of which you can access for free at:
http://www.jimmunol.org/content/166/7/4516.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2001 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
References
NF-␬B and STAT5 Play Important Roles in the Regulation of
Mouse Toll-Like Receptor 2 Gene Expression1
Tipayaratn Musikacharoen,* Tetsuya Matsuguchi,2* Takeshi Kikuchi,*†
and Yasunobu Yoshikai*
T
oll, first identified in Drosophila (1), participates in antimicrobial immune responses and is conserved in various
species (2). It encodes a transmembrane protein whose
intracellular domain is homologous to those of IL-1 receptor family proteins (1). In adult flies, Toll activation results in the activation of a NF-␬B homologue known as dorsal and the subsequent
production of antimicrobial peptides (1). Recently, a series of
mammalian Toll homologues have been identified and termed
Toll-like receptors (TLRs)3 (3).
In the past few years, various members of the TLR family have
been discovered (3–5). Recent studies have shown that a member
of this family, TLR2, mediates signals from bacterial LPS (6 – 8) or
other bacterial components such as lipoteichoic acid, peptidoglycan, and lipoproteins (9 –12). Although TLR2 can mediate LPS
signals in vitro, its role as the LPS receptor in vivo is ambiguous
since the gene-disrupted mouse of TLR2 shows almost normal
responses to LPS (13).
*Laboratory of Host Defense and Germfree Life, Research Institute for Disease
Mechanism and Control, Nagoya University School of Medicine, Nagoya, Japan; and
†
Department of Periodontology, School of Dentistry, Aichi-Gakuin University,
Nagoya, Japan
Received for publication October 20, 2000. Accepted for publication January
17, 2001.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This work was supported in part by grants from the Ono Pharmaceutical Company,
the Yokoyama Research Foundation for Clinical Pharmacology, and the Naito Foundation (to T.M.) and by the Ministry of Education, Science and Culture of the Japanese government (Grant JSPS-RFTF97L00703) and the Yakult Bioscience Foundation (to Y.Y.).
2
Address correspondence and reprint requests to Dr. Tetsuya Matsuguchi, Laboratory
of Host Defense and Germfree Life, Research Institute for Disease Mechanism and
Control, Nagoya University School of Medicine, 65 Tsurumai-cho, Showa-ku,
Nagoya 466-8550, Japan. E-mail address: [email protected]
3
Abbreviations used in this paper: TLR, Toll-like receptor; C/EBP, CCAAT/enhancer inducing protein; CREB, cAMP response element-binding protein; mTLR,
mouse TLR; ERK, extracellular signal-regulated kinase.
Copyright © 2001 by The American Association of Immunologists
We have previously cloned the mouse TLR2 cDNA, analyzed
its gene expression in immunocompetent cells, and reported that
LPS and various cytokines including TNF-␣, IFN-␥, IL-1␤, IL-2,
and IL-15 rapidly induce TLR2 gene expression in macrophages,
whereas the gene expression of TLR4, another member of TLR,
remains constant (14). We have also demonstrated that TCR engagement and the stimulation with IL-2 and IL-15 increase TLR2
mRNA in T cells. Although these results have indicated that the
induced TLR2 plays important roles in mediating immune responses in the later phases of infections, the transcriptional machinery controlling TLR2 gene expression remains largely unknown. In the present study, we have analyzed the 5⬘ upstream
region of the mouse TLR2 gene and investigated the mechanisms
of its expression in mouse macrophage and T cell lines. The 5⬘
flanking region of the mTLR2 gene contains a number of cis-acting
elements that LPS or inflammatory cytokines might modulate, including two NF-␬B binding sites. We constructed a series of the 5⬘
deletion constructs along with NF-␬B deletion mutants to analyze
the functional importance of these elements. We also analyzed
protein binding to some of these sites after LPS or cytokine stimulation. Our results indicated the critical but different requirements
for NF-␬B in the activation-driven mouse TLR2 (mTLR2) promoter in macrophages and T cells.
Materials and Methods
Reagents and Abs
Recombinant mouse TNF-␣ and human IL-15 were purchased from PeproTech (Seattle, WA). LPS from Escherichia coli serotype B6:026 was
obtained from Sigma (St. Louis, MO). Synthetic E. coli-type lipid A,
ONO4007, was kindly provided by Ono Pharmaceutical (Tokyo, Japan).
RPMI 1640 and DMEM were purchased from Sigma. Anti-p50, p65 were
obtained from Santa Cruz Biotechnology (Santa Cruz, CA) and antiSTAT5 Ab was obtained from PharMingen/Transduction Laboratories
(San Diego, CA).
0022-1767/01/$02.00
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
Toll-like receptor 2 (TLR2) is involved in the innate immunity by recognizing various bacterial components. We have previously
reported that TLR2 gene expression is rapidly induced by LPS or inflammatory cytokines in macrophages, and by TCR engagement or IL-2/IL-15 stimulation in T cells. Here, to investigate the mechanisms governing TLR2 transcription, we cloned the 5ⴕ
upstream region of the mouse TLR2 (mTLR2) gene and mapped its transcriptional start site. The 5ⴕ upstream region of the mTLR2
gene contains two NF-␬B, two CCAAT/enhancer binding protein, one cAMP response element-binding protein, and one STAT
consensus sequences. In mouse macrophage cell lines, deletion of both NF-␬B sites caused the complete loss of mTLR2 promoter
responsiveness to TNF-␣. NF-␬B sites were also important but not absolutely necessary for LPS-mediated mTLR2 promoter
activation. In T cell lines, mTLR2 responsiveness to IL-15 was abrogated by the 3ⴕ NF-␬B mutation, whereas 5ⴕ NF-␬B showed
no functional significance. The STAT binding site also seemed to contribute, as the deletion of this sequence significantly reduced
the IL-15-mediated mTLR2 promoter activation. EMSAs confirmed nuclear protein binding to both NF-␬B sites in macrophages
following LPS and TNF-␣ stimulation and to the 3ⴕ NF-␬B site in T cells after IL-15 treatment. Thus, NF-␬B activation is
important but differently involved in the regulation of mTLR2 gene expression in macrophages and T cells following LPS or
cytokine stimulation. The Journal of Immunology, 2001, 166: 4516 – 4524.
The Journal of Immunology
Isolation and characterization of mTLR2 genomic clones
The mTLR2 cDNA containing the whole coding region was labeled with
32
P by random priming and used for screening the mouse genomic phage
library, Lambda Fix II (Stratagene, La Jolla, CA). Phages were plated with
E coli strain XL1-Blue MRA and transferred to nitrocellulose membranes.
