Myomasp/LRRC39, a Heart- and Muscle-Specific Protein, Is
a Novel Component of the Sarcomeric M-Band and Is
Involved in Stretch Sensing
Rainer D. Will,* Matthias Eden,* Steffen Just, Arne Hansen, Alexandra Eder, Derk Frank,
Christian Kuhn, Thalia S. Seeger, Ulrike Oehl, Stefan Wiemann, Bernhard Korn, Manfred Koegl,
Wolfgang Rottbauer, Thomas Eschenhagen, Hugo A. Katus, Norbert Frey
Rationale and Objective: The M-band represents a transverse structure in the center of the sarcomeric A-band
Downloaded from http://circres.ahajournals.org/ by guest on June 18, 2017
and provides an anchor for the myosin-containing thick filaments. In contrast to other sarcomeric structures, eg,
the Z-disc, only few M-band–specific proteins have been identified to date, and its exact molecular composition
remains unclear.
Methods and Results: Using a bioinformatic approach to identify novel heart- and muscle-specific genes, we
found a leucine rich protein, myomasp (Myosin-interacting, M-band-associated stress-responsive protein)/
LRRC39. RT-PCR and Northern and Western blot analyses confirmed a cardiac-enriched expression pattern,
and immunolocalization of myomasp revealed a strong and specific signal at the sarcomeric M-band. Yeast
2-hybrid screens, as well as coimmunoprecipitation experiments, identified the C terminus of myosin heavy chain
(MYH)7 as an interaction partner for myomasp. Knockdown of myomasp in neonatal rat ventricular myocytes
(NRVCMs) led to a significant upregulation of the stretch-sensitive genes GDF-15 and BNP. Conversely, the
expression of MYH7 and the M-band proteins myomesin-1 and -2 was found to be markedly reduced.
Mechanistically, knockdown of myomasp in NRVCM led to a dose-dependent suppression of serum response
factor– dependent gene expression, consistent with earlier observations linking the M-band to serum response
factor–mediated signaling. Finally, downregulation of myomasp/LRRC39 in spontaneously beating engineered
heart tissue constructs resulted in significantly lower force generation and reduced fractional shortening.
Likewise, knockdown of the myomasp/LRRC39 ortholog in zebrafish resulted in severely impaired heart
function and cardiomyopathy in vivo.
Conclusions: These findings reveal myomasp as a previously unrecognized component of an M-band–associated
signaling pathway that regulates cardiomyocyte gene expression in response to biomechanical stress. (Circ Res.
2010;107:1253-1264.)
Key Words: myocytes 䡲 cardiac 䡲 stretch 䡲 serum response factor 䡲 M-band
T
he sarcomeres of cardiac and skeletal muscle represent
the basic molecular unit for contractile force generation
and transmission.1 The thin filaments of the sarcomere consist
of actin fibers that are crosslinked at the Z-disc, whereas the
thick filaments, mainly composed of myosin molecules, are
attached to the M-band, which provides lateral stabilization.2
Beyond a mere mechanical function, these crucial subsarcomeric structures and their molecular components have been
implicated in the regulation of the dynamics of muscle
contraction and the sensing of cardiomyocyte stress.3,4 Moreover, the sarcomeric Z-disc, as well as the M-band, has
increasingly been recognized as a hub for signaling pathways
that mediate diverse intracellular processes including cell
growth and differentiation, as well as protein turnover and
gene expression.2,4 – 6 At the level of the sarcomeric Z-disc,
the conversion of structural and mechanical demands to gene
transcription is mediated by several specific pathways, including calcium-dependent signaling via the calcineurin-
Original received April 18, 2010; revision received August 31, 2010; accepted September 2, 2010. In August 2010, the average time from submission
to first decision for all original research papers submitted to Circulation Research was 13.2 days.
From the Department of Internal Medicine III (R.D.W., M.E., S.J., D.F., T.S.S., U.O., W.R., H.A.K.), University of Heidelberg; Department of
Cardiology (M.E., C.K., N.F.), University Hospital Schleswig-Holstein, Campus Kiel, Germany; Department of Experimental and Clinical Pharmacology
(A.H., A.E., T.E.), University Medical Center Hamburg-Eppendorf, Hamburg; Department of Internal Medicine II (W.R.), University Hospital Ulm; and
Department of Molecular Genome Analysis (S.W.) and Department of Genomic and Proteomics Core Facilities, Protein Interaction Screening (B.K.,
M.K.), German Cancer Research Heidelberg, Germany.
*Both authors contributed equally to this work.
Correspondence to Dr Norbert Frey, Professor of Internal Medicine and Cardiology, Department of Cardiology and Angiology, University Hospital
Schleswig-Holstein, Campus Kiel, Schittenhelmstr. 12, 24105 Kiel, Germany. E-mail [email protected]
© 2010 American Heart Association, Inc.
Circulation Research is available at http://circres.ahajournals.org
DOI: 10.1161/CIRCRESAHA.110.222372
1253
1254
Circulation Research
November 12, 2010
Non-standard Abbreviations and Acronyms
Downloaded from http://circres.ahajournals.org/ by guest on June 18, 2017
BNP
EST
FBME
GDF
GFP
ifu
LRRC
miNeg
MO
MURF
MYBP
MYH
MYOM
NFAT
NRVCM
SRF
brain natriuretic peptide
expressed sequence tag
fibrin-based mini-engineered heart tissues
growth differentiation factor
green fluorescent protein
infectious unit
leucine-rich repeat-containing protein
scrambled microRNA
morpholino
muscle-specific ring finger
myosin-binding protein
myosin heavy chain
myomesin
nuclear factor of activated T cells
neonatal rat ventricular myocyte
serum response factor
brafish resulted in reduced contractility, cardiomyopathy, and
disturbed ultrastructural M-band architecture, consistent with
the notion that this novel M-band component plays an
essential role in cardiac function and integrity.
Methods
Detailed descriptions of the experimental procedures for cloning and
the subsequent bioinformatics, Northern blot analysis, Western blot
analyses, immunofluorescence, yeast 2-hybrid assays, tissue culture,
immunoprecipitations, and reporter gene assays, as well as zebrafish
injection procedures, fractional shortening measurement, generation
of engineered heart tissues, video optical analysis, microarray
hybridizations, and transverse aortic constriction are provided in the
expanded Methods section, available in the Online Data Supplement
at http://circres.ahajournals.org.
Statistical analyses of the data were carried out using ANOVA
followed by Student–Newman–Keuls post hoc tests. If appropriate,
Student’s t test was used (2-sided, assuming similar variances).
Probability values of ⬍0.05 were considered statistically significant.
Results
Myomasp/LRRC39 Is an Evolutionarily Conserved
Cardiac Protein
NFATc pathway,7–9 extracellular signal-regulated kinase 2,10
protein kinase C,11 and the ubiquitin modification machinery
(eg, via MURF-ligases).12,13 More recently, the sarcomeric
M-band has also been shown to play a critical role in
mechanotransduction. Gautel and colleagues were able to
show that an M-band signaling complex, consisting of titin,
Nbr1, p62, and MURF2 mediates gene expression and muscle
protein turnover in response to biomechanical stress via
nuclear translocation of the transcription factor SRF.14 The
physiological and pathophysiological importance of Z-disc
and M-band proteins is further underscored by the fact that
both subsarcomeric structures represent hot spots for inherited human cardiomyopathy and/or muscular dystrophy.15,16
Although several components of the M-band have already
been identified years ago, including specific titin domains,17
the myomesin-1, -2, and -3,18 –20 and obscurin,5 its exact
molecular composition is still not completely resolved. Moreover, the small number of known M-band proteins suggests
that additional components are yet to be discovered.
Thus, in an effort to identify novel sarcomeric proteins, we
searched expressed sequence tag (EST) databases for previously uncharacterized genes with high abundance in cardiac
and muscle cDNA libraries. Using this bioinformatic approach, we found an open reading frame encoding for a
335-aa protein “LRRC39,” which we termed myomasp
(Myosin-interacting, M-band-associated stress-responsive
protein). Here, we show that myomasp/LRRC39 is a highly
cardiac-enriched protein that localizes to the sarcomeric
M-band and directly binds to the C-terminal tail domain of
myosin heavy chain (MYH)7. Knockdown of myomasp/
LRRC39 expression in cardiomyocytes results in the inhibition of SRF-dependent signaling and significant downregulation of MYH7 mRNA other M-band proteins such as
myomesin-1 and -2. Conversely, the expression of stressresponsive genes such as GDF-15 and brain natriuretic
peptide (BNP) is markedly induced on myomasp ablation.
Finally, in vivo knockdown of myomasp/LRRC39 in ze-
In an effort to identify previously unknown cardiac- and
muscle-enriched genes, we searched the EST databases for
uncharacterized sequences predominantly found in cardiac
cDNA libraries.21 The data extraction mainly relied on the
T-STAG (Tissue-Specific Transcripts and Genes; http://tstag.
molgen.mpg.de) and the Unigene (National Center for Biotechnology; http://www.ncbi.nlm.nih.gov/unigene) databases.
Several of the identified ESTs corresponded to the human
Unigene cluster Hs.44277 or the Rattus norvegicus Unigene
cluster Rn.79735. ESTs in these clusters were significantly
enriched for heart and muscle compared with all other tissues.
The resulting NCBI Reference Sequences (NM_144620.2
[human] or NM_001109637.1 [rat]) were used as templates
for the design of primers for the amplification of the complete
open reading frames, which encode for a novel 335-aa
(human)/334-aa (rat) leucine-rich protein with a calculated
molecular mass of 38.8 kDa (human)/38.7 kDa (rat), respectively. Interestingly, 6 leucine-rich repeat motifs (LRR/
LRR_TYPE) were identified in the protein sequence, placing
myomasp into the LRR_RI superfamily (Figure 1A). A
protein sequence alignment between the putative human,
mouse, rat, and zebrafish protein homologs revealed high
evolutionary sequence conservation among species (Figure
1B). Molecular cloning of human (NM_144620.2), murine
(NM_027321.3), and rat (NM_001109637.1) myomasp
complete open reading frames confirmed the predicted
amino acid sequences. Of note, myomasp is identical to a
largely uncharacterized protein termed LRRC39, identified
by Uchida et al in a screen for cardiac-enriched genes with
unknown function.22
Myomasp/LRRC39 Is Predominantly Expressed in
Heart and Skeletal Muscle
To confirm the predicted expression pattern of myomasp/
LRRC39 (Figure 2A, left) in different human tissues, we
performed quantitative real-time PCR experiments using
cDNAs from multiple human tissues and myomasp/LRRC39specific probes and primers (Figure 2A, right). Similar to the
Will et al
Myomasp/LRRC39, a Novel Sarcomeric M-Band Protein
1255
Downloaded from http://circres.ahajournals.org/ by guest on June 18, 2017
Figure 1. Myomasp/LRRC39 protein
motifs and protein alignment. A, Prediction of a “coiled-coil” domain, as well
as 6 leucine-rich repeat motifs (LRR/LRR_TYPE) in myomasp/LRRC39 by the
smart protein domain prediction program
(http://smart.embl-heidelberg.de). Myomasp/LRRC39 contains 1 typical and 5
atypical leucine-rich repeat domains. B,
Protein sequence alignment between
human (NP_653221), mouse
(NP_780622), rat (NP_001103107), and
zebrafish (NP_001017760) myomasp/
LRRC39 shows high conservation
among species, as indicated by the
black bars above the calculated consensus sequence.
calculated pattern, a strong expression in heart and skeletal
muscle was observed, whereas other tissues revealed no
significant signal. Consistently, hybridization of myomasp/
LRRC39-specific cDNA probes with human or mouse multiple tissue Northern blots confirmed heart- and skeletal
muscle–specific gene expression of both human and murine
myomasp/LRRC39 (Figure 2B). Compared to quantitative
real-time PCR (Figure 2A), the Northern blot analyses
revealed a higher myomasp/LRRC39 expression in the
heart than skeletal muscle tissue in mice (Figure 2B). To
also analyze the expression of myomasp/LRRC39 on the
protein level, a Western blot of several rat tissues extracts
was probed with a polyclonal antibody against myomasp/
LRRC39. Myomasp/LRRC39- and control-transfected
HEK-293T cells served as positive and negative controls,
respectively. Again, these experiments revealed a strong
expression of myomasp/LRRC39 protein in rat heart and
skeletal muscle tissue at the predicted size of ⬇39 kDa
(Figure 2C). In addition to the expression pattern on RNA
level, Western blot experiments also revealed a distinct
protein expression in the kidneys.
