International Journal of Systematic and Evolutionary Microbiology (2015), 65, 1083–1085
DOI 10.1099/ijs.0.000058
Reclassification of Deinococcus xibeiensis Wang
et al. 2010 as a heterotypic synonym of
Deinococcus wulumuqiensis Wang et al. 2010
Sunhee Hong,1 Christine E. Farrance,1 Anne Russell1 and Hana Yi2,3
Correspondence
Hana Yi
[email protected]
1
Charles River Laboratories, Endotoxin and Microbial Detection, Newark, DE, USA
2
Department of Public Health Science, Graduate School, Korea University, Seoul, Republic of Korea
3
School of Biosystem and Biomedical Science, Korea University, Seoul, Republic of Korea
Two species of the genus Deinococcus, namely Deinococcus wulumuqiensis Wang et al. 2010
and Deinococcus xibeiensis Wang et al. 2010, were simultaneously proposed and described in
the same publication. However, the identical 16S rRNA gene sequence of the two type strains
strongly raised the probability of their relatedness at the species level. Thus, the genomic
relatedness of the two species of the genus Deinococcus was investigated here to clarify their
taxonomic status. The high (99.9 %) average nucleotide identity (ANI) between the genome
sequences of the two type strains suggested that the two species are synonymous. Additional
phenotypic data including enzymic activities and substrate-utilization profiles showed no
pronounced differences between the type strains of the two species. Data from this study
demonstrated that the two taxa constitute a single species. According to Rule 42 of the
Bacteriological Code, we propose that D. xibeiensis Wang et al. 2010 should be reclassified as a
subjective heterotypic synonym of D. wulumuqiensis Wang et al. 2010.
The genus Deinococcus, the type genus of the family Deinococcaceae, comprises 49 recognized species at the time of
writing (Parte, 2014). Two of the species, namely Deinococcus wulumuqiensis and Deinococcus xibeiensis, were proposed simultaneously in the same publication in 2010
(Wang et al., 2010). The two type strains, designated R12T
for D. wulumuqiensis and R13T for D. xibeiensis, were isolated
from radiation-polluted soil and resistant to gamma radiation. According to the original descriptions (Wang et al.,
2010), the two type strains shared 58.5 % DNA–DNA
relatedness even though they showed high (99 %) 16S rRNA
gene sequence similarity. In addition, lots of phenotypic
properties supported the separation of the two strains into
two independent species (Wang et al., 2010). However, in
our recent resequencing trials, the 16S rRNA gene sequences
of the two type strains were identical and this raised the
possibility that the two species are heterotypic synonyms.
Thus, we decided to re-evaluate the taxonomic relationship
of D. xibeiensis and D. wulumuqiensis by examining genomic
and phenotypic properties.
The type strains of the two species were obtained from
DSMZ (D. wulumuqiensis DSM 28115T and D. xibeiensis
Abbreviation: MALDI-TOF, matrix-assisted laser desorption/ionization
time-of-flight.
The GenBank/EMBL/DDBJ accession numbers for the 16S rRNA gene
sequences of strains DSM 28115T and DSM 28106T are KJ784486
and KJ784487, respectively.
000058 G 2015 IUMS
DSM 28106T) and maintained on tryptone-glucose-yeast
extract (TGY) medium at 30 uC as described previously
(Wang et al., 2010). The phenotypic characteristics were
examined using API 20NE and API ZYM kits. The two test
strains demonstrated exactly the same profiles in the API
galleries tested in this study. The detailed results of biochemical tests are presented in the species description.