The membranes were prehybridized in 500 mM NaCl, 1% SDS, and 10%
dextran sulfate for 3 h at 65°C, followed by hybridization with 32P-labeled
probe for 14 h at 65°C. Membranes were washed twice with 2⫻ SSC and
0.1% SDS for 5 min at 50°C, twice with 0.1⫻ SSC and 0.1% SDS for 15
min at 50°C, and exposed to x-ray films. Positive clones were plated and
screened until successive pure clones were obtained. Phage DNAs were
isolated from positive clones and characterized by enzyme restriction mapping. Subfragments were cloned into pBlueScript II KS⫹ (Stratagene) and
were enzymatically nucleotide sequenced by the DNA sequencer (model
373A sequencer) using DYEnamic ET terminator cycle sequencing kit
(Amersham Pharmacia Biotech, Piscataway, NJ). The nucleotide sequences upstream to the transcriptional initiation site were searched for the
potential binding sites for transcription factors by TRANSFAC (http://www.dna.affrc.go.jp and http://www.motif.genome.ad.jp).
Cell culture and transient transfection assays
Mapping the transcriptional start site of mTLR2
Primer extension analysis was applied to map the initiation start site of the
mTLR2 gene. Total RNAs were prepared from RAW264.7 cells stimulated
with 1 ␮g/ml LPS. An oligonucleotide, AGGAGTCCTCCAGCCGCCGC,
complementary to the 5⬘ untranslated region of the mTLR2 cDNA (8) was
end labeled with 32P and hybridized with 10 ␮g of RNA at 55°C for 8 h.
The reverse transcription was performed in 20 ␮l of first-strand buffer and
100 U of Superscript II (Life Technologies) at 42°C for 1 h. The same
primer was used in DNA sequencing on a plasmid containing the 5⬘ flanking region of the mTLR2 gene with fmol DNA sequencing systems (Promega, Madison, WI). The extended primer was run along with the sequencing product on an 8% denaturing polyacrylamide urea gel.
Plasmid constructs, deletion mutagenesis, and DNA purification
A series of synthesis oligonucleotide senses (CCGCTCGAGCCCAATCGTGG
GATTCCATG (pGL3–2332), CCGCTCGAGGTTGACCCCATGGTGGTT
(pGL3–1486), CCGCTCGAGGCAGGGGGACAAAGTGTTGA (pGL3–789),
CCGCTCGAGTGGGCCTCGATAGGGTATTT (pGL3–598), CCGCTCGA
GCATTCAGCCATCATTGTCCA (PGL3–384), CCGCTCGAGAACGTTTC
CTAGCTGGAGCA (pGL3–297), CCGCTCGAGAGGCGAGCTGGGAGGC
AGCT (pGL3–201), CCGCTCGAGACGGAGCCTCTGGACTTTCA (pGL3–
144), CCGCTCGAGGCCTGCCCTGTGGCTCCTGC (pGL3–117)) and an antisense (GGAAGATCTCTGGGCACCAGCCTAGGAAG, derived from the respective part of the 5⬘ upstream region of the mTLR2 gene) were used to generate
a series of 5⬘ deletion DNA fragments. All PCR fragments were digested with
XhoI and BglII and subcloned into pGL3-basic vector (Promega).
To construct a NF-␬B deletion mutant, 3⬘ NF-␬B-mut, two PCR products from
two pairs of primers (CCGCTCGAGGTTGACCCCATGGTGGTT and CG
GATATCGGTGTCCTAAAGAGAAGCT; GCGATATCACGGAGCCTCTG
GACTTTCA and GGAAGATCTCTGGGCACCAGCCTAGGAAG) were amplified, digested with EcoRV, ligated, and cloned into the pGL3-basic vector. To
construct 5⬘ NF-␬B-mut, PCR products from two pairs of primers (CCGCTC
GAGGTTGACCCCATGGTGGTT and CGGATATCTACTTTAAAACAA
GTTAATC; GCGATTATCCTTACAACTGGAATATGGAG and GGAAGAT
CTCTGGGCACCAGCCTAGGAAG) were amplified, digested with EcoRV, ligated, and cloned into pGL3-basic vector. To construct 3/5⬘ NF-␬B-mut, PCR
products from three pairs of primers (CCGCTCGAGGTTGACCCCATGGTG
GTT and CGGATATCTACTTTAAAACAAGTTAATC; GCGATTATCCT
TACAACTGGAATATGGAG and CGGATATCGGTGTCCTAAAGAGAAG
CT; GCGATATCACGGAGCCTCTGGACTTTCA and GGAAGATCTCTG
GGCACCAGCCTAGGAAG) were amplified, digested with EcoRV, and cloned
into pGL3-basic vector. To prepare pGL3–384-mut, oligonucleotides used for
pGL3–384 were used with the 3⬘ NF-␬B-mut as the template. The amplified product was cloned into pGL3-basic vector. Plasmid DNAs were purified from bacterial cultures using an Endofree Plasmid Maxi kit (Qiagen, Chatsworth, CA).
Finally, restriction enzyme mapping and sequencing confirmed all constructs.
PcDNA3-STAT5a, a dominant negative STAT5a expression plasmid,
was a generous gift from Alan D. Andrea (Dana-Farber Cancer Institute,
Boston, MA).
Immunoprecipitation and Western blot analysis
Cellular extracts were prepared from untreated or IL-15-treated CTLL-2
cells using PLC lysis buffer (50 mM HEPES (pH 7.0), 150 mM NaCl, 10%
glycerol, 1% Triton X-100, 1.5 mM MgCl2, 1 mM EGTA, 100 mM NaF,
10 mM NaPPi, 1 mM Na3VO4, 1 mM PMSF, 10 mg/ml aprotinin, and 10
mg/ml leupeptin). The lysates from 107 cells were incubated with the
STAT5 Ab for 2 h at 4°C, followed by protein G-Sepharose beads (Amersham Pharmacia Biotech) for an additional 1 h. The beads were washed
three times with lysis buffer, suspended in SDS sample buffer, and heated
at 95°C for 5 min. The eluted proteins were applied to SDS-polyacrylamide
gel and electrotransferred to a nitrocellulose membrane. The membrane
was blocked for 2 h in 2% BSA-TBST (20 mM Tris-HCl (pH 7.6), 0.15 M
sodium chloride, and 0.1% Tween 20), incubated with primary Abs in
TBST for 1 h, washed three times with TBST, and incubated for 1 h with
HRP-conjugated antimouse Ig (Amersham, Arlington Heights, IL) diluted
1:10,000 in TBST. After three washes in TBST, the blot was developed
with the ECL system (Amersham Pharmacia Biotech) according to the
manufacturer’s instructions.
