Purdue University
Purdue e-Pubs
Birck and NCN Publications
Birck Nanotechnology Center
6-2014
Effect of T-DNA insertions on mRNA transcript
copy numbers upstream and downstream of the
insertion site in Arabidopsis thaliana explored by
surface enhanced Raman spectroscopy
Ulhas Kadam
Purdue University, Birck Nanotechnology Center, Bindley Bioscience Center, [email protected]
Claudia A. Moeller
Eberhard-Karls-Universitat Tubingen
Joseph Irudayaraj
Purdue University, Birck Nanotechnology Center, Bindley Bioscience Center, [email protected]
Burkhard Schulz
Purdue University, [email protected]
Follow this and additional works at: http://docs.lib.purdue.edu/nanopub
Part of the Nanoscience and Nanotechnology Commons
Kadam, Ulhas; Moeller, Claudia A.; Irudayaraj, Joseph; and Schulz, Burkhard, "Effect of T-DNA insertions on mRNA transcript copy
numbers upstream and downstream of the insertion site in Arabidopsis thaliana explored by surface enhanced Raman spectroscopy"
(2014). Birck and NCN Publications. Paper 1636.
http://dx.doi.org/10.1111/pbi.12161
This document has been made available through Purdue e-Pubs, a service of the Purdue University Libraries. Please contact [email protected] for
additional information.
Plant Biotechnology Journal (2014) 12, pp. 568–577
doi: 10.1111/pbi.12161
Effect of T-DNA insertions on mRNA transcript copy
numbers upstream and downstream of the insertion site
in Arabidopsis thaliana explored by surface enhanced
Raman spectroscopy
Ulhas Kadam1,2,3,4, Claudia A. Moeller5, Joseph Irudayaraj,1,3,4,* and Burkhard Schulz2,*
1
Department of Agricultural & Biological Engineering, Purdue University, West Lafayette, IN, USA
2
Department of Horticulture & Landscape Architecture, Purdue University, West Lafayette, IN, USA
3
Bindley Bioscience Center, Purdue University, West Lafayette, IN, USA
4
Birck Nanotechnology Center, Purdue University, West Lafayette, IN, USA
ZMBP, University of Tu€bingen, Tu€bingen, Germany
5
Received 16 April 2013;
revised 12 December 2013;
accepted 15 December 2013.
*Correspondence (fax 765 496 1115;
email [email protected]) and
(fax 765 494 0363;
email [email protected])
Keywords: mRNA accumulation,
quantification, surface-enhanced
Raman spectroscopy, Arabidopsis
thaliana, T-DNA insertion, gene
expression.
Summary
We report the effect of a T-DNA insertion on the expression level of mRNA transcripts of the
TWISTED DWARF 1 (TWD1) gene upstream and downstream of the T-DNA insertion site in
Arabidopsis. A novel approach based on surface-enhanced Raman spectroscopy (SERS) was
developed to detect and quantify the effect of a T-DNA insertion on mRNA transcript
accumulation at 5′- and 3′-ends of the TWD1 gene. A T-DNA insertion mutant in the TWD1 gene
(twd1-2) was chosen to test the sensitivity and the feasibility of the approach. The null mutant of
the FK506-like immunophilin protein TWD1 in Arabidopsis shows severe dwarfism and strong
disoriented growth of plant organs. A spontaneous arising suppressor allele of twd1-2 called
twd-sup displayed an intermediate phenotype between wild type and the knockout phenotype
of twd1-2. Both twd1 mutant alleles have identical DNA sequences at the TWD1 locus including
the T-DNA insertion in the fourth intron of the TWD1 gene but they show clear variability in the
mutant phenotype. We present here the development and application of SERS-based mRNA
detection and quantification using the expression of the TWD1 gene in wild type and both
mutant alleles. The hallmarks of our SERS approach are a robust and fast assay to detect up to
0.10 fM of target molecules including the ability to omit in vitro transcription and amplification
steps after RNA isolation. Instead we perform direct quantification of RNA molecules. This
enables us to detect and quantify rare RNA molecules at high levels of precision and sensitivity.
Introduction
T-DNA insertion mutagenesis is a commonly used method of
generating ‘loss-of-function’ mutants in plants. It provides a basis
for reverse genetic approaches. This method is predominantly
used to characterize gene functions and to elucidate regulatory
mechanisms in Arabidopsis and rice (Feldmann, 1991; Forsthoefel
et al., 1992; An et al., 2003; Sallaud et al., 2004). Insertion
mutagenesis provides evidence for the function and metabolic
activity of plant genes (Azpiroz-Leehan and Feldmann, 1997;
Errampalli et al., 1991; Koncz et al., 1992). Today, T-DNA
insertion mutagenesis is a well-established method of obtaining
knockout mutants to study the function of a specific plant gene.
This was made possible by generating libraries of knockout
mutants for all Arabidopsis genes (Alonso et al., 2003; Rosso
et al., 2003; Samson et al., 2002; Sessions et al., 2002). It is
understood that loss-of-function occurs due to the disruption
of gene transcription. T-DNA insertions not only disrupt the
expression of mutagenized genes but also act as a molecular
marker for the subsequent selection and identification of the
T-DNA-induced mutation. T-DNA insertions in Arabidopsis genes
568
(coding region including intron sequences) lead to the disruption
of the gene sequence and in most cases to a complete loss of the
gene function (knockout). A population of more than 25 000
sequenced T-DNA insertions generated with a 5.8 kb T-DNA
insertion element revealed an insertion distribution of 64% and
36% between exon and intron sequences, respectively. All seven
of 14 separately tested genes that contained T-DNA insertions in
introns showed functional disruption of the genes through
sequencing and phenotyping (Rosso et al., 2003). These results
indicate that even T-DNA insertions in introns are functionally
disruptive. Most T-DNA insertion elements used for the creation
of large T-DNA insertion populations are between 4.3 and 7.2 kb
in length. These relatively short T-DNAs provide a higher
transformation efficiency and easier molecular analysis of the
inserted fragments. However, the T-DNA used in this paper
(pGV3850:1003) is much larger as it contains left (LB) and right
border (RB) sequences as well as two copies of the pBR322 E. coli
plasmid, a kanamycin resistance gene for selection in plants under
control of the mas 1′ promoter and the kanamycin resistance
gene from transposon Tn903 for selection in bacteria (Figure 1).
The entire T-DNA covers a length of 16.9 kb (Schulz et al., 1995).