Myomasp/LRRC39 Interacts With Myosin
Heavy Chains
To identify potential protein interaction partners for myomasp/LRRC39, we performed yeast 2-hybrid experiments
and screened human heart- and skeletal muscle– derived
cDNA libraries. Among several potentially myomaspinteracting proteins, we found multiple clones encoding for
the C termini of different myosin heavy chain genes (MYH1,
MYH2, MYH6, MYH7) (Figure 3A). To confirm the interaction between MYH7 and myomasp/LRRC39, we conducted coimmunoprecipitation experiments in eukaryotic
HEK-293T cells. These cells were transiently cotransfected
with HA-tagged full-length myomasp/LRRC39, together with
Myc-tagged full-length MYH7 or the respective empty vector
controls. Results revealed an intense coprecipitation of myomasp with MHY7, whereas no specific band was observed
with empty vector alone (Figure 3B). To map the myomasp/
LRRC39-interacting domain of MYH7, we tested several
MYH7 clones with different lengths for interaction with
myomasp/LRRC39 in yeast. This experiment was of particular interest, because sarcomeric myosins are known to have
1256
Circulation Research
November 12, 2010
Downloaded from http://circres.ahajournals.org/ by guest on June 18, 2017
Figure 2. Cardiac- and skeletal muscle– enriched expression
pattern of human and mouse myomasp/LRRC39. A and B,
EST database–predicted muscle- and heart-enriched mRNA
expression profile (left) confirmed by quantitative RT-PCR
(right) (A) and additional Northern blot analyses (B) of multiple
human and mouse tissues using myomasp/LRRC39-specific
probes and primers. C, Western blot analysis of myomasp/
LRRC39 in rat tissue extracts again confirmed the heart- and
muscle-enriched expression and detects an additional band in
kidney.
an A-band localized head and neck region, responsible for
actin–myosin interaction, and a C-terminal tail region
crosslinked at the sarcomeric M-band.23 These mapping
studies revealed that myomasp/LRRC39 interacts with the
C-terminal 282 amino acids of MYH7, consistent with the
notion that myomasp/LRRC39 could be involved in regulating and/or anchoring myosin heavy chain molecules at the
sarcomeric M-band (Figure 3C).
Myomasp/LRRC39 Is a Novel Component of the
Sarcomeric M-Band
Given the high expression levels of myomasp/LRRC39 in the
myocardium and the protein–protein interaction with MYH7,
we next aimed to determine its subcellular localization in
isolated adult rat cardiomyocytes. A strong signal was detected at the sarcomeric M-band, as shown by coimmunostaining with a well-characterized N2A M-band–specific titin
antibody (Figure 4A).24 Consistently, simultaneous staining
of myomasp/LRRC39 with the Z-disc–specific calsarcin-1
antibody25 revealed no overlapping fluorescence pattern,
excluding a sarcomeric Z-disc localization for myomasp/
LRRC39 (Figure 4A). Likewise, A-band staining was investigated with a MYBPC3 antibody, because MYBPC3 has
been shown to bind to the myosin subfragment-2 (S2) neck
Figure 3. Myomasp/LRRC39 interacts with MYH7. A, Protein
fragments of myosin heavy chain genes interacting with fulllength myomasp/LRRC39 identified by yeast 2-hybrid screening
with appropriate controls. B, Confirmation of the interaction
between MYH7 and myomasp/LRRC39 by coimmunoprecipitation of the full-length proteins in eukaryotic cells. C, Identification of the minimal interaction domain of MYH7 with using the
yeast 2-hybrid system. The minimal domain necessary for the
interaction between myosmasp/LRRC39 and MYH7 could be
mapped to C-terminal amino acids 1653 to 1935, which link the
protein to the sarcomeric M-band.
region with its C terminus26 and to localize to the sarcomeric
A-band.27 Simultaneous staining of MYBPC3 and myomasp/
LRRC39 excluded an A-band localization of myomasp/
LRRC39 (Figure 4A). In line with the subcellular localization
in ARVCM, cryosections of intact rat heart and skeletal
muscle tissues again revealed a sarcomeric M-band signal for
myomasp (Figure 4B) and colocalization with the M-band–
specific titin N2A domain (Figure 4B). Taken together, these
data reveal that myomasp/LRRC39 is a novel component of
the sarcomeric M-band.
Myomasp/LRRC39 Knockdown Reveals
Differential Regulation of Sarcomeric and
Stretch-Responsive Genes
The sarcomeric M-band has previously shown to be a hub for
signaling molecules involved in cardiomyocyte gene regulation.14 To test whether myomasp/LRRC39 participates in the
regulation of gene expression as well, we devised a knockdown experiment in neonatal rat cardiomyocytes, using an
Will et al
Myomasp/LRRC39, a Novel Sarcomeric M-Band Protein
1257
Downloaded from http://circres.ahajournals.org/ by guest on June 18, 2017
Figure 4. Myomasp/LRRC39 localizes
to the sarcomeric M-band. A, Immunofluorescence analysis of myomasp/
LRRC39 expression in isolated adult rat
cardiomyocytes (ARCMs). By coimmunostaining myomasp/LRRC39 and
M-band–specific titin-N2-A17 in ARCMs,
myomasp/LRRC39 could by localized to
the sarcomeric M-band. Additional staining of the Z-disc or the A-band could be
excluded by the absence of coimmunofluorescence with calsarcin-1 (Z-disc)
and MYBPC3 (A-band). B, Consistent
with the localization in ARCMs, staining
of intact rat heart and skeletal muscle
cryosections with myomasp/LRRC39
and titin-N2-A antibody showed colocalization at the sarcomeric M-band. Scale
bar, 20 ␮m.
adenovirally encoded synthetic microRNA (miMyomasp).
Knockdown efficiency was ⬎85% compared with an appropriate control virus expressing scrambled microRNAs
(miNeg) (Online Figure II). Seventy-two hours after viral
infection total RNA was isolated, and after quality control,
amplification, and labeling, the cRNA was subsequently
hybridized on Illumina Rat Sentrix-12 BeadChips. For comparison of the expression profile of myomasp/LRRC39
knockdown cardiomyocytes and control cells, the acquired
data were processed and analyzed with Illumina Bead studio
software. The distribution of the normalized differentially
expressed genes (⬎4-fold) of 3 miMyomasp knockdown
samples compared with 3 miNEG controls is shown in Online
Figure I, A. Only those genes with a probability value of
⬍0.005, which were up- or downregulated ⬎4-fold and
showing an array SD of ⬎5-fold and a bead SD of ⬎4-fold
were taken into account for further analysis. By applying
these selection criteria, 367 genes were found to be differentially expressed. A total of 129 genes were found to be
upregulated after miMyomasp knockdown, whereas 238
showed a significant downregulation. The normalized data of
the 367 genes that fulfilled the selection criteria are displayed
in a heat map for each sample (Online Figure I, A). Hierarchical clustering between the sample groups revealed highly
reproducible results and low variance (Online Figure I, B).
Because myomasp/LRRC39 localizes to the M-band and
interacts with MYH7, we focused our interest on the regulation of M-band–associated proteins. Of note, the microarray
analyses of myomasp/LRRC39-deficient cardiomyocytes
showed a highly significant reduction of MYH7B (⫺25.6fold), as well as the M-band proteins myomesin 1 (⫺4.5-fold)
and myomesin 2 (⫺18.8-fold) compared with NRVCMs
infected with miNeg (Online Figure I, C). The downregulation of myomesin 1 and myomesin 2 was subsequently
confirmed by quantitative real-time PCR experiments (Figure
5A). Knockdown of myomasp/LRRC39 led to a significant
38.4% reduction of myomesin 1 (P⬍0.01) and 44.7% reduction of myomesin 2 expression, respectively (P⬍0.01). Likewise, MYH7B mRNA was found to be a significantly
downregulated (⫺37%, P⬍0.05; Figure 5B). In contrast, the
1258
Circulation Research
November 12, 2010
Downloaded from http://circres.ahajournals.org/ by guest on June 18, 2017
Figure 5. Myomasp/LRRC39 knockdown reveals differential regulation of
sarcomeric and stretch-responsive
genes. A, Real-time PCR analysis of the
M-band–stabilizing proteins myomesin 1
and myomesin 2 after adenovirusmediated myomasp/LRRC39 knockdown
in NRVCMs revealed a significant 38.4%
reduction of myomesin-1 (P⬍0.01) and
44.7% reduction of myomesin-2
(P⬍0.01) mRNA expression, respectively.
B, Conversely, MYH7B mRNA and the
stretch-sensitive marker gene BNP were
analyzed and showed a significant
downregulation of MYH7B, whereas a
marked upregulation of BNP mRNA
expression levels could be observed
(⫺37%, P⬍0.05 for MYH7, and 6.3-fold
increase for BNP, P⬍0.01, respectively).
C, Conversely, the stretch-sensitive
marker gene GDF-15 showed a marked
upregulation of mRNA expression levels
(6.3-fold, P⬍0.001). Right, Representative immunoblot with an upregulation of
GDF-15 after adenoviral-mediated
knockdown of myomasp/LRRC39.
stretch-sensitive marker gene BNP revealed a marked upregulation of (6.3-fold increase, P⬍0.001; Figure 5B). Remarkably, one of the genes that displayed the most dramatic
differential regulation (23.7-fold induction; Online Figure I,
C) was the stress- and stretch-sensitive marker GDF15.28,29
The significant upregulation of GDF15 could be confirmed
by quantitative real-time PCR and Western blot experiments
(5.7-fold, P⬍0.01; Figure 5C). Because both GDF-15 and
BNP are highly sensitive to mechanical stress,28 –30 we asked
whether myomasp/LRRC39 expression itself is also regulated
in an in vitro model for stretch of cardiomyocytes (Figure
6A). Interestingly, static biaxial stretch of NRVCM for 24
hours led to a significant reduction in myomasp/LRRC39
mRNA expression (⫺78%, P⬍0.001). To further substantiate
this finding, we analyzed C57BL6 mice which underwent
transverse aortic constriction for 4 weeks (n⫽11) and compared them to sham-operated littermates (n⫽12; Figure 6B).