PCR amplification and sequencing of the 16S rRNA gene
were performed using 5F (TGGAGAGTTTGATCCTGGCTCAG), 531R (TACCGCGGCTGCTGGCAC), 515F (TGCCAGCAGCCGCGGTAA), 1104R (TCGTTGCGGGACTTAACC), 1087F (GGTTAAGTCCCGCAACGA) and 1540R
(AAGGAGGTGATCCAACCGCA) primers. The 16S rRNA
gene sequences of strains DSM 28115T and DSM 28106T
showed 100 % sequence similarity. The newly determined
16S rRNA gene sequences were aligned together with
members of the genus Deinococcus using EzEditor (Jeon et al.,
2014), and analysed phylogenetically using MEGA 6.06
(Sohpal et al., 2010). Evolutionary distance was calculated
on the basis of the Jukes and Cantor model (Jukes & Cantor,
1969) and phylogenetic trees were inferred on the basis of
the neighbour-joining (Saitou & Nei, 1987) and maximumlikelihood (Felsenstein, 1993) models. The tree topologies
were evaluated by bootstrap analyses (Felsenstein, 1985). D.
wulumuqiensis DSM 28115T and D. xibeiensis DSM 28106T
formed a single phyletic line and the next closest relative was
Deinococcus radiodurans DSM 20539T (Fig. 1). The two
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 20:04:44
Printed in Great Britain
1083
S. Hong and others
Deinococcus caeni Ho-08T (DQ017709)
Deinococcus
indicus Wt/1aT (JQ346735)
0.01
100
Deinococcus aquaticus PB314T (DQ017708)
Deinococcus depolymerans TDMA-24T (AB264134)
75
‘Deinococcus radiotolerans’ C1 (KC771028)
Deinococcus daejeonensis MJ27T (JF806527)
78
77
Deinococcus grandis DSM 3963T (Y11329)
97
Deinococcus deserti VCD115T (CP001114)
Deinococcus hohokamensis KR-40T (AY743256)
100
99
Deinococcus navajonensis KR-114T (AY743259)
Deinococcus aquatilis DSM 23025T (ARKH01000011)
Deinococcus ficus CC-FR2-10T (AY941086)
Deinococcus radiodurans DSM 20539T (Y11332)
89
Deinococcus wulumuqiensis DSM 28115T (KJ784486)
100
100 Deinococcus xibeiensis DSM 28106T (KJ784487)
Deinococcus gobiensis I-0T (CP002191)
Deinococcus hopiensis KR-140T (AY743262)
Deinococcus geothermalis DSM 11300T (CP000359)
99
Deinococcus murrayi DSM 11303T (AXWT01000018)
Fig. 1. Neighbour-joining tree based on 16S rRNA gene sequences showing relationships among strains D. wulumuqiensis
DSM 28115T and D. xibeiensis DSM 28106T and members of the genus Deinococcus. Numbers at nodes are given as
percentages and represent the levels of bootstrap support (.70 %) based on neighbour-joining analyses of 1000 resampled
datasets. Filled circles indicate that the corresponding nodes (groupings) are also recovered in the maximum-likelihood tree.
Bar, 0.01 nucleotide substitutions per position.
strains and D. radiodurans DSM 20539T formed a wellsupported clade (bootstrap value of 100) that was distinct
from other members of the genus Deinococcus.
manufacturer’s parameters. Spectra were also imported into
MALDI Biotyper 3.1 offline client software, where a gel-view
comparison of spectra was generated using default parameters.
To re-evaluate the genomic relatedness of the two species,
the average nucleotide identity (ANI; Goris et al., 2007;
Konstantinidis & Tiedje, 2005) between the genome
sequences of D. wulumuqiensis R12T (APCS01000000; Xu
et al., 2013) and D. xibeiensis R13T (AXLL01000000; Hu et
al., 2013) was calculated by using jspecies 1.2.1 (Auch et al.,
2010). In the given pair of genomes, the ANI was 99.9 %.
An ANI of 94–96 % has been suggested as the substitute for
a 70 % DNA–DNA hybridization value (Auch et al., 2010;
Goris et al., 2007; Kim et al., 2014; Konstantinidis & Tiedje,
2005; Richter & Rosselló-Móra, 2009).
The spectra acquired from the MALDI-TOF analysis of D.
wulumuqiensis and D. xibeiensis were compared with those
from D. radiodurans DSM 20539T and Deinococcus ficus
DSM 19119T. Visual comparison of the protein profile
alignment and gel-view comparison (Fig. 2) indicate that
the spectra acquired from D. wulumuqiensis and D. xibeiensis
exhibit nearly identical patterns that match more closely to
each other than to the patterns from other closely related
strains: D. radiodurans DSM 20539T or D. ficus DSM 19119T.