ª 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd
T-DNA insertions and mRNA quantification by SERS 569
The cessation of transcription of T-DNA disrupted genes is due
to premature transcription termination when the RNA polymerase
fails to transcribe the entire gene (Matsumoto, 1994). This is likely
based on the inability of RNA polymerase to run through long
T-DNA inserts of 5–17 kb in length (Hsu, 2009). No detailed study
of the effect of a T-DNA insertion on the accumulation of mRNA
transcripts from the 5′ and 3′ region of the mutated gene in a
T-DNA insertion mutant is available to date. We contribute a
valuable tool for the study of the expression of T-DNA mutagenized genes with the development of a surface-enhanced
Raman spectroscopy (SERS) method to detect and quantify the
mRNA transcripts upstream (5′-end) and downstream (3′-end) of
a T-DNA insertion in the TWISTED DWARF1 (TWD1) gene of
Arabidopsis.
TWD1 belongs to the FK506-binding protein (FKBP) family in
plants. Together with cyclophilins, FKBPs form the superfamily of
immunophilins (Romano et al., 2005). This is a ubiquitous protein
family, found in all classes of organisms, and known to function
as intracellular receptors for the immunosuppressive drugs
FK506, rapamycin, and cyclosporinA in animals and humans.
TWD1, also known as FKBP42 (At3G21640), is a multidomain
protein, which is the only membrane-associated FKBP-like protein
of plant origin (Geisler et al., 2003; Kamphausen et al., 2002).
TWD1 functions at the tonoplast as well as at the plasma
membrane and the ER membrane system. This unique localization pattern is determined by the molecular interaction of TWD1
with two pairs of ABC transporters, ABCC1/ABCC2 at the
Figure 1 Molecular structure of TWD1 with and without T-DNA
insertions. Schematic depictions of the TWD1 gene from Arabidopsis
(At3G21460) with eight exons (blue boxes) and seven introns (black bars).
Light blue boxes represent noncoding regions at 5′ and 3′ ends of the
gene. The TWD1 gene is 2548 bp long (Figure S4). The upper half of the
figure shows the structure of the T-DNA mutated twd1 gene. A tandem
head-to-head oriented T-DNA from pGV3850:1003 is inserted into the
fourth intron with left border sequences pointing outward. The T-DNA
elements are depicted as follows: left T-DNA border (LB), E. coli plasmid
copy of pBR322 (pBR), kanamycin resistance gene for expression in
bacteria, originated from transposon Tn903 (Tn903), kanamycin resistance
gene for selection in plants cells from transposon Tn5 under control of mas
1′ promoter (P1′-NPTII), right T-DNA border (RB). One copy of the
integrated T-DNA is 16.9 kb in length. The entire T-DNA insertion has a
length of more than 33.8 kb. The T-DNA insertion is not drawn to scale.
The quantitative Real-Time PCR (qRT-PCR) primers used to quantify
accumulation of TWD1 mRNA at the 5′- (TWD1-5′F3 and TWD1-5′R3) and
the 3′-end (TWD1-3′F2 and TWD1-3′R2) of TWD1 are indicated as black
(forward primers) and red (reverse primers) arrows. Positions used for TS
hybridization upstream and downstream of the T-DNA insertions are
indicated as red horizontal bars over the third and eighth exon.
vacuole and ABCB1/ABCB19 at ER and plasma membrane,
respectively (Geisler et al., 2003, 2004; Wu et al., 2010). The
interaction of TWD1 with the P-type ABC transporters ABCB1
and ABCB19 has been shown to be essential for ABCB mediated
export of the plant hormone auxin, which is critical for plant
development (Bouchard et al., 2006; Geisler et al., 2003). The
Arabidopsis null mutant twisted dwarf1 (twd1) shows dramatic
phenotypes similar to the double mutant of abcb1/abcb19 with
coinciding phenotypic effects such as reduced hypocotyl and root
length, epinastic rosette leaf growth, and disoriented organ
growth of stems and roots (Geisler et al., 2003; Weizbauer et al.,
2011; Wu et al., 2010) (Figure 2). Auxin transport as well as
increased auxin levels in root tissues in both the twd1 and abcb1/
abcb19 mutants suggest that the observed phenotypes in both
mutants are due to the defect in cellular auxin export (Geisler
et al., 2003).
At present, a variety of molecular biology, microscopy and
fluorescence-based assays are available to determine gene
expression (Kadam et al., 2013). PCR-based methods such as
quantitative Real-Time PCR (qRT-PCR) are often used for the
quantification of gene expression (Richards et al., 2012). However, these assays are laborious, expensive, and need extensive
data analysis skills (Bustin et al., 2009). The need for internal
control genes for comparative analysis makes qRT-PCR a tedious
assay for the quantification of low copy number mRNA transcripts. A major source for errors that are immanent to the
experimental design of PCR-based molecule quantification is the
necessity to include cDNA synthesis steps, which are still the most
error-prone steps in a procedure. Microscopy or the fluorescencebased quantification of gene expression are attractive approaches,
yet they suffer from intense autofluorescence generated by
endogenous plant pigments such as anthocyanins and chlorophyll
(Bao et al., 2009; Bohanec et al., 2002; Borges et al., 2008; Choi
et al., 2009; Darzacq et al., 2009; Dirks and Tanke, 2006). These
approaches can provide only semi-quantitative information, at
best. Classical molecular assays, such as Northern blot hybridiza-
Figure 2 Whole-plant phenotypes of wild type, twd1-2, and twd-sup
plants. Greenhouse grown plants of wild type, twd1-2, and twd-sup are
shown at flowering stage. All plants were grown in 5 cm pots with
Premier Promix BX. Size bar represents 1 cm.
ª 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd, Plant Biotechnology Journal, 12, 568–577
570 U. Kadam et al.
tion and ribonuclease protection assays, are even less sensitive.
Microarray hybridization experiments allow the assessment of
gene expression in a high-throughput manner (Schena et al.,
1995) and have been used for plant gene expression analysis (Alba
et al., 2004). However, they demand large quantities of RNA
samples as hybridization probes and are less useful in performing
gene-specific detection and quantification of low copy number
transcripts (Carter et al., 2005; The MAQC Consortium, 2006). In
general, most traditional assays are less useful for the detection of
lowly expressed mRNA transcripts (Sun and Irudayaraj, 2009b). A
robust assay to detect the level of mRNA transcripts affected by
the T-DNA insert is required to understand the nature of
mutations in these plants.