Consistently, transverse aortic constriction in mice led also to
a highly significant cardiac downregulation of myomasp/
LRRC39 mRNA, as assessed by quantitative real-time PCR
analysis (P⬍0.001).
Thus, downregulation of myomasp leads to suppression of
the expression of other M-band–associated proteins including
myomesin1 (MYOM1) and myomesin 2 (MYOM2). Conversely, myomasp deficiency results in the induction of the
stretch-responsive genes BNP and GDF15. The marked
downregulation of endogenous myomasp mRNA expression
on biomechanical stress implies a role for myomasp/LRRC39
in the stretch signaling cascade.
Downregulation of Myomasp/LRRC39 Inhibits
SRF-Dependent Signaling
It has previously been suggested that sarcomeric M-band
proteins participate in the cardiomyocyte response to biomechanical stress via modulation of SRF-dependent signaling
pathways.14 Thus, we tested the hypothesis that myomasp/
LRRC39 might also participate in SRF-dependent transcriptional regulation. By measuring luciferase activity of
NRVCMs coinfected with a reporter adenovirus (Ad) expressing luciferase under control of the SRF-responsive sm22
promotor (Figure 6C), we could show a significant and
dose-dependent reduction of SRF activity on microRNAmediated myomasp knockdown (⫺37.8% at 90 infectious
units [ifu]; P⬍0.001; Figure 6D and 6E). Taken together,
these data imply that myomasp/LRRC39 is involved in the
regulation of M-band proteins via modulation of SRFdependent gene expression.
Functional Consequences of Myomasp/LRRC39
Knockdown In Vitro
To elucidate the functional consequences of myomasp/
LRRC39 downregulation on cardiomyocyte contraction and
force generation, we used fibrin-based mini-engineered heart
tissues (FBMEs) prepared as described in detail in the Online
Methods section (Figure 7A). After 6 days of culture, FBMEs
Will et al
Myomasp/LRRC39, a Novel Sarcomeric M-Band Protein
1259
Downloaded from http://circres.ahajournals.org/ by guest on June 18, 2017
Figure 6. Myomasp/LRRC39 is downregulated
on biomechanical stress and mediates SRFdependent signaling. A, Quantitative real-time
PCR analysis of endogenous myomasp/LRRC39
expression in stretched NRVCMs revealed a significant downregulation of endogenous myomasp/
LRRC39 mRNA (⫺78%, P⬍0.001). B, Consistently,
quantitative real-time PCR analysis of endogenous
myomasp/LRRC39 mRNA in n⫽11 wild-type
C57BL6 mice, subjected to transverse aortic constriction, compared with n⫽12 sham-operated littermates revealed a significant downregulation of
myomasp/LRRC39 (⫺39%, P⬍0.001). C, Schematic composition of the SRF-responsive sm22
promotor construct. D, Evaluation of the maximal
SRF-responsive sm22 promotor activity under the
experimental settings shows a significant induction
on FCS treatment (5-fold, P⬍0.0001). E, Luciferase
assay of SRF-responsive sm22 promotor activity
after FCS stimulation and adenoviral knockdown
of myomasp in NRVCMs reveals a significant and
dose-dependent reduction of promoter activity
(⫺37.8% at 90 ifu, P⬍0.001).
where infected with 50-ifu AdmiMyomasp or 50-ifu control
virus (AdmiNeg). After development of a spontaneous and
synchronous beating pattern (8 to 10 days), force generation
and fractional shortening of FBMEs were measured by video
optical recordings on days 18 to 20. Infection efficiency and
viral penetration of engineered heart tissue constructs was
visually controlled by green fluorescent protein (GFP) expression (Figure 7B). FBMEs infected with 50-ifu AdmiMyomasp showed a significant reduction in force generation (70
versus 120 mN, P⬍0.002, at a calcium concentration of
0.5 mmol/L; 100 mN versus 160 mN, P⬍0.05, at 1.5 mmol/L
calcium) and markedly impaired fractional shortening (4%
versus 7%, P⬍0.005, at 0.5 mmol/L calcium; 6% versus 8%,
P⬍0.05, at 1.5 mmol/L calcium content) compared with
FBMEs infected with control virus (Figure 7C and 7D).
Representative measurements and corresponding FBMEs are
shown in Figure 7E (AdmiNeg) and Figure 7F (AdmiMyomasp), respectively.
Functional Consequences of a Myomasp/LRRC39
Knockdown In Vivo
To further elucidate myomasp/LRRC39 function in vivo, we
injected zebrafish embryos with morpholino (MO)-modified
antisense oligonucleotides directed against the splice donor
site of intron 2 of zebrafish myomasp/LRRC39. When
injected with 4 ng of MO-Myomasp, 76.9% of injected
embryos (n⫽267) (Figure 8A) revealed severe contractile
dysfunction (Figure 8B; Online Movie 1), whereas heart
function of embryos injected with a standard control MO was
completely unaltered (Figure 8B; Online Movie 2). In myomasp morphants, ventricular and atrial fractional shortening
significantly decreased to 6% and 11.6%, respectively (Figure 8C and 8D). Hence, to evaluate whether myomasp
deficiency interferes with key steps of zebrafish heart development and thereby leads to the observed heart failure
phenotype, we examined expression of cardiac chamber–
specific proteins and mRNAs by immunostainings and antisense RNA in situ hybridization, respectively, as well as
cardiac structure of myomasp morphants by histology. We
found that loss of myomasp function does not interfere with
crucial steps of cardiogenesis, such as heart tube looping,
chamber demarcation, and the differentiation of ventricular
and atrial cardiomyocytes (Figure 8E). Additionally, expression of cardiac genes such as the cardiac myosin light chain
(cmlc2) and chamber-specific myosin heavy chains (vmhc,
amhc, MF20, S46) were found to be expressed in the correct
1260
Circulation Research
November 12, 2010
Downloaded from http://circres.ahajournals.org/ by guest on June 18, 2017
Figure 7. Knockdown of myomasp/
LRRC39 impairs force generation in
spontaneously beating FBMEs. A,
Example of FBME constructs after 16
days of culture. B, GFP fluorescence
image of a representative FBME after
infection with a GFP-tagged adenovirus
(50 ifu), carrying a synthetic microRNA
against myomasp (miMyomasp). C,
Reduction of force generation (0.07 vs
0.12 mN, P⬍0.002) and fractional shortening (4% vs 7%, P⬍0.005) in
miMyomasp-infected FBMEs compared
with control virus (miNeg) at low CaCl2
concentrations (0.5 mmol/L). D, Reduction of force generation (0.10 versus 0.16
mN, P⬍0.05) (left) and fractional shortening (6% vs 8%, P⬍0.05) (right) in
miMyomasp-infected FBMEs compared
with miNeg-infected controls at higher
CaCl2 concentrations (1.5 mmol/L). Representative force measurement (left) and
corresponding photography (right) of
miNeg-infected spontaneous beating
FBMEs (E) and miMyomasp-infected
FBMEs (F), buffered with 1.5 mmol/L
CaCl2.
heart chamber–restricted pattern and in normal amounts,
demonstrating that myomasp deficiency does not lead to the
misexpression of these contractile proteins or severe alteration in cardiogenesis, as observed in several other heart
failure zebrafish mutants.31–33
To further assess whether impaired cardiomyocytes cytoarchitecture accounts for the contractile dysfunction of
myomasp-deficient zebrafish embryos, we analyzed the ultrastructure of cardiac muscle cells by transmission electron
microscopy. At 72 hours postfertilization, myomasp-deficient
morphants show no clear ultrastructural defects in cardiac
sarcomeres; however, no mature M-Band was definable
neither in myomasp-deficient morphants nor in control MOinjected zebrafish. In contrast, deficiency of myomasp/
LRRC39 leads to a marked narrowing of the skeletal muscle
M-band accompanied “bare zone.” This A-band/M-band
transition also appears “fuzzier” as compared with control
MO-injected zebrafish. Other sarcomeric structures of
myomasp-deficient morphants appeared completely unaltered. Arrays of thin myofilaments, as well as Z-discs, were
found to be regular. Furthermore, the content and morphology of other cardiomyocytes components such as mitochondria and cell nuclei also appeared unaffected by the loss of
myomasp function (Figure 8F).
Discussion
Here, we provide the detailed molecular characterization of a
highly cardiac- and skeletal muscle– enriched protein, termed
myomasp/LRRC39. Myomasp is a novel component of the
sarcomeric M-band and is involved in SRF-dependent transcription and stress-responsive signaling. Moreover, myo-
Will et al
Myomasp/LRRC39, a Novel Sarcomeric M-Band Protein
1261
Downloaded from http://circres.ahajournals.org/ by guest on June 18, 2017
Figure 8. MO knockdown of zebrafish
myomasp/LRRC39 results in severe
contractile dysfunction and sarcomeric
defects. A, Myomasp morphants (bottom, lateral view) develop pericardial
edema and blood congestion because of
low cardiac performance. By contrast,
cardiac function of MO-control–injected
zebrafish embryos is unaffected (top, lateral view). B, Seventy-six percent of
wild-type embryos injected with
MO-myomasp display severe contractile
dysfunction. Injection of MO-myomasp
results in an abnormal splice product
(intron integration, 371 bp), leading to
premature termination of translation of
zebrafish myomasp. The asterisk (*)
marks an unspecific PCR product. C and
D, Fractional shortening (FS) of the ventricular (C) and atrial (D) chamber of
wild-type and myomasp-deficient
embryos measured at different developmental stages (48 and 72 hours postfertilization [hpf]). Ventricular and atrial FS of
myomasp morphants markedly
decreases over time. E, At 48 hours
postfertilization, the expression of cardiac
myosin proteins (MF20/S46), as well as
mRNA expression of cardiac myosin light
chain 2 (cmlc2), atrial myosin heavy chain
(amhc), and ventricular myosin heavy
chain (vmhc), is unaffected by the loss of
myomasp function, as revealed by
whole-mount immunostaining and antisense RNA in situ hybridization. Endocardial and myocardial cell layers are also
unaltered in myomasp morphant
zebrafish embryos, indicating no severe
changes in cardiogenesis. In summary,
histological analysis of zebrafish
MO-myomasp knockdown showed no
obvious alterations of cardiac structures.
A indicates atrium; en, endocardium; my,
myocardium; V, ventricle. F, Ultrastructural analysis of heart and skeletal muscle tissues in myomasp morphant
zebrafish embryos. Left, No clear ultrastructural defect in cardiac sarcomeres of
myomasp-deficient morphants; however,
no mature M-Band architecture was
definable neither in knockout nor in control zebrafish. In high-resolution and
high-magnification EM images, knockdown of myomasp/LRRC39 leads to sarcomere defects with narrowing of the skeletal muscle
M-band/A-band transition (“bare-zone,” indicated by white arrows). The M-Band to A-Band transition also appears fuzzier.
masp/LRRC39 is required for proper cardiac function both in
vitro and in vivo.
Myomasp/LRRC39, a Leucine-Rich
Repeat Protein
Myomasp/LRRC39 contains a coiled-coil domain and 6
leucine-rich repeat domains and is highly conserved among
species. Although we could not detect any closely related
proteins in the database, leucine-rich repeat motifs are found
in an increasing number of newly discovered proteins with
diverse cellular functions, including cell adhesion, signal
transduction, and regulation of gene expression.34 The primary function of the leucine-rich repeat domain is believed to
provide a structural framework for protein–protein interactions.34 In 2007, Kim et al were the first to give insight into
the importance of a muscle-specific, leucine-rich– containing
protein, LRRC10.35 Using zebrafish as an in vivo model, they
demonstrated that LRRC10-defective morphants showed severe morphological and functional defects, including heart
looping failure and decreased ejection fraction and cardiac
output, as well as early embryonic lethality. Yet, the underlying mechanisms and potential signaling pathways regulated
by LRRC10 still remain unclear.