For matrix-assisted laser desorption/ionization time-of-flight
mass spectrometry (MALDI-TOF MS) analysis, bacterial
extracts were prepared from fresh colonies using the extraction procedure recommended by the manufacturer (Bruker
Daltonics) and described previously (Mellmann et al., 2008).
Extracts were pipetted onto a polished steel target plate and,
once air-dried, overlaid with a saturated a-cyano-4-hydroxycinnamic acid (CHCA) matrix solution. AutoXecute acquisition control software was used to automatically acquire
sample spectra (1000 spectra per spot) on a Bruker Daltonics
autoflex equipped with a 337 nm nitrogen laser operating in
linear positive mode (delay: 170 ns; ion source 1 (IS1)
voltage: 19.5 kV; ion source 2 (IS2) voltage: 18.17 kV; lens
voltage: 7 kV; mass range: 2 kDa to 20 kDa) and running
flexControl 3.3. Spectra were imported into flexAnalysis
3.3 to normalize and align mass peaks through calibration, baseline subtraction and mass-peak smoothing using
1084
On the basis of the genomic and phenotypic results
presented in this study, we conclude that D. xibeiensis is
indistinguishable from D. wulumuqiensis at the species
level. According to Rule 42 of the Bacteriological Code
(Lapage et al., 1992), if two taxa of the same rank are
united and the names are of the same date, the priority of
names is determined by the author who first unites the
taxa. Thus, we propose D. wulumuqiensis should be used
for the united taxon, with D. xibeiensis as a subjective
heterotypic synonym.
Emended description of Deinococcus
wulumuqiensis Wang et al. 2010
The characteristics of this species are as described by Wang
et al. (2010), with the following amendment. Weakly hydrolyses gelatin, but not aesculin. Does not reduce nitrate or
ferment D-glucose. Does not produce indole, arginine
dihydrolase, urease or b-galactosidase. Assimilates D-glucose
Downloaded from www.microbiologyresearch.org by
International Journal of Systematic and Evolutionary Microbiology 65
IP: 88.99.165.207
On: Sun, 18 Jun 2017 20:04:44
Deinococcus wulumuqiensis
Deinococcus ficus DSM 19119T
Deinococcus radiodurans DSM 20539T
Deinococcus xibeiensis DSM 28106T
Deinococcus wulumuqiensis DSM 28115T
0
500
1000
2
Distance level
4
6
m/z
8
10
12
(103)
Fig. 2. Protein profile and gel-view comparison of four species of the genus Deinococcus species generated by MALDI-TOF
MS. m/z, mass to charge ratio.
and malic acid, but not arabinose, mannose, mannitol, Nacetylglucosamine, maltose, gluconate, caprate, adipate,
citrate or phenylacetate. Produces alkaline phosphatase,
esterase (C4), esterase lipase (C8), leucine arylamidase, acid
phosphatase, naphthol-AS-BI-phosphohydrolase and aglucosidase, but not lipase (C14), valine arylamidase, cystine
arylamidase, trypsin, a-chymotrypsin, a-galactosidase, bgalactosidase, b-glucuronidase, b-glucosidase, N-acetyl-bglucosaminidase, a-mannosidase or a-fucosidase.
The type strain is R12T (5DSM 28115T5CGMCC 1.8884T5
NBRC 105665T). The GenBank accession numbers for the
16S rRNA gene sequence and the whole genome sequence of
the type strain are KJ784486 and APCS01000000, respectively.
Jeon, Y. S., Lee, K., Park, S. C., Kim, B. S., Cho, Y. J., Ha, S. M. & Chun, J.
(2014). EzEditor: a versatile sequence alignment editor for both rRNA-
and protein-coding genes. Int J Syst Evol Microbiol 64, 689–691.
Jukes, T. H. & Cantor, C. R. (1969). Evolution of protein molecules.