EMSA
Nuclear extracts were prepared from RAW264.7 stimulated with 1 ␮g/ml
LPS or 10 ng/ml TNF-␣ and from CTLL-2 stimulated with 10 ng/ml IL-15
as previously described (15). The binding sequences used for the EMSAs
comprise 5⬘-TTTAAAGTAGGGGGTTTCCCCTTACAACTG for 5⬘ NF␬B, 5⬘-ACCTGGGGAATTCCCACACG for 3⬘ NF-␬B, and 5⬘-GAGCAT
TCCAATAACCAAAG for STAT. Approximately 1 ⫻ 105 cpm of an
oligonucleotide, labeled with 32P using T4 polynucleotide kinase, 10 ␮g of
nuclear extract, and 1 ␮g of poly(dI 䡠 dC) were added to the binding buffer
(10 mM Tris-HCl (pH 7.5), 100 mM NaCl, and 4% glycerol) and incubated
for 30 min at 4°C. For competition assays, nuclear extracts were incubated
with a 50- or 100-fold excess of unlabeled over labeled oligonucleotide in
before the 32P-labeled probe. For supershift assays, anti-p50, anti-p65 NF␬B, or anti-STAT5 Abs were incubated with nuclear extracts for 2 h before
the binding reactions. The reaction mixtures were run through a 6% nondenaturing polyacrylamide gel at 4°C in TBE buffer (90 mM Tris-borate,
2 mM EDTA).
Results
Isolation and characterization of mTLR2 genomic clones
We have previously demonstrated that TLR2 mRNA is up-regulated in mouse macrophages in response to LPS and various cytokines including IL-1␤, IL-2, IL-15, TNF-␣, and IFN-␥ (14).
TLR2 gene expression is also induced by TCR engagement, IL-2,
or IL-15 stimulation in T cells (8). To study the transcriptional
regulation of mTLR2, a mouse genomic library was screened with
a mTLR2 cDNA probe. After screening ⬃2 ⫻ 106 clones, we
isolated two positive clones and characterized them by enzyme
mapping and nucleotide sequencing. The two overlapping clones
contained inserts of 14.6 and 15 kb, respectively (Fig. 1). The
exon/intron junctions of the mTLR2 gene were partially decided.
The published 5⬘ untranslated region of mTLR2 cDNA (8) was
encoded by three exons. The first ATG that corresponded to the
translational start codon was located at 15 bases downstream of the
5⬘ end of the third exon.
The transcriptional start site and 5⬘ promoter sequence
The transcriptional initiation site of the mouse TLR2 gene was
determined by primer extension analysis. A synthetic oligonucleotide complementary to nucleotide positions 37–57 of the reported
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
A mouse macrophage cell line, RAW264.7 was obtained from The Institute
of Physical and Chemical Research (Japan) Cell Bank (Tsukuba, Japan)
and maintained in DMEM with 10% newborn calf serum. A mouse T cell
line, CTLL-2, was obtained from The Institute of Physical and Chemical
Research (Japan) Cell Bank and maintained in RPMI 1640 with 10% FCS
and 10 ng/ml mouse IL-2. For the transient transfection, 2 ␮g of the
mTLR2 luciferase construct, in combination with 0.2 ␮g of pRL-SV40 as
an internal control, was transfected into RAW264.7 by LipofectAMINE
(Life Technologies, Rockville, MD) or CTLL-2 by DMRIE-C (Life Technologies) according to the manufacturer’s instructions. Forty-eight hours
after transfection, cells were stimulated with 1 ␮g/ml LPS, 10 ␮g/ml synthetic lipid A, 10 ng/ml TNF-␣, or 10 ng/ml IL-15 for 8 h. Then cells were
lysed and the lysates were used for luciferase activity measurements using
the dual luciferase reporter assay system (Toyo Ink, Tokyo, Japan) according to the manufacturer’s instructions. All of the luciferase assays shown in
the current study were repeated at least three times, and a typical result was
shown for each experiment.
4517
4518
NF-␬B AND STAT5 REGULATE MOUSE TLR2 GENE EXPRESSION
FIGURE 1. Restriction enzyme map and characterization of mTLR2
gene. Isolated positive phage clones were characterized by restriction enzyme mapping. The two positive clones with inserts of 14.6 and 15 kb
overlapped by 11.7 kb. The first two exons are shown as black boxes and
the position of the first methionine is shown.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
mTLR2 cDNA sequence (8) was hybridized to total RNA from
LPS-stimulated RAW264.7 cells and extended by reverse transcription. As shown in Fig. 2A, the length of the extended product
was 102 nt, as determined by comparison with the sequence ladders from the same primer. This transcriptional initiation site was
located 55 bp upstream of the 5⬘ end of the previously described
cDNA (8). Several probes prepared from the genomic DNA 5⬘
upstream of this site did not generate any signals in Northern blotting analyses using RNA from LPS-treated RAW264.7 cells (data
not shown). The mRNA transcription initiation site is designated
as ⫹1 in the numbering of the nucleotide sequence throughout this
paper (Fig. 2B).
The nucleotide sequence analyses determined the coding part of
the genomic DNA is precisely identical to the previously established cDNA sequence (8). Although the putative TATA or CAAT
sequence was not identified in the DNA sequence upstream of the
defined transcriptional start site, this region was rich in GC content. A computer search of the 5⬘ flanking sequence with the transcription factor databases from TRANSFAC (http://www.dna.
affrc.go.jp and http://www.motif.genome.ad.jp) disclosed several
putative binding sites for transcription factors. These included two
NF-␬B (positions ⫺1115 to ⫺1106 and ⫺160 to ⫺150), two
CCAAT/enhancer binding protein (C/EBP; positions ⫺1591 to
⫺1578 and ⫺777 to 765), a cAMP response element-binding protein (CREB; positions ⫺1267 to ⫺1260), and a STAT (positions
⫺279 to ⫺271) binding sites (Fig. 2B).
Functional analysis of the TLR2 promoter in mouse macrophage
cell lines
A series of 5⬘ deletion constructs of the mTLR2 promoter region
was initially generated to analyze mTLR2 promoter activity and to
identify functional cis-acting elements required for mTLR2 gene
expression (Fig. 3A). These 5⬘-deleted DNAs were cloned into the
promoter-less luciferase vector pGL3-basic (Promega). The generated plasmids were transfected into a mouse macrophage cell
line, RAW264.7, whose mTLR2 mRNA was responsive to various
stimulants (14). Forty-eight hours after the transfection, the cells
were stimulated with LPS or TNF-␣ for 8 h, and the luciferase
activity was measured. The results standardized by the internal
control are shown in Fig. 3B.
The highest induction was obtained with pGL3–1486 for both
LPS and TNF-␣ treatments. The longer construct, pGL3–2332,
showed less induction for each treatment, suggesting that the
1486-bp 5⬘ upstream region of the mTLR2 gene is sufficient for
the maximal induction by LPS and TNF-␣. It may also indicate the
region between ⫺2332 and ⫺1486 is inhibitory for the mTLR2
induction. The five shorter constructs (789, 598, 384, 297, and
201) showed slightly less induction for both LPS and TNF-␣.