Myomasp/LRRC39 Is a Novel Sarcomeric
M-Band Protein
In contrast to LRRC10, which is localized to T-tubuli and the
Z-disc,35,36 myomasp/LRRC39 is exclusively detected at the
sarcomeric M-band. Traditionally, the M-band has been
viewed as a transverse structure providing mechanical an-
1262
Circulation Research
November 12, 2010
Downloaded from http://circres.ahajournals.org/ by guest on June 18, 2017
choring and alignment of the thick filaments of the sarcomere. Data from several studies indicate that regular M-band
assembly is needed for proper packing of the thick filaments
with appropriate distances to the thin filaments at the onset of
contraction (termed “M-bridges”).37,38 A critical component
in this model is the giant protein titin, which extends from the
thin filaments at the Z-discs to the thick filaments at the
M-band, thus providing mechanical cross-stabilization and
adjustment of force imbalances between the filaments.39
Interestingly, the assembly and morphology of M-bands is
variable in different muscle fibers.5 Fast muscle types have a
3-line M-band pattern; M1, -2, -4; whereas slow muscle cells
show a 4-line pattern; M1, -2, -4, -6. In addition to titin, 2
other components of the M-band are thought to function as
M-bridges, myomesin 1 and myomesin 2. Both proteins are
aligned in antiparallel dimers to the central zone of myosins
(M1 line) and to the C-terminal region of titin (M4 line). The
nature of the M-line– bordering bare zone and the M6⬘/M6
lines are not known at present.40 Differential expression
levels of mature myomesin and an alternatively spliced
embryonic (“EH”)-myomesin isoform (initially described as
skelemin) are thought to contribute to specific functional and
structural features of different muscle types and developmental stages.19,41,42 For example, a decreased amount of myomesin 2 in slow muscle fibers results in an increase of titin
compliance43 and “fuzzy” sarcomeres. In contrast, fast muscle fibers display the highest content of mature myomesin and
the lowest EH-myomesin level associated with a high order
of M-band organization. Fast-type fibers therefore are
thought to have the highest force generation capacity,
whereas fuzzy, embryonic sarcomeres reveal less contractile
efficiency but instead gain passive mechanical stability.43 In
this context, we could show that knockdown of myomasp/
LRRC39 results in a significant reduction of myomesin 1 and
-2 gene expression, which may explain the reduced force
generation of myomasp-depleted engineered heart tissue and
zebrafish hearts. Moreover, we could identify the C-terminal
rod domain of MYH7 as an interacting partner for myomasp/
LRRC39, thus representing a direct link to an important
M-band structure. Of note, it has been shown that myomesins
bind to both myosin44 and titin45 at the sarcomeric M-band.
One might speculate that the knockdown of myomasp/
LRRC39 may lead to a decrease in M-band crosslinking and
stability and a reduced adaptive capacity to force imbalances
or stretch, which may have led to an activation of stretchresponsive genes such as BNP and GDF-15.
A Role for Myomasp/LRRC39 in Biomechanical
Stress Signaling?
Recently, a direct role for the M-band in intracellular signaling processes and mechanotransduction is emerging,14 providing another potential link between impaired M-band composition and altered cardiomyocyte gene expression. In this
context, we observed a significant downregulation of endogenous myomasp/LRRC39 in stretched cardiomyocytes, a well
characterized model in which an upregulation of BNP and
GDF15 has already been shown.28 This finding was further
corroborated by analyzing C57BL6 mice which underwent
transverse aortic constriction. In this in vivo model we also
observed a significant downregulation of endogenous myomasp/LRRC39 mRNA, further supporting the notion that
myomasp is involved in biomechanical stress signaling.
Moreover, not the only the structural composition of the
M-band may play a role in stretch sensing but the M-band
itself could serve as a nodal point in signaling. In agreement
with this hypothesis, Gautel and colleagues14 were able to
show that mechanical stress leads to force-induced conformational changes in the kinase domain of titin. The activation
of the kinase by stretch facilitates its interaction with Nbr1
and p62, followed by the binding of the ubiquitin ligase
MURF-2. MURF-2 in turn interacts with the transcription
factor SRF to inhibit its nuclear localization and thus its
transcriptional activity. As a result the prohypertrophic response elicited by mechanical forces is attenuated.14 Similarly, we observed a suppression of SRF activity in cardiomyocytes on administration of increasing doses of myomasp/
LRRC39 knockdown virus. The suppression of SRFdependent transcription by downregulation of myomasp/
LRRC39 might at least partly explain the reduced expression
of myomesins and myosins as these genes are known to
contain SRF-responsive CArG boxes in their promoter region.46 Yet, it is likely that competing signaling pathways
exist because, for example, cardiac actin was not differentially regulated (data not shown).
Moreover, proper and stoichiometric protein composition
of the M-band during stretch is needed to ensure a quick
reaction to changes in sarcomeric force and/or enhanced
stiffness/reduced compliance.5 Thus, an impaired M-band
composition may induce stress-responsive pathways, independently of any direct effects on SRF signaling. Our data support
a model where artificial myomasp knockdown in vitro partly
mimics these effects of stretch, leading to the observed induction
of immediate responsive genes like BNP and GDF-15.
Finally, the fact that myomasp-null zebrafish morphants
show ultrastructural M-band alterations with a marked reduction of the A-band/M-band transition zone (bare zone) supports the concept that subtle structural perturbations may contribute to the observed functional defects. Regardless of the
precise mechanism, our data underline the importance of proper
M-band composition in general, and myomasp/LRRC39 expression in particular, in proper cardiomyocyte function.
Myomasp/LRRC39 As a Candidate Gene
for Cardiomyopathy
Another important aspect with possible regulatory function is
the protein-protein interaction between myomasp/LRRC39
and myosin/MYH7. MYH7 is connected to the M-band via its
interaction with myomesin at the A-band/M-band transition
zone.47– 49 Mutations in the MYH7 gene are commonly found
in patients experiencing hypertrophic and dilated cardiomyopathy.50,51 Most of these mutations affect the globular head
region of the myosin molecule. In contrast, MYH7 mutations
associated with skeletal muscle myosin storage myopathy
with and without cardiomyopathy have almost exclusively
been identified in the MYH7 C-terminal rod domain.52,53
Myomasp/LRRC39 directly interacts with the C-terminal
coiled-coil myosin heavy chain tail region of MYH7. In
addition, loss of myomasp/LRRC39 affects integrity of this
Will et al
Myomasp/LRRC39, a Novel Sarcomeric M-Band Protein
Downloaded from http://circres.ahajournals.org/ by guest on June 18, 2017
A-band/M-band transition zone in zebrafish skeletal muscle.
Thus, myomasp might also be an attractive candidate gene for
this disorder and/or involved in its pathophysiology. It would
be of special interest to see whether patients carrying this
myosin mutation reveal an altered M-band architecture or a
differential localization of myomasp/LRRC39.
In conclusion, we identified a novel heart- and musclespecific M-band protein termed myomasp/LRRC39, which
interacts with MYH7 and negatively regulates stretchsensitive genes. Downregulation of myomasp/LRRC39 alters
the molecular M-band composition via modulation of SRFdependent gene expression, as well as myocardial performance in vitro and in vivo.
Although we cannot rule out that structural alterations caused
by abrogation of myomasp/LRRC39 result in changes in signaling and function, we interpret our results to support a role for
myomasp/LRRC39 as a previously unrecognized component of
an M-band–associated signaling pathway that regulates cardiomyocyte gene expression in response to biomechanical stress.
Further in vivo gain- and loss-of-function experiments, as well
as the analyses of myomasp/LRRC39 in patient samples, will
help to clarify whether this novel sarcomeric protein also
participates in the pathogenesis of cardiomyopathy.
10.
11.
12.
13.
14.
15.
16.
17.
18.
Acknowledgments
We thank Susann Werkmeister, Jutta Krebs, and Sabine Marquart for
excellent technical assistance, as well as Hiltraud Hosser for performing the ultrastructural analysis. We thank S. Labeit for kindly
providing the M-band–specific anti-titin N2A antibody.
19.
20.
Sources of Funding
This work was supported by the Landesstiftung Baden-Württemberg,
as well as by a grant of the Bundesministerium für Bildung und
Forschung, Germany (Nationales Genomforschungsnetz: NGFNplus) (to N.F.).
21.
22.
Disclosures
None.
References
1. Clark KA, McElhinny AS, Beckerle MC, Gregorio CC. Striated muscle
cytoarchitecture: an intricate web of form and function. Annu Rev Cell
Dev Biol. 2002;18:637–706.
2. Lange S, Ehler E, Gautel M. From A to Z and back? Multicompartment
proteins in the sarcomere. Trends Cell Biol. 2006;16:11–18.
3. Linke WA. Sense and stretchability: the role of titin and titin-associated
proteins in myocardial stress-sensing and mechanical dysfunction. Cardiovasc Res. 2008;77:637– 648.
4. Hoshijima M. Mechanical stress-strain sensors embedded in cardiac
cytoskeleton: Z disk, titin, and associated structures. Am J Physiol Heart
Circ Physiol. 2006;290:H1313–H1325.
5. Agarkova I, Ehler E, Lange S, Schoenauer R, Perriard JC. M-band: a
safeguard for sarcomere stability? J Muscle Res Cell Motil. 2003;24:
191–203.
6. Frank D, Kuhn C, Katus HA, Frey N. The sarcomeric Z-disc: a nodal
point in signalling and disease. J Mol Med. 2006;84:446 – 468.
7. Molkentin JD, Lu JR, Antos CL, Markham B, Richardson J, Robbins J,
Grant SR, Olson EN. A calcineurin-dependent transcriptional pathway for
cardiac hypertrophy. Cell. 1998;93:215–228.
8. Frey N, Barrientos T, Shelton JM, Frank D, Rutten H, Gehring D, Kuhn
C, Lutz M, Rothermel B, Bassel-Duby R, Richardson JA, Katus HA, Hill
JA, Olson EN. Mice lacking calsarcin-1 are sensitized to calcineurin
signaling and show accelerated cardiomyopathy in response to pathological biomechanical stress. Nat Med. 2004;10:1336 –1343.
9. Heineke J, Ruetten H, Willenbockel C, Gross SC, Naguib M, Schaefer A,
Kempf T, Hilfiker-Kleiner D, Caroni P, Kraft T, Kaiser RA, Molkentin
23.
24.
25.
26.
27.
28.
29.
30.
1263
JD, Drexler H, Wollert KC. Attenuation of cardiac remodeling after
myocardial infarction by muscle LIM protein-calcineurin signaling at the
sarcomeric Z-disc. Proc Natl Acad Sci U S A. 2005;102:1655–1660.
Purcell NH, Darwis D, Bueno OF, Muller JM, Schule R, Molkentin JD.
Extracellular signal-regulated kinase 2 interacts with and is negatively
regulated by the LIM-only protein FHL2 in cardiomyocytes. Mol Cell
Biol. 2004;24:1081–1095.