We developed and applied a highly sensitive SERS-based
method to explore the accumulation of TWD1 gene transcripts
upstream and downstream of a T-DNA insertion site. Transcript
quantification using SERS is founded on two important factors.
The first is a hybridization of DNA ‘capture oligonucleotides’ with
mRNA. The second is the detection of a probe-specific signal that
undergoes surface enhancement and signal amplification with
the use of nanoprobes (Figure 3). We used gold nanoparticles
(AuNPs) of 30 nm in diameter to produce uniform surface
enhancement (Figure S1). The use of organic labels with higher
cross-section areas conjugated to metal surfaces (Au or Ag)
provides significant increase in the Raman signal and can be
exploited to detect transcripts that are expressed in low copy
numbers. This principle has been successfully employed for the
detection of RNA and DNA (Cao et al., 2002; Graham et al.,
2008). The physical phenomenon of surface enhancement is
attributed to two effects: the electromagnetic (EM) effect and
the chemical effect of the metallic substrate surfaces at the
nanoscale (Cao et al., 2002; Faulds et al., 2004; Kneipp et al.,
2006). The EM effect is distance-dependent and decreases
exponentially with growing distance. Appropriate distance
between the Raman label and the AuNP surface is crucial to
obtain a strong and reproducible Raman signal. The distancedependent coupling effect (Lee and Irudayaraj, 2013) between
AuNPs is very sensitive and decreases significantly beyond a
distance of 25 nm.
Furthermore, surface-enhanced Raman spectroscopy has the
ability to provide >1012 fold enhancement in signal strength and
has attracted tremendous interest in enabling a wide range of
applications (Kneipp and Kneipp, 2006; Wang and Irudayaraj,
2013). Such high signal enhancement renders SERS a powerful
analytical tool for the detection of rare mRNA transcripts. After
initial optimization, Raman spectroscopy needs a minimum of
sample preparation and requires no PCR amplification steps. This
makes SERS a highly sensitive and accurate method for single
molecule detection of biomolecules such as DNA, RNA or
proteins. Additionally, it provides extensive chemical information
on living cells and their interactions with other biomolecules,
chemicals or environmental factors (Ravindranath et al., 2011;
Stephen et al., 2012; Sun and Irudayaraj, 2009a; Wang et al.,
2010).
Results and discussion
To study the feasibility and effectiveness of mRNA quantification
through SERS in plants, we chose a T-DNA insertion mutation in
the TWD1 gene of Arabidopsis. TWD1 is ubiquitously expressed
Figure 3 Schematic depiction of SERS-based quantification of TWD1 transcripts from T-DNA insertion mutants in twd1-2, twd1-sup and wild type.
(1) Target strand oligonucleotides (TS), which are complementary to the RNA sequence of interest, are used to select hybridizing RNA molecules out of a
total RNA population by DNA/RNA hybridization. RNA is depicted in red. RNA molecules of interest are depicted dark-red. Nonhybridizing single-stranded
RNA and DNA molecules are subsequently digested with S1 nuclease. (2) The remaining RNA/DNA hybrids are then incubated with NaOH to destroy the
RNA portion. The target strands (TS) remain in a concentration equivalent to the previously present RNA molecules of interest. (3) Capture strands (CS),
specific to the target mRNA sequence are immobilized on gold-coated glass slides followed by 6-mercaptohexanol treatment. (4) The TS are subsequently
hybridized to immobilized (CS) on glass slides. (5) Probing strand oligonucleotides (PS), which are complementary to the upper half of the TS, were
hybridized to the CS/TS complex on the glass slide. PS are covalently linked to Raman probe decorated nano-gold-particles, which are used for detection
and quantification in Raman spectroscopy. (6) Raman spectra are acquired for transcript quantification and processed for quantification.
ª 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd, Plant Biotechnology Journal, 12, 568–577
T-DNA insertions and mRNA quantification by SERS 571
throughout the plant at a relatively low level and is not
significantly regulated by endogenous or exogenous factors
(Figures S2 and S3) (Goda et al., 2008; Kilian et al., 2006;
Schmid et al., 2005; Winter et al., 2007). The tandem T-DNA
insertion in head-to-head orientation from pGV3850:1003 into
the fourth intron of TWD1 (At3G21640) at bp position 1146
(Figure S4) that has been found in the twd1-2 mutant leads to a
complete knock-out of the TWD1 gene. The entire insertion spans
a length of 33.8 kb. The phenotype of twd1-2 mutants is
indistinguishable from other twd1 knock-out alleles (Geisler
et al., 2003; Wu et al., 2010). A spontaneous mutation showing
an intermediate twd1 phenotype was found in a crossing
experiment of twd1-2 with Arabidopsis Ws-2 accessions. This
mutant allele of twd1-2 was termed twd-sup because it shows an
intermediate twd1-2 knock-out phenotype (Figure 2). Genetic
analysis of twd-sup revealed that the partial suppression of the
twd1 mutant phenotype in twd-sup is dominant because F1
plants from crosses of twd-sup with twd1-2 show only the twdsup suppressor phenotype. Crosses of twd-sup with Ws wild-type
plants were made to genetically separate the twd1-2 mutation
and a possible suppressor mutation. All plants of the F1
generation showed wild-type phenotype, which confirms the
recessive nature of the twd-sup mutation and rules out the
possibility that the twd-sup phenotype is caused by heterozygosity of the twd1-2 mutated locus in these plants. It was expected
that in the F2 and higher generations the segregation of wild
type, twd-sup and twd1-2 phenotypes would be observed if
twd1-2 and twd-sup are caused by two unlinked mutations.
However, closely linked twd1-2 and twd-sup mutations could be
mapped by the frequency of twd1-2 plants segregating in F2 and
following generations. Intragenic suppressors would not yield
twd1-2 phenotypes segregating in the F2 or later generations.
The expected segregation ratio in this case should be close to 3:1
(WT: twd-sup) with no observable twd1-2 phenotypes. The
segregation ratio of wild type, twd-sup and twd1-2 phenotypes
has been tested in F2, F3 and F4 generations from several
independent reciprocal crosses between Ws-2 and twd-sup
plants. A total of 26,284 plants have been tested. From these,
18 810 displayed wild-type phenotype and 7474 displayed twdsup phenotype. The phenotype of the twd1-2 mutant was not
observed in any of these plants (Table 1). This result indicates a
very high likelihood of an intragenic suppressor coupled with the
twd1-2 mutation. However, DNA sequencing of the entire TWD1
locus from twd1-2 and twd-sup plants including the tandem
insertion of the T-DNA showed sequence identity of the entire
locus in twd1-2 and in twd-sup plants. This does not support the
presence of an intragenic suppressor.