However, the responsiveness for these treatments was abrogated
when the construct was downed to ⫺144 (pGL3–144). We also
FIGURE 2. Nucleotide sequence of the mouse TLR2 gene 5⬘ upstream
region. A, Primer extension assay. Ten micrograms of total RNA from
LPS-stimulated RAW264.7 cells was hybridized with 32P-labeled oligonucleotide complementary to nucleotide positions 37–57 of the reported
mTLR2 cDNA sequence. The reverse transcription was performed and the
generated cDNA was run along with sequencing ladders on a polyacrylamide gel. ⴱ, Generated cDNA from primer extension. The complementary
sequences of sequencing products are shown and the transcriptional start
site is indicated. B, The nucleotide sequences of the 5⬘ flanking region are
given in capital letters, nucleotide sequences of exon I are shown in lowercase letters, and the transcriptional start site is shown in bold capital
letters. The numbering begins at the transcriptional start site. The potential
transcription factor binding sites, C/EBP, CREB, NF-␬B, and STAT, are
indicated by underlines and 5⬘ end of each deletion luciferase reporter
construct is indicated.
The Journal of Immunology
4519
induction by LPS and TNF-␣. To further confirm the roles of
NF-␬B binding sites, we separately mutated two NF-␬B binding
sites of pGL3–1486 (termed 5⬘ NF-␬B-mut and 3⬘ NF-␬B-mut,
respectively) and compared their activity with pGL3–1486 (Fig. 4,
A and B). Each NF-␬B mutant showed a lower response to LPS or
TNF-␣ treatment than the wild-type construct, suggesting that both
NF-␬B sites contributed to the full mTLR2 mRNA induction by
LPS and TNF-␣. Deletion of both NF-␬B sites (5⬘/3⬘ NF-␬B-mut)
abrogated the response to TNF-␣. This construct, however, still
retained a significant response to LPS stimulation.
To localize LPS-responsive elements other than NF-␬B binding
sites, we next mutated the 3⬘ NF-␬B site of a shorter construct,
pGL3–384. The new construct termed pGL3–384-mut did not
show any induction in response to either LPS or TNF-␣ (Fig. 4C).
Altogether, these results have demonstrated that in mouse macrophages, two NF-␬B binding sites of mTLR2 promoter are essential
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 3. mTLR2 promoter functional analysis using 5⬘ deletion constructs in RAW264.7 cells. A, Schematic presentation of the 5⬘ deletion
luciferase constructs. The structure of the mTLR2 gene promoter is shown
on the top. Symbols represent the binding site for indicated transcription
factors. A series of 5⬘ deletion constructs were constructed as described in
Materials and Methods. The number of each construct corresponds to its 5⬘
end. B, The 5⬘ deletion constructs (shown in A) were transfected into
RAW264.7 cells along with pRL-SV40 as an internal control. The transfected cells were left untreated or treated for 8 h with 1 ␮g/ml LPS or 10
ng/ml TNF-␣ as indicated. Luciferase activities are expressed as fold induction in treated samples relative to untreated control for each luciferase
reporter construct.
transfected these constructs into another mouse macrophage cell
line, J774.1 and obtained very similar results to those from
RAW264.7 cells (data not shown).
Roles of NF-␬B consensus sequences in mTLR2 gene expression
in mouse macrophages
In our previous report, we demonstrated that specific inhibitors for
extracellular signal-regulated kinase (ERK) did not inhibit LPSmediated mTLR2 mRNA induction in RAW264.7 cells, suggesting that the activation of ERK is not essential for the induction
(14). In contrast, curcumin, the NF-␬B inhibitor, effectively inhibited the mTLR2 up-regulation by LPS (14). This result, however,
was not conclusive since the inhibitory effect of curcumin is not
specific to NF-␬B.
Our luciferase assay data with 5⬘ deletion constructs (Fig. 3A)
are consistent with the essential roles of the two NF-␬B sites (positions ⫺1115 to ⫺1106 and ⫺160 to ⫺150) in mTLR2 mRNA
FIGURE 4. Roles of NF-␬B binding sites in the mTLR2 promoter activities in RAW264.7 cells. A, The mTLR2 promoter constructs, pGL3–
1486 and pGL3–384, were used as wild types to produce the NF-␬B deletion constructs. The X indicates that the particular transcription factor site
has been deleted. B, The NF-␬B deletion mutant constructs were produced
from wild-type pGL3–1486 and transfected into RAW264.7 cells. The fold
induction by LPS and TNF-␣ is shown. C, The shortened luciferase reporter construct, pGL3–384, was used as a template to construct pGL3–
384-mut in which 3⬘ NF-␬B was deleted. Luciferase activities from both
constructs and pure pGL3-basic vector are shown.
4520
NF-␬B AND STAT5 REGULATE MOUSE TLR2 GENE EXPRESSION
in the transcriptional response to TNF-␣. They are also important
for the LPS response, but transcriptional factors other than NF-␬B
are also activated by LPS and contribute by affecting the TLR2 5⬘
flanking region between ⫺384 and ⫺1486.
Sythetic lipid A-mediated mTLR2 promoter activation in
mouse macrophages
To rule out the possibility that LPS-mediated mTLR2 promoter
activation was due to a small amount of contaminating substances
other than LPS, additional experiments were done with synthetic
lipid A, the biological center of LPS. A series of 5⬘ deletion constructs and NF-␬B-mutated constructs were transfected into
RAW264.7 cells and transfected cells were stimulated with 10
␮g/ml synthetic lipid A. The luciferase assay results with lipid A
(Fig. 5, A and B) showed very similar patterns to those with LPS
(Figs. 3 and 4). These results indicated that the LPS-mediated
mTLR2 promoter activation was not due to the contaminating substances such as lipoproteins.
and stimulated with IL-15 for 8 h. The results of luciferase assays
are shown in Fig. 6A. They were similar to those with LPS- or
TNF-␣-stimulated RAW264.7 cells, except for pGL3–201. Although this construct was slightly responsive to IL-15, the induction ratio was significantly less than the four longer constructs
(789, 598, 384, and 297). We also performed the assay with IL-2
stimulation and obtained very similar results (data not shown),
which seemed reasonable since IL-2 and IL-15 share the same
signaling receptors (IL-2R ␤ and common ␥ chain) in T cells (16).
Since IL-15 activates NF-␬B (17, 18), we also used NF-␬B
binding site-disrupted constructs to analyze the role of NF-␬B in
mTLR2 gene expression mediated by IL-15 in CTLL-2 cells (Fig.
6, B and C). Surprisingly, 5⬘ NF-␬B deletion had no effect on
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
mTLR2 promoter sequences mediating IL-15 responsiveness
in T cells
A significant fraction of T cells express TLR2 and TLR4 genes, and
gene expression of TLR2, unlike that of TLR4, is rapidly induced
by TCR engagement, IL-2, or IL-15 stimulation (8). Although we
have revealed that ERK and p38 kinase activation are essential for
the mTLR2 mRNA up-regulation by TCR engagement (14), molecular mechanisms mediating IL-2/IL-15 responsiveness have not
been explored.