Pyle WG, La Rotta G, de Tombe PP, Sumandea MP, Solaro RJ. Control
of cardiac myofilament activation and PKC-betaII signaling through the
actin capping protein, CapZ. J Mol Cell Cardiol. 2006;41:537–543.
Willis MS, Schisler JC, Li L, Rodriguez JE, Hilliard EG, Charles PC,
Patterson C. Cardiac muscle ring finger-1 increases susceptibility to heart
failure in vivo. Circ Res. 2009;105:80 – 88.
Willis MS, Ike C, Li L, Wang DZ, Glass DJ, Patterson C. Muscle ring
finger 1, but not muscle ring finger 2, regulates cardiac hypertrophy in
vivo. Circ Res. 2007;100:456 – 459.
Lange S, Xiang F, Yakovenko A, Vihola A, Hackman P, Rostkova E,
Kristensen J, Brandmeier B, Franzen G, Hedberg B, Gunnarsson LG,
Hughes SM, Marchand S, Sejersen T, Richard I, Edstrom L, Ehler E, Udd
B, Gautel M. The kinase domain of titin controls muscle gene expression
and protein turnover. Science. 2005;308:1599 –1603.
Kimura A. Molecular basis of hereditary cardiomyopathy: abnormalities
in calcium sensitivity, stretch response, stress response and beyond.
J Hum Genet. 2010;55:81–90.
Frank D, Kuhn C, Katus HA, Frey N. Role of the sarcomeric Z-disc in the
pathogenesis of cardiomyopathy. Future Cardiol. 2007;3:611– 622.
Granzier HL, Labeit S. The giant protein titin: a major player in myocardial mechanics, signaling, and disease. Circ Res. 2004;94:284 –295.
Obermann WM, Gautel M, Steiner F, van der Ven PF, Weber K, Furst
DO. The structure of the sarcomeric M band: localization of defined
domains of myomesin, M-protein, and the 250-kD carboxy-terminal
region of titin by immunoelectron microscopy. J Cell Biol. 1996;134:
1441–1453.
Steiner F, Weber K, Furst DO. M band proteins myomesin and skelemin
are encoded by the same gene: analysis of its organization and expression.
Genomics. 1999;56:78 – 89.
Schoenauer R, Lange S, Hirschy A, Ehler E, Perriard JC, Agarkova I.
Myomesin 3, a novel structural component of the m-band in striated
muscle. J Mol Biol. 2008;376:338 –351.
Wang D, Chang PS, Wang Z, Sutherland L, Richardson JA, Small E,
Krieg PA, Olson EN. Activation of cardiac gene expression by myocardin, a transcriptional cofactor for serum response factor. Cell. 2001;
105:851– 862.
Uchida S, Schneider A, Wiesnet M, Jungblut B, Zarjitskaya P, Jenniches
K, Kreymborg KG, Seeger W, Braun T. An integrated approach for the
systematic identification and characterization of heart-enriched genes
with unknown functions. BMC Genomics. 2009;10:100.
Obermann WM, Gautel M, Weber K, Furst DO. Molecular structure of
the sarcomeric m band: mapping of titin and myosin binding domains in
myomesin and the identification of a potential regulatory phosphorylation
site in myomesin. EMBO J. 1997;16:211–220.
Cazorla O, Freiburg A, Helmes M, Centner T, McNabb M, Wu Y,
Trombitas K, Labeit S, Granzier H. Differential expression of cardiac titin
isoforms and modulation of cellular stiffness. Circ Res. 2000;86:59 – 67.
Frey N, Richardson JA, Olson EN. Calsarcins, a novel family of sarcomeric calcineurin-binding proteins. Proc Natl Acad Sci U S A. 2000;
97:14632–14637.
Flavigny J, Robert P, Camelin JC, Schwartz K, Carrier L, BerrebiBertrand I. Biomolecular interactions between human recombinant
beta-MyHC and cMyBP-Cs implicated in familial hypertrophic cardiomyopathy. Cardiovasc Res. 2003;60:388 –396.
Vignier N, Schlossarek S, Fraysse B, Mearini G, Kramer E, Pointu H,
Mougenot N, Guiard J, Reimer R, Hohenberg H, Schwartz K, Vernet M,
Eschenhagen T, Carrier L. Nonsense-mediated mRNA decay and
ubiquitin-proteasome system regulate cardiac myosin-binding protein C
mutant levels in cardiomyopathic mice. Circ Res. 2009;105:239 –248.
Frank D, Kuhn C, Brors B, Hanselmann C, Ludde M, Katus HA, Frey N.
Gene expression pattern in biomechanically stretched cardiomyocytes:
evidence for a stretch-specific gene program. Hypertension. 2008;51:
309 –318.
Wollert KC. Growth-differentiation factor-15 in cardiovascular disease:
from bench to bedside, and back. Basic Res Cardiol. 2007;102:412– 415.
Kudoh S, Akazawa H, Takano H, Zou Y, Toko H, Nagai T, Komuro I.
Stretch-modulation of second messengers: effects on cardiomyocyte ion
transport. Prog Biophys Mol Biol. 2003;82:57– 66.
1264
Circulation Research
November 12, 2010
Downloaded from http://circres.ahajournals.org/ by guest on June 18, 2017
31. Sehnert AJ, Stainier DY. A window to the heart: can zebrafish mutants
help us understand heart disease in humans? Trends Genet. 2002;18:
491– 494.
32. Xu X, Meiler SE, Zhong TP, Mohideen M, Crossley DA, Burggren WW,
Fishman MC. Cardiomyopathy in zebrafish due to mutation in an alternatively spliced exon of titin. Nat Genet. 2002;30:205–209.
33. Rottbauer W, Wessels G, Dahme T, Just S, Trano N, Hassel D, Burns CG,
Katus HA, Fishman MC. Cardiac myosin light chain-2: a novel essential
component of thick-myofilament assembly and contractility of the heart.
Circ Res. 2006;99:323–331.
34. Kobe B, Kajava AV. The leucine-rich repeat as a protein recognition
motif. Curr Opin Struct Biol. 2001;11:725–732.
35. Kim KH, Antkiewicz DS, Yan L, Eliceiri KW, Heideman W, Peterson
RE, Lee Y. Lrrc10 is required for early heart development and function
in zebrafish. Dev Biol. 2007;308:494 –506.
36. Kim KH, Kim TG, Micales BK, Lyons GE, Lee Y. Dynamic expression
patterns of leucine-rich repeat containing protein 10 in the heart. Dev
Dyn. 2007;236:2225–2234.
37. Pask HT, Jones KL, Luther PK, Squire JM. M-band structure, M-bridge
interactions and contraction speed in vertebrate cardiac muscles. J Muscle
Res Cell Motil. 1994;15:633– 645.
38. Millman BM. The filament lattice of striated muscle. Physiol Rev. 1998;
78:359 –391.
39. Tskhovrebova L, Trinick J. Titin: properties and family relationships. Nat
Rev Mol Cell Biol. 2003;4:679 – 689.
40. Lange S, Agarkova I, Perriard JC, Ehler E. The sarcomeric M-band
during development and in disease. J Muscle Res Cell Motil. 2005;26:
375–379.
41. Price MG, Gomer RH. Skelemin, a cytoskeletal M-disc periphery protein,
contains motifs of adhesion/recognition and intermediate filament
proteins. J Biol Chem. 1993;268:21800 –21810.
42. Agarkova I, Auerbach D, Ehler E, Perriard JC. A novel marker for
vertebrate embryonic heart, the EH-myomesin isoform. J Biol Chem.
2000;275:10256 –10264.
43. Agarkova I, Perriard JC. The M-band: an elastic web that crosslinks thick
filaments in the center of the sarcomere. Trends Cell Biol. 2005;15:
477– 485.
44. Obermann WM, Plessmann U, Weber K, Furst DO. Purification and
biochemical characterization of myomesin, a myosin-binding and titinbinding protein, from bovine skeletal muscle. Eur J Biochem. 1995;233:
110 –115.
45. Nave R, Furst DO, Weber K. Visualization of the polarity of isolated titin
molecules: a single globular head on a long thin rod as the m band
anchoring domain? J Cell Biol. 1989;109:2177–2187.
46. Nelson TJ, Balza R Jr, Xiao Q, Misra RP. SRF-dependent gene
expression in isolated cardiomyocytes: regulation of genes involved in
cardiac hypertrophy. J Mol Cell Cardiol. 2005;39:479 – 489.
47. Bahler M, Eppenberger HM, Wallimann T. Novel thick filament protein
of chicken pectoralis muscle: the 86 kD protein. I. Purification and
characterization. J Mol Biol. 1985;186:381–391.
48. Bahler M, Eppenberger HM, Wallimann T. Novel thick filament protein
of chicken pectoralis muscle: the 86 kD protein. II. Distribution and
localization. J Mol Biol. 1985;186:393– 401.
49. Bahler M, Wallimann T, Eppenberger HM. Myofibrillar M-band proteins
represent constituents of native thick filaments, frayed filaments and bare
zone assemblages. J Muscle Res Cell Motil. 1985;6:783– 800.
50. Walsh R, Rutland C, Thomas R, Loughna S. Cardiomyopathy: a systematic review of disease-causing mutations in myosin heavy chain 7 and
their phenotypic manifestations. Cardiology. 2010;115:49 – 60.
51. Oldfors A, Tajsharghi H, Darin N, Lindberg C. Myopathies associated
with myosin heavy chain mutations. Acta Myol. 2004;23:90 –96.
52. Armel TZ, Leinwand LA. Mutations in the beta-myosin rod cause myosin
storage myopathy via multiple mechanisms. Proc Natl Acad Sci U S A.
2009;106:6291– 6296.
53. Oldfors A. Hereditary myosin myopathies. Neuromuscul Disord.
2007;17:355–367.
Novelty and Significance
What Is Known?
●
●
●
The sarcomeric contractile filaments are precisely crosslinked at
the Z-disk and M-band to provide static stability. The Z-disk
and M-band are structural hubs with additional signaling
functions, integrating biomechanical strain with intracellular
signaling pathways.
Regular M-band assembly is needed for proper packing of the thick
filaments with appropriate distances to the thin filaments at the
onset of contraction.
M-band–associated proteins have also been implicated n intracellular
signaling processes and mechanotransduction.
What New Information Does This Article Contribute?
●
●
●
We identified a cardiac-enriched transcript encoding for a novel
component of the sarcomeric M-band, which we termed
myomasp.
Biomechanical strain in vitro, as well as in hearts subjected to aortic
banding in vivo, led to marked downregulation of myomasp
expression.
Knockdown of myomasp/LRRC39 expression in vitro results in the
inhibition of serum response factor (SRF)-dependent signaling and
downregulation of M-band proteins myomesin-1 and -2, whereas
the expression of stress-responsive genes such as GDF-15 and
brain natriuretic peptide (BNP) is induced. In vivo knockdown of
myomasp/LRRC39 in zebrafish resulted in reduced contractility,
cardiomyopathy, and perturbed ultrastructural M-band
architecture.
The Z-disk and the M-band are increasingly recognized as
sarcomeric hubs with structural and signaling functions, integrating information on stretch with pathways controlling muscle
growth and protein turnover. In this study, we found a novel
cardiac-enriched protein, termed myomasp. Immunolocalization
identified myomasp as component of the sarcomeric M-band,
and interaction studies confirmed the C terminus of myosin
heavy chain (MYH)7 as an interaction partner. We found that
myomasp mRNA expression was reduced in neonatal rat
ventricular myocyte (NRVCM) subjected to static stretch or mice
that underwent transverse aortic constriction. Myomasp knockdown in NRVCM led to an upregulation of the stretch-sensitive
genes GDF-15 and BNP, whereas expression of MYH7 mRNA
and the M-band proteins myomesin-1 and -2 was reduced.