Adult twd-sup plants reach about 50% of wild type height,
whereas twd1-2 null mutants do not surpass 20% of the height
of the wild type (Figure 2). The epinastic growth behaviour of
rosette leaves is missing in twd-sup and the extreme disorientation in growth of stems, leaves, siliques and roots that was
Table 1 Segregation of twd-sup, twd1-2 and wild-type phenotypes
in reciprocal crosses of twd-sup and Ws-2 wild type
No.
No.
Ratio wt:
Cross
Total
plants
No. wt
twd-sup
twd1-2
twd-sup
twd-sup 9 Ws-2
26 284
18 810
7474
0
2.5 : 1
Ws-2 9 twd-sup
observed in twd1 null mutants (Geisler et al., 2003; Weizbauer
et al., 2011) is not as pronounced in twd-sup plants (Figure 2).
To develop and test a method for mRNA detection and
quantification using a SERS approach in cases of very low
accumulation of mRNA, we employed the genetically close plants
of Ws-2 with the intact TWD1 gene and the two isogenic T-DNA
mutations twd1-2 and twd-sup. They are ideal test cases to test
the limits of our new method. These plant lines allow the
assessment of mRNA accumulation in closely related genetic
material, which should express TWD1 mRNA sequences without
sequence alterations. In a first experiment, the expression of
mRNA sequences upstream and downstream of the T-DNA was
tested using semi-quantitative RT-PCR. Combinations of PCRprimers twdex1_f and twdex3_r were used to amplify cDNA
sequences encoded by the first three exons of the TWD1 gene
(Figure 4c,d). In all cases (twd1-2 (lane1), twd-sup (lane 2) and
wild type (lane 3), a 245 bp long PCR fragment is detected with
increasing intensity from twd1-2 over twd-sup to wild type. To
test the structure of the TWD1 locus in this region, the PCR with
the same primer combination was performed with genomic DNA
from twd1-2, twd-sup and wild type as template. As expected, a
PCR band of 800 bp length was detected in all three cases as
introns 1 and 2 increase the size of the amplified band. The
combination of primers twdex1-f and the T-DNA specific primer
LB2 amplified PCR products only from twd1-2 and twd-sup
mRNA (Figure 4b, lane 1 and 2). The respective PCRs with
genomic DNA as template resulted also only with twd1-2 and
twd-sup in an amplification of PCR products (Figure 4b, lane 4
and 5) as wild-type plants do not contain T-DNA sequences. The
primer combination twdex1_f and 6118 (Figure 4d, Table 2) was
used to amplify the entire TWD1 locus from exon 1 to 8, which
spans the entire TWD1 ORF (open reading frame) (Figure S4). PCR
products of the predicted length of 1200 and 2500 bp were
found only with cDNA or genomic DNA from the wild type. DNA
and cDNA from the mutant lines twd1-2 and twd-sup did not
yield any detectable PCR products with this primer combination
(Figure 4a). Transformation of twd1-2 null mutants with the
5′-end of the TWD1 gene under control of the constitutively
expressing CaMV 35S promoter did not result in a change of
phenotype (data not shown). The observed expression pattern
does not explain the differences in phenotype between twd1-2
and twd-sup plants. A more sensitive technology was needed to
assess the accumulation of mRNA in these two mutants because
we could not determine with RT-PCR whether the 3′-end of the
TWD1 is expressed at all or if the level of mRNA accumulation is
beyond the detection level of RT-PCR.
Total RNA was isolated from 4 to 5-week-old plants for the
analysis of TWD1 gene expression. This RNA served as nucleotide
target in the SERS assay as well as for cDNA synthesis in
confirmatory qRT-PCR experiments. The synthesis of AuNPs, the
conjugation of DNA oligonucleotides to nanoparticles, and the
validation of nanoprobes were performed in the next step. Finally,
we conducted a quantitative comparison of the results obtained
through SERS (Figure 5) along with the qRT-PCR as a validation of
the sensitivity and accuracy of the SERS-based mRNA quantification (Figure 6). To quantify the accumulation of TWD1 mRNA,
two different target sequences were selected and respective
probes designed to detect the TWD1 mRNA at the upstream and
downstream of the T-DNA insertion site in TWD1 (Figure 1).
Well-characterized SERS nanoprobes comprising of AuNPs
functionalized with Raman tags and ssDNA (probing strands,
PS) were used for uniform signal enhancement. The surface
ª 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd, Plant Biotechnology Journal, 12, 568–577
572 U. Kadam et al.
(a)
(b)
(c)
Figure 4 Semi quantitative detection of TWD1
mRNA upsteam and downstream of the T-DNA
insertion in twd1-2, twd-sup and wild-type.
RT-PCR on mRNA from twd1-2 (lane 1), twd-sup
(lane 2), and Ws-2 wild type (lane 3) as well as
PCR on genomic DNA from twd1-2 (lane 4),
twd-sup (lane 5), and Ws-2 wild type (lane 6) with
PCR primer combinations twdex1-f and twdex3_r
(a), twdex1_f and LB2 (b), twdex1_f and 6118 (c).
Water controls are in lane 7. All PCRs were
separated on 1% agarose gels after 34 PCR cycles.
(d)
Table 2 Oligonucleotide sequences used for RT-PCR
6118
5′- gggggtagatctttcacgttg -3′
twdex1
5′- acgacgagtcacactactcttgag -3′
twd_Nterm_r
5′- tccgaattcttaagcttgaccttcctttataatctgcttactg -3′
LB2
5′- gatgcactcgaaatcagccaattttagac -3′
ACTIN_f
5′- tggaactggaatggttaaggctg -3′
ACTIN_r
5′- tctccagagtcgagcacaatac -3′
RT-PCR, Real-Time PCR.
Figure 6 Relative mRNA accumulation measurements via quantitative
Real-Time PCR (qRT-PCR). Normalized relative mRNA accumulation level
from wild type (WT), twd1-2, and twd-sup using qRT-PCR. Accumulation
of mRNA of the 5′- and 3′-regions of the TWD1 gene was analysed with
qRT-PCR using the primers TWD1-5′F3 and TWD1-5′R3 for amplification
of the region upstream of the T-DNA insertion (5′-TWD1 region) as well as
the primers TWD1-3′F2 and TWD1-3′R2 for amplification downstream of
the T-DNA insertion (3′-TWD1 region). Primer binding sites are indicated in
Figure 1.