To analyze the mechanisms of IL-15-mediated mTLR2 gene expression in T cells, CTLL-2, a mouse T cell line, was transiently
transfected with a series of 5⬘-deleted mTLR2 promoter constructs
(Fig. 3A). Forty-eight hours after transfection, cells were starved
FIGURE 5. Responsiveness of mTLR2 promoter to synthetic lipid A
stimulation. A, A series of mTLR2 deletion luciferase constructs was transfected into RAW264.7 cells. The transfected cells were left unstimulated or
stimulated with 10 ␮g/ml synthetic lipid A for 8 h and the fold induction
is shown. B, A series of NF-␬B deletion constructs was also transfected
into RAW264.7 cells. The fold induction of luciferase activities mediated
by synthetic lipid A stimulation (10 ␮g/ml) is shown.
FIGURE 6. The mTLR2 promoter activities in the CTLL-2 cell line. A,
CTLL-2 cells were transfected with a series of 5⬘ deletion reporter luciferase constructs as described in Fig. 3A. Transfected cells were left unstimulated or stimulated with 10 ng/ml IL-15 for 8 h. IL-15-mediated
mTLR2 promoters activities are shown. B, IL-15 mediated mTLR2 promoter induction in CTLL-2 and RAW264.7 cells. The different NF-␬B
deletion mutants are indicated and fold induction by IL-15 in both cell lines
is shown. C, The deletion of the 3⬘ NF-␬B binding site eliminates the
induction of IL-15. Luciferase activity in CTLL-2 is shown.
The Journal of Immunology
mTLR2 gene induction by IL-15. In contrast, the 3⬘ NF-␬B mutation caused the complete loss of the responsiveness in CTLL-2
cells. These results indicated that the two NF-␬B binding sites of
the mTLR2 gene promoter play different roles in IL-15-mediated
mTLR2 gene transcription in T cells. We also transfected these
constructs into another mouse T cell line, S49.1, for IL-15 stimulation and obtained basically the same results as those from
CTLL-2 cells (data not shown).
The different roles of the two NF-␬B sites are not specific to
IL-15 but due to the cell type difference, since IL-15-mediated
mTLR2 promoter activation was mediated by each NF-␬B site in
RAW264.7 cells (Fig. 6B).
DNA protein binding of mTLR2 promoter in RAW264.7 cells
IL-15-mediated mTLR2 promoter in CTLL-2 requires STATbinding element
Since IL-15 induced the activation of STAT5 in T cells (19), we
investigated the possibility that STAT-binding element might also
be required in IL-15-mediated mTLR2 gene expression in T cells.
Western blot analyses revealed that IL-15 induced tyrosine phosphorylation of STAT5 in CTLL-2 cells (Fig. 9A). Shortened luciferase reporter constructs that have 3⬘ NF-␬B and STAT binding
sites, pGL3–384, were cotransfected with a STAT5a dominant
negative expression plasmid. The cotransfection of this dominant
negative construct abrogated the response to IL-15 (Fig. 9B). We
then performed electrophoretic gel shift assay using an oligonucleotide corresponding to the STAT consensus sequence found in
the mTLR2 promoter region and STAT5 Ab. As shown in Fig. 8C,
IL-15 induced the specific protein binding to this STAT consensus
sequence, which was supershifted by STAT5 Ab. These results
have indicated that STAT5 activation contributes to the mTLR2
gene transcription in IL-15-stimulated T cells.
Discussion
In this study, we have described the isolation and characterization
of the 5⬘ regulatory region of the mTLR2 gene. In our previous
reports (8, 14), we have demonstrated that mTLR2 gene expression
is significantly inducible in macrophages and T cells. In macro-
phages, mTLR2 mRNA was rapidly induced by LPS, IL-1␤, IL-2,
IL-15, IFN-␥, or TNF-␣ (14), whereas in T cells it was responsive
to TCR engagement, IL-2, or IL-15 (8). In our current study, we
focused on the molecular mechanism of how mTLR2 transcription
is regulated by LPS, TNF-␣, and IL-15. Our results of promoter
functional analyses showed that the upstream region reaching up to
⫺1486 is sufficient for the fully inducible expression of the mTLR2
gene in both macrophages and T cells. Nucleotide sequencing
analysis of this region identified consensus sequences for binding
of various transcription factors that may be involve in the induction of mTLR2 gene expression. They included two NF-␬B, two
C/EBP, one CREB, and one STAT consensus sequences, all of
which are responsive to LPS or cytokine stimulation in some gene
promoters. This is in contrast to mouse and human TLR4 promoters, in which neither NF-␬B nor CREB consensus sequences were
found in the 5⬘ proximal regions of the transcriptional initiation
sites. Both human and mouse TLR4 genes, however, contains two
C/EBP sites in their promoter regions (20). The difference of the
promoter sequences between these two TLRs probably explains
their different mRNA induction patterns in macrophages and T
cells as we have previously reported (8, 14).
In our previous report, we demonstrated that curcumin, an
NF-␬B inhibitor, effectively inhibited the LPS-mediated mTLR2
gene expression in macrophages (14). This result, however, was
not conclusive since the inhibitory effect of curcumin is not specific. The luciferase assay results in our current report are consistent with the important roles of the two NF-␬B sites (positions
⫺1115 to ⫺1106 and ⫺160 to ⫺150) in mTLR2 mRNA induction
by both LPS and TNF-␣. The deletion analysis of each NF-␬B site
clearly showed that NF-␬B has indeed integrating function for full
stimulation of the mTLR2 promoter in macrophages. Thus, like
several other receptors, TLR2 not only activates NF-␬B, but it
itself is induced by NF-␬B.
NF-␬B encompasses an important family of transcriptional activators. It is critical for the inducible expression of multiple genes,
including those playing essential roles in immune responses. The
members of the NF-␬B family include p50 (NF-␬B1), p52 (NF␬B2), p65 (RelA), RelB, v-Rel, and c-Rel (21–25). In cells, NF-␬B
exists as homo- or heterodimers with distinct DNA-binding specificity. A heterodimer composed of p50 and p65 subunits is the
most common dimer (21, 22). In unstimulated cells, the NF-␬B
proteins exist in cytoplasm and form an inactive complex with the
inhibitory protein inhibitor ␬B (26, 27). Cellular stimulation with
LPS, inflammatory cytokines, or phorbol ester results in phosphorylation, ubiquitination, and subsequent degradation of inhibitor
␬B. This allows the translocation of NF-␬B to the nucleus where
it up-regulates the transcription of the target genes (1, 23).
In contrast to the essential role of NF-␬B activation in TNF-␣mediated mTLR2 mRNA induction, LPS and lipid A could activate mTLR2 promoter, albeit to a lesser degree, in the absence of
both NF-␬B binding sites (Fig. 4B). The additional regulatory
site(s) should exist between ⫺1486 and ⫺384 because pGL3–384mut, in which the 3⬘ NF-␬B site was mutated, failed to respond to
LPS and lipid A (Figs. 4C and 5B). Although NF-␬B is the most
typical transcription factor activated by LPS, LPS signals also involve several other transcription factors in various cell types,
namely, ATF-2, AP-1, Sp-1, CREB, and C/EBP (28 –30). It is of
note that the 1486 bp upstream region of the mTLR2 gene contains
CREB and C/EBP binding sites. It is thus conceivable that some of
these sites contribute to the LPS-mediated mTLR2 transcription.