Knockdown of myomasp suppressed SRF-dependent gene expression, consistent with observations linking the M-band to
SRF-mediated signaling. Downregulation of myomasp in engineered heart tissue constructs decreased force generation and
reduced fractional shortening. In vivo, myomasp-null zebrafish
reveal reduced contractile function performance and ultrastructural M-band alterations, with marked reduction of the A-band/
M-band transition zone. These observations support the concept
that myomasp plays a critical role in maintaining M-band
integrity, as well as regular contractile performance.
Downloaded from http://circres.ahajournals.org/ by guest on June 18, 2017
Myomasp/LRRC39, a Heart- and Muscle-Specific Protein, Is a Novel Component of the
Sarcomeric M-Band and Is Involved in Stretch Sensing
Rainer D. Will, Matthias Eden, Steffen Just, Arne Hansen, Alexandra Eder, Derk Frank,
Christian Kuhn, Thalia S. Seeger, Ulrike Oehl, Stefan Wiemann, Bernhard Korn, Manfred
Koegl, Wolfgang Rottbauer, Thomas Eschenhagen, Hugo A. Katus and Norbert Frey
Circ Res. 2010;107:1253-1264; originally published online September 16, 2010;
doi: 10.1161/CIRCRESAHA.110.222372
Circulation Research is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231
Copyright © 2010 American Heart Association, Inc. All rights reserved.
Print ISSN: 0009-7330. Online ISSN: 1524-4571
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://circres.ahajournals.org/content/107/10/1253
Data Supplement (unedited) at:
http://circres.ahajournals.org/content/suppl/2010/09/16/CIRCRESAHA.110.222372.DC1
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Circulation Research can be obtained via RightsLink, a service of the Copyright Clearance Center, not the
Editorial Office. Once the online version of the published article for which permission is being requested is
located, click Request Permissions in the middle column of the Web page under Services. Further information
about this process is available in the Permissions and Rights Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Circulation Research is online at:
http://circres.ahajournals.org//subscriptions/
Online data supplements
Expanded material and methods
Cloning of human, mouse and rat myomasp/LRRC39:
The complete open reading frames of myomasp/LRRC39 were amplified from cardiac
cDNA of the corresponding species employing the Gateway technology (Invitrogen). The
following gene-specific primers were used, LRRC39F and LRRC39Rs for constructs with
stop codon and LRRC39F and LRRC39Ros for constructs without stop codon,
respectively:
humanLRRC39F (5´-GCTGGCACCATGACAGAAAATGTGGTTTGTACTG-3´)
humanLRRC39Rs (5´-GCTGGGTCGCCTTATCCATCCGTATTTATGGAGAT-3´)
mouseLRRC39F (5´-GCTGGCACC ATGACAGAAAGTGCGGTTTGT-3´)
mouseLRRC39Rs (5´-GCTGGGTCGCCTCAATTACTTTCTCCATCAGAATGT-3´)
ratLRRC39F (5´-GCTGGCACCATGACAGAAAGTGTGGTTTGTACC-3´)
ratLRRC39RS (5´-GCTGGGTCGCCTTATCCATCAGACCGTGTAGAGC-3´)
humanLRRC39Ros (5-GCTGGGTCGCCTCCATCCGTATTTATGGAGATTG´-3)
mouseLRRC39Ros(5´-GCTGGGTCGCCATTACTTTCTCCATCAGAATGTATAGAGC-3´)
ratLRRC39Ros (5´-GCTGGGTCGCCTCCATCAGACCGTGTAGAGCT-3´)
For integration of the specific recombination site into the PCR-products, a second
universal
PCR
was
performed
GGGGACAAGTTTGTACAAAAAAGCTGGCACC-3’)
using
attBFor
(5’-
and
attBRev
(5’-
GGGGACCACTTTGTACAAGAAAGCTGGGTCGCC-3’) primers and 1µl of the initial
PCR-reaction as template. The PCR-product containing the recombination-specific
attachment sites (att sites) was further recombined into the pDON201 entry vector.
For recombinant protein expression, rat myomasp/LRRC39 cDNA was subsequently
shuttled into Gateway compatible expression plasmids in order to obtain expression
constructs encoding for amino-terminal fusion tags (HA; MYC).
Cloning of synthetic LRRC39 knockdown microRNAs:
Knockdown Oligonucleotides miMyomasp_TOP
(TGCTGCTAGTGAGCAGTCCAATGCCTGTTTTGGCCACTGACTGACAGGCATTGCTG
CTCACTAG) and miMyomasp_Bottom
(CCTGCTAGTGAGCAGCAATGCCTGTCAGTCAGTGGCCAAAACAGGCATTGGACTG
CTCACTAGC) were designed using Invitrogen’s BLOCK-iT™ RNAi Designer and
subsequently cloned into the pcDNA™6.2-GW/EmGFP-miR vector according to
manufacturer’s instructions. This construct was used as template for the recombination
into the pDON201 entry vector which itself served as template for the generation
expression constructs. As negative control we used the pcDNA™6.2-GW/EmGFP-miR
plasmid, which can form a hairpin structure and is consecutively processed into a mature
miRNA, yet is predicted not to target any known mammalian gene (sequence of the
insert: 5’-GAA ATG TAC TGC GCG TGG AGA CGT TTT GGC CAC TGA CTG ACG
TCT CCA CGC AGT ACA TTT-3’).
Generation of recombinant adenoviruses encoding for myomasp/LRRC39 or
myomasp/LRRC39 knockdown miRNA
Adenoviruses were generated using the appropriate Entry vectors in combination with
the ViraPower™ Adenoviral Expression System (Invitrogen) according to manufacturer´s
instructions. Ad-ß-galactosidase-V5 encoding adenovirus served as control for
overexpression experiments (Invitrogen).
Northern blot analysis
Multiple tissue northern-blots (BioChain) containing mouse or human poly(A) RNA were
hybridized overnight at 65°C with
32
P-dCTP-labeled (Rediprime II Random Prime
labelling System, Amersham Biosciences) cDNA probes corresponding to the ORF of
mouse and human myomasp/LRRC39, respectively. Serial washes were conducted with
2
2 x SSC/0.1% SDS and 0.2 x SSC/0.1% SDS at 65°C. Autoradiography was performed
at –80°C for 24-168 hours with an intensifying screen.
Y2H library screening
Automated yeast two-hybrid screens were essentially performed as described1, with the
following differences: Human cDNA libraries from human heart and skeletal muscle
(Clontech) as well as a library of individually cloned full – length open reading frames
from cDNAs of 5000 different genes were screened to a minimal coverage of 5 million
clones per library. To mate yeast strains harbouring the bait protein and the prey library,
exponentially growing cultures of an O.D.600nm of 1 were combined, pelleted by
centrifugation for 2 min at 2900rpm, and resuspended in an equal volume of YPDA
containing 20% PEG 6000 in a 50mL centrifugation tube. Mating mixes were incubated
at 30OC with gentle agitation (100 rpm) for exactly 3 h, before washing and resuspending
the cells in selective medium. For the generation of a high-confidence dataset,
interaction pairs were selected which were isolated at least twice, or where the bait
interacted with two highly related preys, and which did not involve promiscuous preys.
Coimmunoprecipitation experiments:
Interacting proteins were transiently coexpressed in HEK293-T cells as N-terminal
fusions (HA-myomasp + MYC-MYH7 / HA + MYC-MYH7 /). 48 hours after transfection,
with jetPEI (PolyPlus Transfection) according to manufacturer instructions, the medium
was removed and cells were lysed in 1000µl of ice-cold ELB lysis buffer (50mM HEPES
pH 7.0, 250mM NaCl, 1% NP40, 5mM EDTA, Protease Inhibitor Cocktail (Roche # 1 836
170) and Phosphatase Inhibitor Cocktail 1 + 2 (Sigma # P2850; P5726). Lysates were
incubated on ice for 30 minutes. Cellular debris was removed by centrifugation, 5min at
13.000 rpm 4°C. 3000µl of the cleared protein extract was incubated together with 50µl
Anti-HA-Agarose (Sigma # A2095) for 2 hours at 4°C with moderate agitation. After 4
washes with 1ml lysisbuffer the protein complexes were eluted in 1 bead volume 1x SDS
3
sample buffer. For western blot experiments the beads were separated by 2min
centrifugation at 13000 rpm / RT and the protein containing supernatant was analysed.
RNA isolation and purification.
Total RNA from NRVMs was isolated using the TRIzol method (Invitrogen # 15596-018)
according to the manufacturer’s instructions und resuspended in DEPC treated water.
Quantitative real time PCR.
CDNA was generated from total RNA using the Superscript III first strand kit (Invitrogen #
18080-051). Following primers were used for qPCR-validation of microarray results:
ratqRTrLRRC39_F
(5’-ACA ATC CCT CTT GCT GTG C-3’)
ratqRTrLRRC39_R
(5’-CCA TGC AGC CTG GAA TAT-3’)
ratqRTr18S_F
(5’-TCA AGA ACG AAA GTC GGA GG-3’)
ratqRTr18S_R
(5’-GGA CAT CTA AGG GCA TCA C-3’)
ratqRTrGDF15_F
(5’-AGC TGT CCG GAT ACT CAG TC-3’)
ratqRTrGDF15_R
(5’-GAG TCT CTT GGG TGC AAA TG-3’)
ratqRTrMYOM1_F
(5’-GGC CCA CAC TTC GCT GAG TA-3’)
ratqRTrMYOM1_R
(5’-TTG CCA CCT TGC ACT TCA AC-3’)
ratqRTrMYOM2_F
(5’-GAG AGG GCG AGA CGG TCA CAC T-3’)
ratqRTrMYOM2_R
(5’-CTC GAG GCT GTA CCC TCT TCA GA-3`)
ratqRTrMYH7B_F
(5’-CCT GCA GCC CTG CAT CGA CC-3’)
ratqRTrMYH7B_R
(5’-GCT TGG CCC TGA AGC TTG CGT-3’)
ratqRTrBNP_F
(5’-GCA GCA TGG ATC TCC AGA AGG-3’)
ratqRTrBNP_R
(5’-CTG CAG CCA GGA GGT CTT CC-3’)
For validation of gene expression data in human tissue, the universal probe® real-time
PCR-system
Roche
hqRTLRRC39F
applied
science)
was
used
(5´-caacaaacttgaacaacttcctga-3´)
with
the
following
Primers
hqRTLRRC39R
(5´-
gcaagcatgttatttcatttcg-3´) and Universal ProbeLibrary probe: #46 (cat.no. 04688066001).
4
For
normalization
of
cDNA
content,
homo
sapiens
hypoxanthine
phosphoribosyltransferase 1 was used as a housekeeping gene control with the
following
probe
and
primers
hqRTHPRT1F
(5´-
tgaccttgatttattttgcatacc-3´),
hqRTHPRT1R (5´- cgagcaagacgttcagtcct-3´) and Universal ProbeLibrary probe: #73
(cat.no. 04688961001). For all other quantitative real-time PCR analyses, the Platinum
SYBR®GreenER™ qPCR SuperMix (Invitrogen # 11760-500) was used in combination
with the ABI Prism 7000 Sequence Detection System (Applied Biosystems).