Figure 5 Normalized Raman peak intensities. Normalized Raman peak
intensities at 1075 cm 1 (Raman shift) of wild type (WT), twd1-2, and
twd-sup show the differences in mRNA accumulation of respective SERS
target sequences at the 5′- and the 3′-ends of the TWD1 gene.
morphology and structure of the bare and the DNA-conjugated
nanoparticles was determined using transmission electron microscopy (TEM), UV-VIS spectroscopy and determination of the zetapotential (f) using a Zeta-Sizer. TEM images of the synthesized
gold nanoparticles used in this study are shown in Figure 4a,b. A
treatment with 2% uranyl acetate negatively stained the conjugated gold nanoparticles. A clear halo of 1–2 nm surrounding the
AuNPs was visible. This indicated the attachment of thiolated
ssDNA (Figure S1). The UV-VIS spectra of AuNPs before DNAconjugation (peak at 528 nm) and after DNA-conjugation (peak
at 535 nm) were determined for cross validation of successful
DNA-conjugation. We found a ‘red’ shift in absorption as a
function of surface morphology and size in the UV-Vis spectra
(Figure S5). Additionally, the zeta-potential (f) of AuNPs was
measured to confirm the covalent attachment of thiolated
oligonucleotides. The surface charge and environmental ionic
conditions of the AuNP-DNA complex is a reporter of nanoparticle
stability. Therefore, it is important to quantify the surface charge
distribution of AuNP-DNA conjugates (Park and Hamad-Schifferli,
2010; Park et al., 2010).
Figure 3 shows a schematic overview of the key steps involved
in the SERS-based quantification of mRNA transcripts from plants.
The detection and quantification of mRNA transcripts is based on
two principles. The first is the mechanism of DNA-RNA hybridization (‘Watson-Crick’ base-pairing) to capture mRNA transcripts
in a sequence specific manner. The second is the signal
enhancement by nanotags (ssDNA-AuNP-RTag) to obtain specific
and robust Raman signals. Quantification was accomplished by
establishing a calibration curve with known concentrations of
target strand DNA oligonucleotides. Gold-coated glass slides were
covered with a silicone mask to construct an array of holes of
3 mm in diameter to load the samples and to avoid cross
contamination of neighbouring sample spots. The thiolated
capture strand (CS, 10 nM) has sequence complementary to the
downstream half of the target strand (TS) and was immobilized
onto the well surface via a strong ‘Gold-Sulfur’ covalent interaction (Cao et al., 2002; Faulds et al., 2002; Lee et al., 2011). The
uncovered gold slide surface was blocked with a layer of
6- mercaptohexanol (Figure 3). This treatment inhibits nonspecific binding of the Raman probes onto the gold surface
(Sun and Irudayaraj, 2009a,b). In the next step, the TS was
hybridized to CS through hydrogen bonds due to complementary
base paring of the nucleotides. Finally, the nanoprobes consisting
of the PS-AuNP-RTag complex were hybridized to the 3′ half of
the TS, which completes the ‘Raman sandwich structure’.
ª 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd, Plant Biotechnology Journal, 12, 568–577
T-DNA insertions and mRNA quantification by SERS 573
A standard curve and its correlation was obtained using a
broad range of concentrations of TS oligonucleotides (from
10.0 nM to 0.10 fM) for target mRNA quantification. This curve
was used to assess the limit of Raman detection. Mercaptobenzoic acid (MBA), a non-fluorescent Raman tag, was used in this
study. The characteristic Raman shift peak of MBA at 1075 cm 1
(wavenumber) was chosen (Figure 7) for quantification because
of the dominant fingerprint at this peak. After acquisition of the
spectra, a baseline correction of each spectrum was performed
and the plasmon-phonon band (180–230 cm 1) used as a selfreferencing parameter for normalization. This plasmon-phonon
band arises from nanoparticle/nanoparticle interactions and is
established as an internal standard as described in our previous
work (Ravindranath et al., 2012). The corrected peak (I1075)
(Figure 7) was normalized against the corrected plasmon-phonon
band (I~220), that is, In = I1075/I220. Similar normalization processes
were performed with control samples and the In obtained for
controls were subtracted from the samples used for calibration. A
minimum of five replications was used for analysis and normalization was performed independently. The data points were fitted
in the graph and a correlation coefficient (R2 = 0.9775) representing the calibration to predict the concentration of TS from the
intensity of MBA (using the peak at 1075 cm 1) was obtained
(Figure 7). The calibration method for the ‘sandwich assay’
accounts for all the variations in nanoparticles, including surface
features, size of the particle, and Raman tag variations involved in
synthesis, sample preparation and detection. Calibrations performed with this approach can be applied to a wide range of
samples.
The twd1-2 and twd-sup mutants have the identical DNA
sequence at the TWD1 locus. Despite the knockout of the TWD1
gene by the same T-DNA insertion, both identical genotypes
display clearly distinct phenotypes (Figure 2). The dramatic
phenotypic changes induced by the twd1 knockout mutation
such as strong epinasty of rosette leaves, disoriented growth of all
areal organs, and severe dwarfism occur in a much milder form in
twd-sup plants. This observation suggested differences in mRNA
accumulation in both lines and encouraged us to use these plants
to determine the accumulation of TWD1 mRNA. As the expression of the TWD1 gene is ubiquitous but generally low in
Arabidopsis (Winter et al., 2007), these wild-type and mutant
lines provide very suited material to test the feasibility and
sensitivity of mRNA quantification via SERS. Our hypothesis for
the variability of the mutant phenotype in twd1-2 and twd-sup is
a suppression function, which shows tight linkage with the TWD1
locus in twd-sup mutant plants. Crosses of twd-sup with wildtype plants showed wild-type uniformity in the F1 generation.