In Mammalian Protein Metabolism, vol. 3, pp. 21–132. Edited by
H. N. Munro. New York: Academic Press.
Kim, M., Oh, H. S., Park, S. C. & Chun, J. (2014). Towards a taxonomic
coherence between average nucleotide identity and 16S rRNA gene
sequence similarity for species demarcation of prokaryotes. Int J Syst
Evol Microbiol 64, 346–351.
Konstantinidis, K. T. & Tiedje, J. M. (2005). Genomic insights that
advance the species definition for prokaryotes. Proc Natl Acad Sci
U S A 102, 2567–2572.
Lapage, S. P., Sneath, P. H. A., Lessel, E. F., Skerman, V. B. D.,
Seeliger, H. P. R. & Clark, W. A. (editors) (1992). International Code of
Nomenclature of Bacteria (1990 Revision). Bacteriological Code.
Washington, DC: American Society for Microbiology.
Acknowledgements
This work was supported by Basic Science Research Programs through the
National Research Foundation of Korea (NRF) funded by the Ministry of
Science, ICT, and Future Planning (NRF-2013R1A1A3010041). We are
grateful to Nazer Patel for helping with the MALDI-TOF analysis.
Mellmann, A., Cloud, J., Maier, T., Keckevoet, U., Ramminger, I.,
Iwen, P., Dunn, J., Hall, G., Wilson, D. & other authors (2008).
Evaluation of matrix-assisted laser desorption ionization-time-offlight mass spectrometry in comparison to 16S rRNA gene sequencing
for species identification of nonfermenting bacteria. J Clin Microbiol
46, 1946–1954.
References
Parte, A. (2014). List of prokaryotic names with standing in
nomenclature. http://www.bacterio.net
Auch, A. F., von Jan, M., Klenk, H. P. & Göker, M. (2010). Digital DNA-
DNA hybridization for microbial species delineation by means of
genome-to-genome sequence comparison. Stand Genomic Sci 2, 117–134.
Richter, M. & Rosselló-Móra, R. (2009). Shifting the genomic gold
standard for the prokaryotic species definition. Proc Natl Acad Sci
U S A 106, 19126–19131.
Felsenstein, J. (1985). Confidence limits on phylogenies: an approach
Saitou, N. & Nei, M. (1987). The neighbor-joining method: a new
using the bootstrap. Evolution 39, 783–791.
method for reconstructing phylogenetic trees. Mol Biol Evol 4, 406–425.
PHYLIP (phylogenetic inference package)
version 3.5c. Distributed by the author. Department of Genome
Sciences, University of Washington, Seattle, USA.
Sohpal, V. K., Dey, A. & Singh, A. (2010). MEGA biocentric software for
Goris, J., Konstantinidis, K. T., Klappenbach, J. A., Coenye, T.,
Vandamme, P. & Tiedje, J. M. (2007). DNA-DNA hybridization
Wang, W., Mao, J., Zhang, Z., Tang, Q., Xie, Y., Zhu, J., Zhang, L., Liu,
Z., Shi, Y. & Goodfellow, M. (2010). Deinococcus wulumuqiensis sp.
values and their relationship to whole-genome sequence similarities.
Int J Syst Evol Microbiol 57, 81–91.
nov., and Deinococcus xibeiensis sp. nov., isolated from radiationpolluted soil. Int J Syst Evol Microbiol 60, 2006–2010.
Hu, Y., Xu, X., Song, P., Jiang, L., Zhang, Z. & Huang, H. (2013). Draft
Xu, X., Jiang, L., Zhang, Z., Shi, Y. & Huang, H. (2013). Genome
genome sequence of Deinococcus xibeiensis R13, a new carotenoidproducing strain. Genome Announc 1, e00987-13.
sequence of a gamma- and UV-ray-resistant strain, Deinococcus
wulumuqiensis R12. Genome Announc 1, e-00206-13.
Felsenstein, J. (1993).
http://ijs.sgmjournals.org
sequence and phylogenetic analysis: a review. Int J Bioinform Res Appl
6, 230–240.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 20:04:44
1085