Sentrix BeadChip array Hybridisation
Quality and integrity of total RNA was checked by gel analysis using the total RNA Nano
chip assay on an Agilent 2100 Bioanalyzer (Agilent Technologies GmbH, Berlin,
Germany). Only samples with RNA index values greater than 8.5 were selected for
expression profiling. RNA concentrations were determined using the NanoDrop
spectrophotometer (NanoDrop Technologies, Wilmington, DE).
Biotin-labeled cRNA samples were prepared for hybridization on Illumina Rat Sentrix-12
BeadChip arrays (Illumina, Inc.) according to Illumina's recommended sample labeling
procedure based on the modified Eberwine protocol2-3. In brief, 250 ng total RNA was
used for cDNA synthesis, followed by an amplification/labeling step (in vitro transcription)
to synthesize biotin-labeled cRNA according to the MessageAmp II aRNA Amplification
kit (Ambion, Inc., Austin, TX). Biotin-16-UTP was purchased from Roche Applied
Science, Penzberg, Germany. The cRNA was column purified according to TotalPrep
RNA Amplification Kit, and eluted in 60 µl of water. Quality of cRNA was controlled using
the RNA Nano Chip Assay on an Agilent 2100 Bioanalyzer and spectrophotometrically
quantified (NanoDrop). Hybridization is performed at 58°C, in GEX-HCB buffer (Illumina
Inc.) at a concentration of 100 ng cRNA/µl, unsealed in a wet chamber for 20h. Spike-in
controls for low, medium and highly abundant RNAs were added, as well as mismatch
control and biotinylation control oligonucleotides. Microarrays were washed twice in
E1BC buffer (Illumina Inc.) at room temperature for 5 minutes. After blocking for 5 min in
5
4 ml of 1% (wt/vol) Blocker Casein in phosphate buffered saline Hammarsten grade
(Pierce Biotechnology, Inc., Rockford, IL), array signals are developed by a 10-min
incubation
in
2
ml
of
1
µg/ml
Cy3-streptavidin
(Amersham
Biosciences,
Buckinghamshire, UK) solution and 1% blocking solution. After a final wash in E1BC, the
arrays are dried and scanned. Microarray scanning and data analysis Microarray
scanning was done using a Beadstation array scanner, setting adjusted to a scaling
factor of 1 and PMT settings at 430. Data extraction was done for all beads individually,
and outliers were removed when > 2.5 MAD (median absolute deviation). All remaining
data points are used for the calculation of the mean average signal for a given probe,
and standard deviation for each probe was calculated. Data analysis was done by
normalization of the signals using the cubic spline normalization algorithm with
background subtraction, and differentially regulated genes are defined by calculating the
standard deviation differences of a given probe in a one-by-one comparisons of samples
or groups.2
Western blot analysis
In order to determine tissue specificity of myomasp/LRRC39 expression different protein
extracts of rat tissues were prepared in RIPA-buffer (10 mM Tris-HCl pH 7.5, 15mM
Na2EDTA;1% NP-40;0,5% sodium deoxycholate; 0,1% SDS; Protease Inhibitor Cocktail
(Roche # 1 836 170). After homogenisation 150µg of the cleared supernatant were
separated on a 12,5% PAA-Gel and transferred on a PVDF-Membrane. The membrane
was probed with an anti-human LRRC39 antibody (Abnova #H00127495-B01P ) at a
dilution of 1 :750 according to the manufacturer’s protocol followed by ECL detection (GE
Healthcare RPN2106).
Lufciferase Reporter gene assays.
16 hours after plating, neonatal cardiomyocytes were serum starved and infected with an
adenoviral reporter gene construct carrying a firefly luciferase reporter under
transcriptional control of the sm22-promotor, the myomasp/LRRC39 miRNA knockdown
6
virus as well as an adenoviral LacZ virus for normalization of the infection efficiency for
24 hours. To apply an identical virus load per condition we used an adenovirus encoding
for a miRNA backbone but not carrying any predicted binding sites known to target any
mammalian gene. After 24 hours of infection the sm22-promotor was induced by
incubation of the cardiomyocytes in medium containing 10% FCS for additional 24 hours
Luciferase assays were performed according to the manufacturer’s instructions using the
Luciferase Assay System with Reporter Lysis Buffer (Promega # E4030). To normalize
the infection efficiency a ß-galactosidase assay was performed in a 0.1 mol/L sodiumphosphate-buffer (pH 7.3) with 1 mmol/L MgCl2. For the colorimetric detection 2Nitrophenyl-ß-D-galactopyranoside (30µg/ml) was used as substrate. After incubation
for 30 minutes a photometric analysis was performed.
Immunofluorescence microscopy
The subcellular localization of myomasp/LRRC39 was determined in adult rat
cardiomyocytes (ARVCM) and cryosections of rat cardiac tissue using indirect
immunofluorescence. Adult mouse and cardiomyocytes were prepared as described4-5.
ARVCM were fixed in 3.4% PFA for 10min at RT, 16h after isolation. Blocking and
permeabilization were done in 5% BSA and 0,1% Triton X-100 (Sigma # T8787) for 1h at
RT. Cryosections were blocked in 5% BSA but not permeabilized with Triton.
For detection, the cover slips or slides, respectively, were incubated with mouse
polyclonal LRRC39 (Abnova #
H00127495-B01P; 1:100) together with one of the
following primary antibodies: polyclonal anti-calsarcin-1 (1:100), polyclonal anti-MYBPC3
(1:100), polyclonal anti-calsarcin-2 (1 :200) at 4°C overnight
Fluorescence labelling was carried out with secondary antibodies conjugated with goat
anti-mouse fluorescein (1 :200 /Vector Laboboratries Inc.) or goat anti-rabbit Cy3 (1: 200
/ Dianova) for 60 min at RT.
Vectashield medium with DAPI (4',6'-diamidino-2-
phenylindole) (Vector Laboboratries Inc.) was used for mounting of the slides .
7
Fluorescence micrographs were taken with Axioskop 2 Plus (Zeiss). Cell surface areas
of cardiomyocytes were determined applying AxioVision Release 4.4 (Carl Zeiss Vision).
Tissue culture experiments
HEK-293T cells (large “T” transformed embryonic kidney cells) were maintained in
DMEM
medium
supplemented
with
10%
FBS,
2
mM
L-glutamine
and
penicillin/streptomycin under standard cell culture conditions (37°C / 5% CO2).
Isolation and culture of neonatal rat ventricular cardiomyocytes (NRVMs).
Hearts from 1-2 days old Wistar rats (Charles River) were excised and minced in ADS
buffer (120 mmol/L NaCl, 20 mmol/L HEPES, 8 mmol/L NaH2PO4, 6 mmol/L glucose, 5
mmol/L KCl, 0.8 mmol/L MgSO4, pH 7.4). A series of digestion steps was carried out with
an enzymatic solution containing collagenase type II (0.5 mg/ml, Worthington) and
pancreatin (0.6 mg/ml, Sigma-Aldrich) in sterile ADS buffer. A Percoll (GE Healthcare)
gradient centrifugation step was applied to remove contaminating fibroblasts from
cardiomyocytes. NRVMs were resuspended and cultured in Dulbecco’s modified Eagle’s
medium (DMEM) containing 10% FCS, penicillin/streptomycin and L-glutamine (PAA) for
24 h. After 24 h cells were either infected in serum-free medium or serum starved for 24
h before applying stimulants or inhibitors for the indicated time.
Stretch experiments
Cardiomyocyte stretch experiments were done as described previously6
Isolation and culture of adult rat ventricular cardiomyocytes (ARVMs).
Adult rat cardiomyocytes (ARCM) were isolated from Sprague–Dawley rats as described
4-5
.
8
Zebrafish Strain, Morpholino microinjection procedures, fractional shortening
measurements
Care and breeding of zebrafish Danio rerio was done as described7. The present study
was performed under institutional approvals which confirm to the Guide for the Care and
Use of Laboratory Animals published by the US National Institute of Health
(NIHPublication No. 85-23).
Morpholino-modified oligonucleotides were directed against the splice donor site of intron
2 (MO-myomasp/Lrrc39 = 5 ́- CGTTGTGCACGTACCTACCCACTGC -3 ́) of zebrafish
myomasp/Lrcc39. A standard control oligonucleotide (MO-control) (GENETOOLS, LLC)
was injected at the same concentration as a negative control8. To inhibit pigmentation,
0.003 % 1-phenyl-2-thiourea was added to the embryo medium. Pictures and movies
were recorded 24, 48 and 72 hours after fertilization.
To analyze contractile force of the myomasp morphant and control-morpholino injected
embryos, we performed fractional shortening measurements with help of the zebraFS
software application (www.benegfx.de).
Zebrafish histology, Transmission Electron Microscopy, antisense RNA in situ
hybridization, and Immunostaining
Embryos were fixed in 4% paraformaldehyde and embedded in JB-4 (Polysciences,
Inc.). 5µm sections were cut, dried, and stained with hematoxylin/eosin.
For transmission electron microscopy, zebrafish embryos were fixed overnight in 3%
glutaraldehyde in 100mM cacodylic acid (pH 7.4) supplemented with 0.1% picrinic acid
at 4°C, they were treated with OsO4 and dehydrated in a graded series of ethanol. Epon
812 was used for embedding. Subsequently, ultrathin sections (70nm) were obtained
with an Ultracut E microtome (Leica), stained with uranyl acetate and Reynolds lead
citrate and examined on a Philips EM 301 transmission electron microscope.
9
Whole mount antisense RNA in situ hybridization was carried out essentially as
described9 using digoxigenin-labeled antisense probes for zebrafish cmlc2, amhc and
vmhc.
For whole-mount double immunostaining, embryos were fixed in Dent´s fixative and
stained with monoclonal antibodies directed against atrial and ventricular meromyosin
(MF20; DSHB) and against the atrial specific isoform of myosin heavy chain (S46;
DSHB).
Engineered heart tissues (“FBMES”)
Unpurified heart cells were isolated from neonatal Wistar rats (postnatal day 0 to 3) by a
fractionated DNase/Trypsin digestion protocol as previously described above. The
resulting cell population was immediately subjected to ibrin-based mini engineered heart
tissues (FBMEs) generation. Experimental performed as described in detail10. All
procedures were reviewed and approved by Ethics Committee, University Hamburg.
Sylgard 184 silicone elastomer (Dow Corning) was used to produce silicone post racks in
custom-made teflon casting molds. The two-component Sylgard 184 elastomer was
handled according to manufactures instructions and degassed under vacuum conditions
before casting. The racks contained 4 pairs of posts
length/width of racks:
79 x 18,5 mm, length of posts 12 mm, diameter 1 mm, plate diameter 2 mm, distance
(center-center) 8.5 mm. Teflon spacers for producing the casting molds had the following
geometry: length 12 mm, width 3 mm, height 13.5 mm.