However, the F2 plants show segregation of 3:1 of wild type and
twd-sup phenotypes. No twd1-2 phenotypes could be found in
more than 20 000 F2 plants scored. Genetic analysis also showed
that the suppressor function is dominant over twd1-2 as all F1
offspring from crosses of twd1-2 with twd-sup show the
intermediate twd-sup suppressor phenotype. Null mutant phenotypes of the TWD1 gene were not found in these crosses. This
unusual segregation behaviour combined with total sequence
identity of the TWD1 locus in twd1-2 and twd-sup plants led us to
assume that an epigenetic effect rather than a second site
suppressor mutation is responsible for the partial reversion of the
twd1-2 phenotype in twd-sup plants. Using SERS to determine
the accumulation of mRNA upstream and downstream of the
inserted T-DNA we found that mRNA accumulation upstream of
the T-DNA insertion was relatively high in wild-type (4600 pM)
and twd-sup (100 pM) plants, whereas twd1-2 plants showed
only very minute accumulation (0.54 pM) of this part of the mRNA
(Table 3).
Accumulation of 3′-end sequences downstream of the insertion site of the T-DNA followed this accumulation pattern. Again
the wild type (13.6 pM) and twd-sup (0.27 pM) showed measurable amounts of mRNA accumulation, whereas these sequences
in twd1-2 (0.016 pM) were hardly detectable (Table 3). In all
cases, 5′-end molecules accumulated to much higher levels than
3′-end derived molecules. This may be due to the initiation of RNA
molecules not yet fully transcribed or aborted mRNA transcription, which would result in accumulation of more 5′-end than
3′-end sequences in any of the tested lines. The likely fate of
aborted and shortened RNA transcripts is rapid degradation in the
cell, which would also result in accumulation of less transcripts of
the 3′-end of TWD1. A validation experiment using qRT-PCR to
measure the relative expression of TWD1 was performed using
the same pools of mRNA prepared from wild type, twd1-2 and
twd-sup plants. We found that the detection of 3′- and 5′-end
using qRT-PCR followed the same patterns as with SERS
detection. However, the recorded relative expression differences
were much less pronounced with qRT-PCR than with SERS. This
could be due to the steps involved in reverse transcription and
repeated amplification through taq polymerase whose activities
and fidelity are also dependent on sequence composition of the
Table 3 Absolute quantification of 5′ and 3′ mRNA transcripts of
TWD1 from wild type, twd1-2 and twd-sup using SERS
Figure 7 Comparison of the entire spectra acquired with known
concentrations of target strand to generate a standard curve. The spectra
shown range from 450 to 1700 wavenumbers (normalized to the
plasmon-phonon band (at 230 cm 1) as a self-referencing standard). Inset
shows a calibration curve for the quantification of TWD1 gene transcripts.
The concentrations of ssDNA that were used to establish the calibration
curve range from 10 16 to 10 8 M ssDNA.
Genotype
5′-TWD1 (pM)
3′-TWD1 (pM)
Wild type
4600 54.4
twd1-2
0.54 0.047
0.016 0.023
13.6 0.19
twd-sup
100 1.23
0.27 0.079
SERS, Surface-Enhanced Raman Spectroscopy; TWD1, TWISTED DWARF 1.
Listed are the quantified mRNA molecules in pM. The quantification of mRNA
was performed according to Sun and Irudayaraj (2009b).
ª 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd, Plant Biotechnology Journal, 12, 568–577
574 U. Kadam et al.
template, among other factors. Thanks to continuously decreasing cost for deep sequencing technology, RNAseq as a method
for whole-genome transcriptome analysis is getting ever more
popular. This method allows an estimate of the expression level of
RNAs from a plant sample as the sequenced reads (in most cases
about 100 bp long) can be quantified after alignment with the
genome sequence. However, this method also relies on transcription of the entire mRNA population into cDNA via the reverse
transcriptase enzyme. This step is relatively error-prone and
biased towards sequence composition of the RNA templates.
Subsequently, most deep sequencing protocols ask for a clusterPCR of 15 cycles (Illumina HiSeq 2000), which again creates a
source for bias towards particular sequence composition. To
detect and quantify very rare mRNA molecules, either a great
amount of starting material has to be used to extract RNA from or
the sequencing reaction has to run for extended time, which
again enhances bias towards GC rich fragments (Illumina HiSeq
2000). Improved chemistry for sequencing and amplification
might be able to overcome these problems in the future. To date,
RNAseq is a great and powerful method to assess expression of
entire transcriptomes and provides a relatively good idea about
the expression of all genes in a genome. But this method is not
suited for a precise quantification of single transcripts or even
only parts of a gene. SERS, in contrast, does not include
transcription or amplification steps but records the mRNA
molecules that are present in the sample directly. Experiments
using microarray hybridization and detection were also performed but not included in this analysis because the design of the
microarrays (Affymetrix ATH1, Santa Clara, CA) did not allow the
simultaneous detection of the 5′-end as well as the 3′-end of the
TWD1 gene. This is the first application of a SERS-based
biophysical assay to study variations in mRNA transcript levels in
T-DNA insertion mutants in plants. As a great number of T-DNA
mutagenesis resources exist for a variety of plant species
(Forsthoefel et al., 1992; Sallaud et al., 2004; Tadege et al.,
2009; Thole et al., 2012), this approach will likely open up new
avenues for expression studies of mutagenized genes and lowly
expressed transgenes in plant biotechnology.
Experimental procedures
Reagents and chemicals
DNA oligonucleotides were purchased from IDT (Coralville, IA).
Gold(III)chloride-trihydrate, Tris(2-carboxyethyl)phosphine hydrochloride (TCEP), Tween-20, trisodium citrate dehydrate, Na2EDTA were obtained from Sigma-Aldrich (St Louis, MO). Other
chemicals used in this study were of the highest quality and
obtained from university stores at Purdue University main
campus.
Plant material and growth
Arabidopsis wild-type and twd1 mutant plants were grown under
greenhouse conditions at 25 °C (day) and 21 °C (night) under a
16-h photoperiod. Plants were grown in Premier ProMix BX or
Premier ProMix PGX (Premier Tech Horticulture, Rivire-du-Loup,
Canada) and fertilized with 200 ppm Miracle-Gro Excel (Scotts,
Marysville, OH) adjusted to pH 6 following manufacturer recommendations.
Mapping of suppressor mutants
Segregation ratios of the F2-, F3- and F4-generations of crosses
between twd-sup and Ws-2 wild type were determined by
phenotyping soil-grown plants at 25 days of age. At this stage of
development, the phenotypes of twd1-2 and twd-sup plants are
clearly distinguishable. A subset of the scored plants was also
genotyped using PCR as shown in Figure 4a,b to confirm the
scored phenotypes. Using the formula n = logP/logf (Dilkes and
Feldmann, 1998), the recombination frequency between twd1-2
and twd-sup mutations has been estimated. If no twd1-2
phenotypes were found, a maximum marker distance was
calculated after f = 10(logP/n) after formula conversion. The
number of tested individuals is signified by n, P is the probability
of coupled markers, f = 1 – recombination frequency (probability
that both markers are not coupled).