Our experiments using 5⬘ deletion constructs revealed that the difference between pGL3–1486 and pGL3–789 was more marked
with LPS than with TNF-␣ treatment. In contrast, pGL3–598
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
To examine the NF-␬B binding to the mTLR2 promoter, EMSAs
were performed (Fig. 7). The double-strand oligonucleotides corresponding to the 5⬘ and 3⬘ NF-␬B sequences of mTLR2 promoter
were labeled and incubated with nuclear extracts from RAW264.7
cells stimulated with LPS or TNF-␣. We observed constitutive
protein binding to the 3⬘ NF-␬B probe, but not to the 5⬘ NF-␬B
probe in this cell line (Fig. 7, A and B). Stimulation with LPS or
TNF-␣ significantly induced protein binding to both 5⬘ and 3⬘
NF-␬B probes. The protein binding was abrogated by the addition
of a 50-fold molar excess of unlabeled oligonucleotides, suggesting the binding was specific.
We next addressed whether extracts bound to 5⬘ and 3⬘ NF-␬B
probes could be modified by Abs against NF-␬B/Rel family members p50 and p65. As shown in the Fig. 7C, the inducible 3⬘ NF-␬B
complexes were supershifted with Abs against p50 and p65, indicating the contributions of both p65 and p50 in the shift complexes. In contrast, inducible 5⬘ NF-␬B complexes were shifted
with Ab against p65 but not affected by that of p50 (Fig. 7D).
Thus, the 5⬘ NF-␬B site binds the p65 homodimer.
EMSAs using two NF-␬B probes were also performed for IL15-treated CTLL-2 cells (Fig. 8, A and C). Unlike LPS or TNF-␣
in macrophages, IL-15 induced nuclear protein binding only to the
3⬘ NF-␬B site in T cells (Fig. 8, A and C). The protein-DNA
complex of the 3⬘ NF-␬B site was supershifted by both anti-p65
and p50 Abs (Fig. 8B).
4521
4522
NF-␬B AND STAT5 REGULATE MOUSE TLR2 GENE EXPRESSION
FIGURE 7. Specific protein-binding activities of NF-␬B sequences in
RAW264.7 cells. A, The nuclear extracts were prepared from RAW264.7
cells. RAW264.7 cells were untreated or treated with 10 ng/ml TNF-␣ or
1 ␮g/ml LPS for 30 min. Ten micrograms of nuclear extracts was incubated
with 32P-labeled oligonucleotide complementary to the 5⬘ NF-␬B sequence
for 30 min. Protein-DNA complexes were separated on a 6% polyacrylamide gel run in 0.25⫻ TBE. Autoradiography was performed at room
temperature for 12 h. Comp refers to EMSA binding reactions that also
contained a 50-fold molar excess of the unlabeled oligonucleotide as the
competitor. The binding efficiencies and free probe signals are shown. B,
The nuclear extracts from treated RAW264.7 cells were preincubated for
2 h with Abs against the p50 or p65 subunit as indicated. The 5⬘ NF-␬B
probe was added and the mixtures were incubated on ice for 30 min. The
results of supershift assays are shown. C, The competition assay to the 3⬘
showed almost the same induction as pGL-789 with LPS treatment. These results are consistent with the idea that the CREB
binding site (⫺1267 to ⫺1260) plays a role in the LPS-mediated
mTLR2 induction. It has recently been reported that CREB plays
a role in the TNF-␣ mRNA induction by LPS in macrophages (28).
In another report, it has been revealed that CREB is activated by
LPS through p38 stress-activated protein kinase and is involved in
the up-regulation of CD80, CD83, and CD86 (31). It is noteworthy
NF-␬B sequence. The 100-fold excess unlabeled oligonucleotide was
added as the competitor. The binding mixtures were run in 1⫻ TBE. The
DNA-protein binding complexes and competition results are shown. D,
The supershift assays with Abs against p50 and p65 used the 3⬘ NF-␬B
probe. The shifted bands are shown.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 8. Specific protein-binding activities of NF-␬B sequences in
CTLL-2 cells. A, CTLL-2 were untreated or treated with 10 ng/ml IL-15
for 50 min and the nuclear extracts were prepared. For competition assays,
10 ␮g of nuclear extracts was incubated with a 100-fold molar excess of
the unlabeled 3⬘ NF-␬B oligonucleotide as described in Materials and
Methods. The binding bands are shown. B, The nuclear extracts used in A
were used for supershift assays with Abs against p50 and p65 used 3⬘
NF-␬B probe. The shifted bands are indicated. C, IL-15 does not induce
protein binding to the 5⬘ NF-␬B site in CTLL-2 cells. The 50-fold excess
unlabeled oligonucleotide was added as the competitor.
The Journal of Immunology
that LPS-mediated mTLR2 gene expression was slightly inhibited
by a specific inhibitor of p38 stress-activated protein kinase (14).
The results of the supershift assay suggested the difference between the two NF-␬B sites. The 3⬘ NF-␬B was supershifted by Abs
against p50 and p65, whereas 5⬘ NF-␬B was supershifted only by
an Ab against p65. Thus, 3⬘ NF-␬B is preferably bound by the
p50/p65 heterodimer and 5⬘ NF-␬B is more prone to bind the p65
homodimer.
p65 homodimers have different binding specificities from p50/
p65 heterodimers (32). p65 homodimers preferentially bind
GGGRNTTTCC, as evidenced by screening with a pool of random
oligonucleotides (33). This motif is somewhat different from the
p50 homodimer consensus sequence (GGGGATYCCC), and the
DNA motifs that bind p65 homodimers but not p50 homodimers
do not bind p50/p65 heterodimers well. The sequence of the 5⬘
NF-␬B binding site of the mTLR2 promoter (GGGGGTTTCC)
exactly matches the motif for the p65 homodimer and thus may
preferentially bind p65 homodimers.
In a recent paper, it has been suggested that some kinds of the
commercially available LPS contain small amounts of contaminants that can be recognized by TLR2 (34). In our study, however,
mTLR2 promoter was activated by synthetic lipid A treatment,
clearly indicating that LPS could activate mTLR2 promoter with
its lipid A portion.
In contrast to macrophages, only the 3⬘ NF-␬B sequence seemed
functional in IL-15-treated CTLL-2 cells. It is consistent with the
EMSA data in which the 5⬘ NF-␬B probe was not shifted with
nuclear extracts prepared from the IL-15-treated T cell line (Fig.