To generate FBMEs, a reconstitution mix was prepared on ice as follows (final
concentration): 4.1x106 cells/ml, 5 mg/ml bovine fibrinogen (Sigma F4753, stock solution:
200 mg/ml plus aprotinin 0.5 µg/mg fibrinogen in NaCl 0.9%), 100 µl/ml Matrigel (BD
Bioscience 356235). 2xDMEM was added to match the volumes of fibrinogen and
thrombin stock to ensure isotonic conditions. Casting molds were prepared by placing
the teflon spacer in 24-well culture dishes and adding 1.6 ml 2% agarose in PBS
10
(Invitrogen 15510-027) per well. After agarose solidification the spacer was removed and
silicon post racks were placed onto the dishes with pairs of posts reaching into each
casting mold. For each FBME 145 µl reconstitution mix was mixed briefly with 4.5 µl
thrombin (100 U/ml, Sigma Aldrich T7513) and pipetted into the agarose slot.
For fibrinogen polymerisation the constructs were placed in a 37 °C, 7% CO2 humidified
cell culture incubator for 2 hours. 300 µl of cell culture medium was then added per well
to ease removal of the constructs from agarose casting molds. The racks were
transferred to new 24-well cell culture dishes. Constructs were maintained in 37 °C, 7%
CO2 humidified cell culture incubator. Media was changed on Mondays, Wednesdays
and Fridays. EHT medium consisted of DMEM (Biochrom F0415), 10% horse serum
(Gibco 26050), 2% chick embryo extract, 1% Penicillin/Streptomycin (Gibco 15140),
insulin (10 µg/ml, Sigma Aldrich I9278), tranexamic acid (400 µm/ml, Sigma Aldrich
857653) and aprotinin (33 µg/ml, Sigma Aldrich A1153).
Video optical analysis
The setup for video optical recording consisted of a cell incubator unit with control of
CO2, humidity and temperature, and a glass roof for monitoring purposes. Light diodes
were positioned underneath the cell culture dish. A Basler camera (Type A 602f-2)
placed above the cell culture unit was positioned in XYZ direction (IAI Corporation) in a
PC-controlled manner. Video optical recording and light exposure were synchronized to
minimize heating of cell culture medium by light. Video optical analysis was performed
with a customized software package by ctmv.de. The software is based on figure
recognition of the contracting muscle strip at top and bottom ends in a fully automated
manner. The distance between the ends of the muscle strip is determined during
contractions and recorded over time. Based on post geometry, elastic modulus of
Sylgard 184 (2.6 kPa) and delta of post distance (post deflection) force was calculated.
Recorded contractions are identified by peak criteria (threshold value, minimum
relaxation). Based on identified contractions, values for frequency, average force,
fractional shortening, contraction – and relaxation time (T1, T2, respectively) were
11
calculated. Records of experiments are automatically generated with two levels of quality
control: pictures are taken at the beginning and the end of each measurement.
Contractions are recorded as force development over time. The effort to analyse
contractility with this setup is limited to defining the x-, y-, z- coordinates of the camera
for each FBME10.
Transverse aortic constriction in C57BL6 mice:
Transverse aortic constriction (TAC) was performed in male C57BL6 mice (8-10 weeks
old). Briefly the animals were anesthetized with ketamine (120 mg/kg i.p.) plus xylazine
(15 mg/kg i.p.). The mice were orally intubated with 20-gauge tubing and ventilated
(Harvard Apparatus) at 120 breaths per minute (0.2 ml tidal volume). The aortic
constriction was created via a lateral thoracotomy at the second intercostal space. A
suture (Prolene 6-0) was placed around the transverse aorta between the
brachiocephalic and left carotid artery. The suture was ligated against a 27-gauge
needle, the needle was removed leaving a discrete stenosis. The chest was closed and
a pneumothorax evacuated. Sham animals underwent the same the procedure except
ligation. After 4 weeks animals were sacrificed and RNA was harvested and after cDNA
synthesis gene expression was asssed with quantitative realtime PCR. In these realtime
experiments mouse- Rpl32 served as housekeeping gene:
Rpl32_e1 (5’-F GGTGGCTGCCATCTGTTTTACG-3’)
Rpl32_e3 (5’-R CCGCACCCTGTTGTCAATGC-3’)
qPCR-LRRC39m F 730 ( 5’- CCTCCCACCAGAGCTCAGCA-3’)
qPCR-LRRC39m R 834 (5’- TCGAGGGCAGGCATGTCCAA-3’)
12
Statistical analyses.
All results are shown as the mean +/- standard error of the mean (SEM) unless stated
otherwise. Real time PCR data analyses were carried out using the ∆∆ct method.
Statistical analyses of the data were carried out using one-way ANOVA followed by
Student-Newman-Keuls post-hoc tests. If appropriate, Student’s t-test (two sided) was
employed. P values <0.05 were considered statistically significant.
Literature:
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
Albers M, Kranz H, Kober I, Kaiser C, Klink M, Suckow J, Kern R, Koegl M.
Automated yeast two-hybrid screening for nuclear receptor-interacting proteins.
Mol Cell Proteomics. 2005;4:205-213
Eberwine J, Yeh H, Miyashiro K, Cao Y, Nair S, Finnell R, Zettel M, Coleman P.
Analysis of gene expression in single live neurons. Proc Natl Acad Sci U S A.
1992;89:3010-3014
Eberwine J, Spencer C, Miyashiro K, Mackler S, Finnell R. Complementary DNA
synthesis in situ: Methods and applications. Methods Enzymol. 1992;216:80-100
Boerries M, Most P, Gledhill JR, Walker JE, Katus HA, Koch WJ, Aebi U,
Schoenenberger CA. Ca2+ -dependent interaction of s100a1 with f1-atpase leads
to an increased atp content in cardiomyocytes. Mol Cell Biol. 2007;27:4365-4373
Luedde M, Flogel U, Knorr M, Grundt C, Hippe HJ, Brors B, Frank D,
Haselmann U, Antony C, Voelkers M, Schrader J, Most P, Lemmer B, Katus HA,
Frey N. Decreased contractility due to energy deprivation in a transgenic rat
model of hypertrophic cardiomyopathy. J Mol Med. 2009;87:411-422
Frank D, Kuhn C, Brors B, Hanselmann C, Ludde M, Katus HA, Frey N. Gene
expression pattern in biomechanically stretched cardiomyocytes: Evidence for a
stretch-specific gene program. Hypertension. 2008;51:309-318
Akimenko MA, Johnson SL, Westerfield M, Ekker M. Differential induction of
four msx homeobox genes during fin development and regeneration in zebrafish.
Development. 1995;121:347-357
Seeger TS, Frank D, Rohr C, Will R, Just S, Grund C, Lyon R, Luedde M, Koegl
M, Sheikh F, Rottbauer W, Franke WW, Katus HA, Olson EN, Frey N. Myozap, a
novel intercalated disc protein, activates serum response factor-dependent
signaling and is required to maintain cardiac function in vivo. Circ Res.
2010;106:880-890
Rottbauer W, Just S, Wessels G, Trano N, Most P, Katus HA, Fishman MC. Vegfplcgamma1 pathway controls cardiac contractility in the embryonic heart. Genes
Dev. 2005;19:1624-1634
Hansen A, Eder A, Bonstrup M, Flato M, Mewe M, Schaaf S, Aksehirlioglu B,
Schworer A, Uebeler J, Eschenhagen T. Development of a Drug Screening
Platform Based on Engineered Heart Tissue. Circ Res. 2010. May 6
13
Supplemental Figure I.
Statistical microarray data analyses of myomasp/LRRC39
regulated genes. (A) Scatter plot showing the log ratio of the means of myomasp /LRRC39
differentially regulated genes plotted against the log ratio of the means of the control
hybridizations. Red dots represent significantly upregulated genes, blue dots downregulated
genes (>4 fold each). (B) Heat map displaying the genes with > 4 fold differential expression.
Each hybridization sample is plotted individually. Red colors represent upregulation, blue
colors downregulation. (C) Table showing differential regulation of M-band associated
proteins after myomasp/LRRC39 knockdown.
Supplemental Figure II. Adenoviral knockdown of mympasp/LRRC39 in neonatel rat
ventricular cardiomyocytes. (A) Realtime PCR analysis showing a time dependent
suppression of myomasp/LRRC39 mRNA after adenovirus mediated knockdown through
infection with AdMiMyomasp compared to AdMiNeg infected cells. While adenovirus
mediated knockdown for 24h revealed a moderate reduction of myomasp/LRRC39mRNA
which not reached statistical significance, reduction of myomasp/LRRC39 mRNA after 72h
was highly significant (-85%; p<0.01). (B) Representative immunoblot showing a markedly
reduction of myomasp/LRRC39 protein expression through adenoviral infection with 50 ifu
AdMiMyomasp and a AdMiMyomasp alternative virus compared to 50 ifu AdMiNeg for 72h.
Supplemental Figure III.
Morpholino knockdown of zebrafish myomasp/LRRC39
results in sarcomeric M-Band defects Accessory panel with additional low (left panel) and
high magnification EM images (right panel) of randomly selected zebrafish skeletal-musclesarcomeres comparing MO-myomasp knockdown zebrafish (upper panel) with control
animals (bottom).
Supplemental Figure IV. Myomesin 2 protein expression after knockdown of
myomasp/LRRC39 in NRVM Representative immunoblot probed with an anti-rabbit
myomesin 2 antibody (Santa Cruz) showing a significant of target protein expression after
adenoviral mediated knockdown of myomasp/LRRC9 in rat ventricular cardiomyocytes.
B
3
5000
2
4500
4000
1
3500
0
3000
2500
-2 -1
mean log ratio miMyomasp
4
5
A
2000
1500
1000
-2 -1
0
1
2
3
4
5
6
500
7
miNEG-1
miNEG-2
miNEG-3
miMyomasp-1
miMyomasp-2
miMyomasp-3
0
mean log ratio miNEG
> 4x upregulated
> 4x downregulated
C
Table I.)
1 Regulation of M-band associated proteins after LRRC39 / Myomasp knockdown
Gene Name
Gene Symbol
Acc. No.
Fold Change
miNEG / miMyomasp
Myomesin 1
MYOM1
XM_237523
-4,5
Myomesin 2
MYOM2
XM_240481
-18,8
Myosin heavy chain 7
MYH7B
XM_230774
-25,6
Supplemental Figure I
P= n.s
Ad
miMyomasp
24h
Supplemental Figure II
Ad
miNEG
48h
20ifU AdrLRRC39_V5 +
50ifU AdmiMyomasp
Ad
miNEG
24h
20ifU AdrLRRC39_V5 +
50ifU AdmiMyomasp alternative
1.50
20ifU AdrLRRC39_V5 +
50ifU AdmiNEG
20ifU rLRRC39_V5
myomasp-mRNA expression
[n-fold change]
A
P<0.05
P<0.01
1.00
0.50
0.00
Ad
miMyomasp
48h
B
myomasp/LRRC39
43 kDa
myomasp/V5
43 kDa
Ad
miNEG
72h
Ad
miMyomasp
72h
skeletal muscle
MO-myomasp
skeletal muscle
1μm
skeletal muscle
MO-myomasp
0.2μm
skeletal muscle
1µm
skeletal muscle
MO-myomasp
0.2μm
skeletal muscle
1µm
MO-myomasp
skeletal muscle
MO-myomasp
0.2μm
skeletal muscle
1µm
MO-control
skeletal muscle
MO-control
MO-myomasp
MO-control
0.2μm
skeletal muscle
0.2µm
Supplemental Figure III
MO-control
0.2μm
55 kDa
Supplemental Figure IV
AdmiMyomasp
α-tubulin
AdmiMyomasp
165 kDa
AdmiNEG
MYOM2