Sample preparation of RNA
Total RNA was extracted from 100 mg of leaf tissue obtained
from 4- to 5-week-old plants grown under greenhouse conditions
at the Horticulture Greenhouse Facility at Purdue University. For
RNA extraction, leaf tissues from a minimum of five different
plants were combined, and three independent biological replicates were produced. The RNA extraction was performed using
an acidic phenol (pH ≤ 4.7) method with modification after
Hartwig et al. (2011, 2012). The quality of extracted RNA was
tested using 2% Agarose gel electrophoresis. Validations of RNA
quality were performed by measurement of RNA integrity
numbers (RINs) with an Agilent 2100 Bioanalyzer (Agilent
Technologies, Santa Clara, CA). The total RNA was quantified
using a Nanodrop photometer (Thermo Scientific, Wilmington,
DE), and the quality was estimated by a 260/280 nm ratio. The
260/280 nm ratios of 2.0 to 2.2 were used for quality control of
all RNA samples. Samples with RNA integrity number above >8.0
were selected for the analysis. Quantification of TWD1 mRNA via
qRT-PCR to validate the SERS quantification data was performed
as described in Hartwig et al. (2012). The TWD1-specific primers
used in this experiment were named: TWD1-3′F2 (5′-CCGAATG
TTCCACCTATGGC-3′) (150 nM), TWD1-3′R2 (5′-CTGCGAGCTTT
TCCCTCCTT-3′) (150 nM), TWD1-5′F3 (5′-CACATGACCAAGAGA
GCGAA-3′) (300 nM) and TWD1-5′R3 (5′-ACCCTCTTGAGATGG
CTCAC-3′) (300 nM).
Sample preparation of DNA
Genomic DNA for sequencing and genotyping was prepared
using Cetyltrimethylammoniumbromid (CTAB) buffer (2% CTAB,
1.4 M NaCl, 100 mM Tris/HCl at pH 8.0, 20 mM EDTA at pH 8.0).
A rosette leaf was homogenized in 300 lL CTAB-buffer with a
1.5 mL homogenization pestle and incubated at 65 °C for
60 min. Samples were cooled to room temperature, and 1 vol.
chloroform was added and mixed. After phase separation, the
aqueous phase was mixed with 1 vol. isopropanol and precipitated at 4 °C for 15 min. After centrifugation, the DNA pellet
was washed with 500 lL ice-cold 70% ethanol twice and
resuspended in water after air-drying. Quality and quantity of
DNA was determined at 260 nm and 280 nm using a nanodrop
photometer.
Hybridization of mRNA to ssDNA
Total RNA extract was treated with DNaseI to remove any DNA
contamination. The treated RNA was used to prepare a hybridization solution to select representative ssDNA target strands. The
hybridization solution of 30.00 lL (i.e., 20.00 lL of DNaseI
treated total RNA, 9 lL of a 39 aqueous hybridization solution:
3 M NaCl, 0.5 M HEPES, 1 mM EDTA; and 1 lL (0.3 ng) of DNA
oligonucleotides (target strand) with sequences complementary
ª 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd, Plant Biotechnology Journal, 12, 568–577
T-DNA insertions and mRNA quantification by SERS 575
to the mRNA transcripts of interest. This mixture was incubated at
75 °C for 10 min and incubated for 2 h at 60 °C to form RNADNA hybrids. 270 lL of S1 nuclease mix (S1 nuclease mix
(300 lL): 30 lL of 109 S1 nuclease buffer, 0.25 lL of S1
nuclease (Invitrogen, Carlsbad, CA), 0.6 lL of 10 mg/mL calf
thymus DNA (R&D Systems, Minneapolis, MN), 269.15 lL RNasefree water) were added and the mix was incubated at 37 °C for
45 min. Then, a 50.6 lL of the hydrolysis solution (1.6 M NaOH
and 135 mM EDTA) was added to remove nonpaired RNA
molecules from RNA-DNA hybrid. This mixture was incubated at
95 °C for 15 min to destroy ssRNA molecules. Finally, the
reaction mix was neutralized with 50.6 lL of neutralizing solution
(1 M HEPES, 1.6 M HCl, and 69 SSC) to stabilize the DNA targets
of interest in a neutral medium (Sun and Irudayaraj, 2009b).
Characterization of nanoparticles
UV-Vis absorption spectra were recorded with a V-570, Rev.1.00
spectrometer (JASCO, Easton, MD) using disposable polyacrylic
cuvettes (Figure S5A). Transmission electron micrographs (TEM)
were taken using a Philips CM-100 TEM (FEI Company, Hillsboro,
OR) operated at 100 kv, spot 3, 200 lm condenser aperture and
70 lm objective aperture at the Life Science Imaging Facility
(Purdue University). Images were captured with an SIA L3-C
digital camera coupled with a high-magnification electron
microscope. Four microlitres of a nanoparticle sample (0.3 nM)
was spotted onto a 400 mesh grid covered with formvar-carbon
film and glow discharged prior to use. A 2% uranyl acetate stain
was used to negatively stain the samples. The grid was floated on
sample droplets for ~1 min exposure time prior to rinsing it in a
stain droplet and dried by blotting on paper tissue. The zetapotential was measured using the Zetasizer (Malvern Instruments,
Westborough, MA) (Figure S5B). Each sample size was measured
at least three times (Cao et al., 2002).
Synthesis of DNA-AuNP-RTag probes
Thiolated oligos were reduced using a 10 M solution of TCEP
(room temperature, shaking for 15 min). TCEP is a water-soluble
reagent, commonly used for selective reduction of disulfides and
is highly stable compared with DTT. Moreover, TCEP needs to be
removed from the solution. The reduced thiolated probing DNA
strands (1 lM) were added to the precipitate obtained from
10 mL of AuNPs solution to obtain a 1 mL solution. The solution
was then incubated at room temperature for 24 h (on a shaker).