8B). The different roles of these NF-␬B sites seemed cell-type
specific, since both 5⬘ and 3⬘ NF-␬B sites were functional in IL15-treated RAW264.7 cells (Fig. 6B). Considering the differences
of the binding specificity of the two NF-␬B sites, it is reasonable
to presume that IL-15-treated CTLL-2 cells did not contain sufficient amounts of p65 homodimers. The molar ratio of the three
NF-␬B complexes (p50 homodimer, p50/p65 heterodimer, and p65
homodimer) varies among different cell types (21). Although the
expression of p65 is essentially constitutive, some increases have
been reported in some T cell lines (21) and TNF-␣-treated astrocytes (35). Unfortunately, the effects of LPS, TNF-␣, or IL-15 on
the ratio of NF-␬B dimers in macrophages or T cells has not been
elucidated.
In contrast to LPS or TNF-␣, the region between ⫺297and
⫺201 plays a role in the IL-15-mediated mTLR2 transcription. It
is likely that a STAT binding site in this region is responsible for
this, since STAT5 was tyrosine phosphorylated and bound the
STAT consensus sequence in IL-15-treated CTLL-2 cells (Fig. 9,
A and C). Interestingly, the expression of the dominant negative
form of STAT5a abrogated the mTLR2 promoter activation by
IL-15 (Fig. 9B). Although STAT3 is also activated by IL-15 in T
cells (19), this result indicates that STAT5 is not only involved but
is required for the IL-15-mediated mTLR2 gene expression in T
cells. It was of note, however, that pGL3–384-mut, which contains
the STAT binding site, but no NF-␬B site, was not responsive to
IL-15 treatment. It suggests that the cooperation of the active STAT
and 3⬘ NF-␬B sites is necessary to mediate the IL-15 effect in T cells.
Synergy between different signal pathways has recently been demonstrated for many cytokines and growth factors. The collaboration between the NF-␬B motif and a STAT-binding element has recently
been reported for IFN regulatory factor-1 gene promoter (36). It has
been reported that artificial constructs containing a single copy of both
a STAT-binding element and a NF-␬B motif were able to mediate a
synergistic response to IFN-␥ and TNF-␣, and this response varied
with both the relative spacing and the specific sequence of the regions
between these two sites (36).
In conclusion, the present study has explored how mTLR2 promoter is activated in immunocompetent cells by LPS, TNF-␣, or
IL-15. We have found that NF-␬B, probably the most important
transcriptional factor in immune responses of the host, plays important but different roles in response to these three stimulants.
Although NF-␬B is sufficient for the full response to TNF-␣, other
factors contribute to the maximum mTLR2 induction by LPS or
IL-15. Both TNF-␣ and IL-15 are rapidly induced in the early
phase of bacterial infections. Since TLR2 can induce signals by
recognizing a wide variety of bacterial components, the rapid induction of TLR2 will enhance the prompt responses of the host to
bacteria. There are at least 11 members of TLRs in the mouse, and
our preliminary data suggested that the gene expression of at least
2 other members of TLRs, TLR3 and TLR5, were induced by LPS
treatment (T. Matsuguchi, unpublished results). It remains an open
question whether the expression of these TLRs are under the similar control mechanisms to TLR2.
Acknowledgments
We thank K. Itano, A. Kato, and A. Nishikawa for their technical
assistance.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 9. The roles of the STAT-binding element in IL-15-mediated
mTLR2 gene transcription in CTLL-2 cells. A, The cell lysates were prepared from untreated or IL-15-treated CTLL-2 cells. STAT5 immunoprecipitates were separated by SDS-PAGE and blotted with either antiphosphotyrosine or anti-STAT5 Ab. B, The pGL3–384 reporter construct
was cotransfected with STAT5a dominant negative expression plasmid.
The fold induction of luciferase activities by IL-15 is shown. C, CTLL-2
cells were untreated or treated with 10 ng/ml IL-15 for 15 min and the
nuclear extracts were prepared. The competition and supershift assays performed as described in Materials and Methods used STAT5 probe. The
competition results and shifted band are shown.
4523
4524
NF-␬B AND STAT5 REGULATE MOUSE TLR2 GENE EXPRESSION
References
18. Pahl, H. L. 1999. Activators and target genes of Rel/NF-␬B transcription factors.
Oncogene 18:6853.
19. Johnston, J. A., C. M. Bacon, D. S. Finbloom, R. C. Rees, D. Kaplan, K. Shibuya,
J. R. Ortaldo, S. Gupta, Y. Q. Chen, J. D. Giri, et al. 1995. Tyrosine phosphorylation and activation of STAT5, STAT3, and Janus kinases by interleukins 2 and
15. Proc. Natl. Acad. Sci. USA 92:8705.
20. Rehli, M., A. Poltorak, L. Schwarzfischer, S. W. Krause, R. Andreesen, and
B. Beutler. 2000. PU.1 and interferon consensus sequence-binding protein regulate the myeloid expression of the human Toll-like receptor 4 gene. J. Biol.
Chem. 275:9773.
21. Siebenlist, U., G. Franzoso, and K. Brown. 1994. Structure, regulation and function of NF-␬B. Annu. Rev. Cell. Biol. 10:405.
22. Thanos, D., and T. Maniatis. 1995. NF-␬B: a lesson in family values. Cell 80:
529.
23. Ghosh, S., M. J. May, and E. B. Kopp. 1998. NF-␬B and Rel proteins: evolutionarily conserved mediators of immune responses. Annu. Rev. Immunol. 16:
225.
24. Baeuerle, P. A., and D. Baltimore. 1996. NF-␬B: ten years after. Cell 87:13.
25. Baldwin, A. S., Jr. 1996. The NF-␬B and I␬B proteins: new discoveries and
insights. Annu. Rev. Immunol. 14:649.
26. Baeuerle, P. A., and D. Baltimore. 1988. I␬B: a specific inhibitor of the NF-␬B
transcription factor. Science 242:540.
27. Zabel, U., and P. A. Baeuerle. 1990. Purified human I␬B can rapidly dissociate
the complex of the NF-␬B transcription factor with its cognate DNA. Cell 61:
255.
28. Tsai, E. Y., J. V. Falvo, A. V. Tsytsykova, A. K. Barczak, A. M. Reimold,
L. H. Glimcher, M. J. Fenton, D. C. Gordon, I. F. Dunn, and A. E. Goldfeld.
2000. A lipopolysaccharide-specific enhancer complex involving Ets, Elk-1, Sp1,
and CREB binding protein and p300 is recruited to the tumor necrosis factor
alpha promoter in vivo. Mol. Cell. Biol. 20:6084.
29. Boehlk, S., S. Fessele, A. Mojaat, N. G. Miyamoto, T. Werner, E. L. Nelson,
D. Schlondorff, and P. J. Nelson. 2000. ATF and Jun transcription factors, acting
through an Ets/CRE promoter module, mediate lipopolysaccharide inducibility of
the chemokine RANTES in monocytic Mono Mac 6 cells. Eur. J. Immunol.
30:1102.
30. Pan, J., L. Xia, L. Yao, and R. P. McEver. 1998. Tumor necrosis factor-␣- or
lipopolysaccharide-induced expression of the murine P-selectin gene in endothelial cells involves novel ␬B sites and a variant activating transcription factor/
cAMP response element. J. Biol. Chem. 273:10068.
31. Ardeshna, K. M., A. R. Pizzey, S. Devereux, and A. Khwaja. 2000. The PI3
kinase, p38 SAP kinase, and NF-␬B signal transduction pathways are involved in
the survival and maturation of lipopolysaccharide-stimulated human monocytederived dendritic cells. Blood 96:1039.
32. Schmitz, M. L., and P. A. Baeuerle. 1991. The p65 subunit is responsible for the
strong transcription activating potential of NF-␬B. EMBO J. 10:3805.
33. Kunsch, C., S. M. Ruben, and C. A. Rosen. 1992. Selection of optimal ␬B/Rel
DNA-binding motifs: interaction of both subunits of NF-␬B with DNA is required for transcriptional activation. Mol. Cell. Biol. 12:4412.
34. Hirschfeld, M., Y. Ma, J. H. Weis, S. N. Vogel, and J. J. Weis. 2000. Cutting
edge: repurification of lipopolysaccharide eliminates signaling through both human and murine Toll-like receptor 2. J. Immunol. 165:618.
35. Lee, S. J., J. Hou, and E. N. Benveniste. 1998. Transcriptional regulation of
intercellular adhesion molecule-1 in astrocytes involves NF-␬B and C/EBP isoforms. J. Neuroimmunol. 92:196.
36. Ohmori, Y., R. D. Schreiber, and T. A. Hamilton. 1997. Synergy between interferon-␥ and tumor necrosis factor-␣ in transcriptional activation is mediated by
cooperation between signal transducer and activator of transcription 1 and nuclear
factor ␬B. J. Biol. Chem. 272:14899.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
1. Belvin, M. P., and K. V. Anderson. 1996. A conserved signaling pathway: the
Drosophila Toll-dorsal pathway. Annu. Rev. Cell. Dev. Biol. 12:393.
2. Lemaitre, B., E. Nicolas, L. Michaut, J. M. Reichhart, and J. A. Hoffmann. 1996.
The dorsoventral regulatory gene cassette spatzle/Toll/cactus controls the potent
antifungal response in Drosophila adults. Cell 86:973.
3. Rock, F. L., G. Hardiman, J. C. Timans, R. A. Kastelein, and J. F. Bazan. 1998.
A family of human receptors structurally related to Drosophila Toll. Proc. Natl.
Acad. Sci. USA 95:588.
4. Medzhitov, R., P. Preston-Hurlburt, and C. A. Janeway, Jr. 1997. A human homologue of the Drosophila Toll protein signals activation of adaptive immunity.
Nature 388:394.
5. Chaudhary, P. M., C. Ferguson, V. Nguyen, O. Nguyen, H. F. Massa, M. Eby,
A. Jasmin, B. J. Trask, L. Hood, and P. S. Nelson. 1998. Cloning and characterization of two Toll/interleukin-1 receptor-like genes TIL3 and TIL4: evidence
for a multi-gene receptor family in humans. Blood 91:4020.
6. Yang, R. B., M. R. Mark, A. Gray, A. Huang, M. H. Xie, M. Zhang, A. Goddard,
W. I. Wood, A. L. Gurney, and P. J. Godowski. 1998. Toll-like receptor-2 mediates lipopolysaccharide-induced cellular signalling. Nature 395:284.
7. Kirschning, C. J., H. Wesche, T. Merrill Ayres, and M. Rothe. 1998. Human
Toll-like receptor 2 confers responsiveness to bacterial lipopolysaccharide.
J. Exp. Med. 188:2091.
8. Matsuguchi, T., K. Takagi, T. Musikacharoen, and Y. Yoshikai. 2000. Gene
expressions of lipopolysaccharide receptors, Toll-like receptors 2 and 4, are differently regulated in mouse T lymphocytes. Blood 95:1378.
9. Schwandner, R., R. Dziarski, H. Wesche, M. Rothe, and C. J. Kirschning. 1999.
Peptidoglycan- and lipoteichoic acid-induced cell activation is mediated by Tolllike receptor 2. J. Biol. Chem. 274:17406.
10. Yoshimura, A., E. Lien, R. R. Ingalls, E. Tuomanen, R. Dziarski, and
D. Golenbock. 1999. Cutting edge: recognition of Gram-positive bacterial cell
wall components by the innate immune system occurs via Toll-like receptor 2.
J. Immunol. 163:1.
11. Brightbill, H. D., D. H. Libraty, S. R. Krutzik, R. B. Yang, J. T. Belisle,
J. R. Bleharski, M. Maitland, M. V. Norgard, S. E. Plevy, S. T. Smale, et al. 1999.
Host defense mechanisms triggered by microbial lipoproteins through Toll-like
receptors. Science 285:732.
12. Hirschfeld, M., C. J. Kirschning, R. Schwandner, H. Wesche, J. H. Weis,
R. M. Wooten, and J. J. Weis. 1999. Cutting edge: inflammatory signaling by
Borrelia burgdorferi lipoproteins is mediated by Toll-like receptor 2. J. Immunol.
163:2382.
13. Takeuchi, O., K. Hoshino, T. Kawai, H. Sanjo, H. Takada, T. Ogawa, K. Takeda,
and S. Akira. 1999. Differential roles of TLR2 and TLR4 in recognition of Gramnegative and Gram-positive bacterial cell wall components. Immunity 11:443.
14. Matsuguchi, T., T. Musikacharoen, T. Ogawa, and Y. Yoshikai. 2000. Gene
expression of Toll-like receptor 2, but not Toll-like receptor 4, is induced by LPS
and inflammatory cytokines in mouse macrophages. J. Immunol. 165:5767.
15. Schwenzer, R., K. Siemienski, S. Liptay, G. Schubert, N. Peters, P. Scheurich,
R. M. Schmid, and H. Wajant. 1999. The human tumor necrosis factor (TNF)
receptor-associated factor 1 gene (TRAF1) is up-regulated by cytokines of the
TNF ligand family and modulates TNF-induced activation of NF-␬B and c-Jun
N-terminal kinase. J. Biol. Chem. 274:19368.
16. Porter, B. O., and T. R. Malek. 1999. IL-2R␤/IL-7R␣ doubly deficient mice
recapitulate the thymic and intraepithelial lymphocyte (IEL) developmental defects of ␥c⫺/⫺ mice: roles for both IL-2 and IL-15 in CD8␣␣ IEL development.
J. Immunol. 163:5906.
17. McDonald, P. P., M. P. Russo, S. Ferrini, and M. A. Cassatella. 1998. Interleukin-15 (IL-15) induces NF-␬B activation and IL-8 production in human neutrophils. Blood 92:4828.