Next, the solution was buffered at pH 7.4 using 10 mM
phosphate buffer and 0.01% Tween-20 and salted slowly with
4 M NaCl to reach a final salt concentration of 0.3 M. After
‘ageing’ for 40 h (shaking at RT) and washing, 1 mL of RTag
Table 4 Oligonucleotide sequences used for Raman analysis
TS_TWD1_5′
5′- TGCTCATGCCATGTATCCTC -3′
CS_TWD1_5′
5′- GGCATGAGCAttttt-C3-SH -3′
PS_TWD1_5′
5′- SH-C6-tttttGAGGATACAT -3′
TS_TWD1_3′
5′- CGTAGCTCTCTTCTAATCGC -3′
CS_TWD1_3′
5′- GAGAGCTACGttttt-C3-SH -3′
PS_TWD1_3′
5′- SH-C6-tttttGCGATTAGAA -3′
PS, probing strand; TWD1, TWISTED DWARF 1.
TS signifies target strand oligonucleotides, CS signifies capture strand oligonucleotides, and PS signifies probe strand oligonucleotides. Thiolation of oligonucleotides is indicated with SH.
solution (MBA) was added and incubated for 24 h (shaking at
RT). The resulting DNA-AuNP-RTag probes were finally washed
three times with 0.3 M PBS (pH 7.5) to remove excess Raman tags
(Cao et al., 2002).
SERS sandwich assay
To construct the SERS sandwich assay (Figure 3), gold-coated
glass slides were first treated with piranha solution (70% H2SO4,
30% H2O2) (Yang et al., 1975) for 1 h and the slides were
covered with a silicone mask with an array of holes (3 mm in
diameter) to avoid cross contamination between neighbouring
spots. Ten microlitres capturing strand (CS) oligonucleotides
(1 lM) with 3′-thiol modification was spotted onto the slide and
incubated in a humidity chamber at RT for 6 h. Subsequently,
10 lL of 1.0 mM 6-mercapto-1-hexanol was added and incubated overnight in a humidity chamber at RT to avoid nonspecific
binding. Next, 10 lL of the target strand (TS) oligonucleotide was
added to hybridize with the immobilized CS by incubating in
a humidity chamber at 37 °C for 4 h. Finally, 10 lL of a DNAAuP-RTag probe functionalized with probing strand (PS) oligonucleotides with 5′-thiol modification and non-fluorescent Raman
tags covalently attached to 30 nm gold nanoparticles were added
to complete the detection array. This sandwich structure was
incubated in a humidity chamber at 37 °C for 4 h and
subsequently washed three times with 19 PBS to remove
unbound probing strands. Finally, the gold slides with immobilized oligonucleotides in the array format were analysed via
Raman spectroscopy. DNA oligonucleotides used for SERS experiments are listed in Table 4.
Semi-quantitative RT-PCR
To determine the mRNA accumulation of TWD1 mRNA upstream
and downstream of the T-DNA insertion a protocol for semiquantitative RT-PCR was used. RNA was transcribed into cDNA
using oligo dT primed reverse transcription with SuperScript II RT
polymerase (Invitrogen, Darmstadt, Germany) according to the
suppliers instructions. A PCR of 50 lL volume was put together
with 1 lL DNA or cDNA, 0.2 lM of each primer, 0.25 mM dNTP
(Fermentas, St. Leon-Rot, Germany), 20 mM Tris/HCl at pH 8.4,
50 mM KCl, 2,5 mM MgCl, 2.5 U Taq DNA-polymerase. The PCR
amplification programme contained the following steps: 95 °C
for 4 min (denaturation), 35 cycles of 95 °C for 1 min, 58 °C for
1 min, 72 °C for 2.5 min. After the completion of 35 cycles a fillin reaction of 5 min at 72 °C was added. Aliquots of the PCR
were taken every second cycle after 18–34 cycles and quantified
densitometrically on agarose gel images to determine the linear
range of PCR amplification. Expression of ACTIN 1 and ACTIN 3
were used as constitutively expressed control genes. TWD1
expression was normalized to ACTIN gene expression. Primer
sequences for RT-PCR are listed in Table 2.
Acknowledgements
Authors acknowledge the following sources of funding for this
project: NSF Award 0754740 to JI. NSF-EAGER award DBI0939906 to BS and JI. Seed funds from the Director of Ag
Research in the College of Agriculture at Purdue University.
Support to UK came from a PRF matching grant from Purdue
University for the Indo-US Knowledge Network Grant (award to
JI) and a Purdue Bilsland fellowship. CAM was supported by a
€bingen (ZMBP). We
graduate stipend from the University of Tu
thank R.R. Altstatt for language editing.
ª 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd, Plant Biotechnology Journal, 12, 568–577
576 U. Kadam et al.
Conflict of interest
Authors declare no conflict of interests.
References
Alba, R., Zhangjun, F., Payton, P., Liu, Y., Moore, S.L., Debbie, P., Cohn, J.,
D’Ascenzo, M., Gordon, J.S., Rose, J.K.C., Martin, G., Tanksley, S.D.,
Bouzayen, M., Jahn, M.M. and Giovannoni, J.J. (2004) ESTs, cDNA
microarrays, and gene expression profiling: tools for dissecting plant
physiology and development. Plant J. 39, 697–714.
Alonso, J.M., Stepanova, A.N., Leisse, T.J., Kim, C.J., Chen, H., Shinn, P.,
Stevenson, D.K., Zimmerman, J., Barajas, P., Cheuk, R., Gadrinab, C., Heller,
C., Jeske, A., Koesema, E., Meyers, C.C., Parker, H., Prednis, L., Ansari, Y.,
Choy, N., Deen, H., Geralt, M., Hazari, N., Hom, E., Karnes, M., Mulholland,
C., Ndubaku, R., Schmidt, I., Guzman, P., Aguilar-Henonin, L., Schmid, M.,
Weigel, D., Carter, D.E., Marchand, T., Risseeuw, E., Brogden, D., Zeko, A.,
Crosby, W.L., Berry, C.C. and Ecker, J.R. (2003) Genome-wide insertional
mutagenesis of Arabidopsis thaliana. Science, 301, 653–657.
An, S., Park, S., Jeong, D.H., Lee, D.Y., Kang, H.G., Yu, J.H., Hur, J., Kim, S.R.,
Kim, Y.H., Lee, M., Han, S., Kim, S.J., Yang, J., Kim, E., Wi, S.J., Chung, H.S.,
Hong, J.P., Choe, V., Lee, H.K., Choi, J.H., Nam, J., Kim, S.R., Park, P.B., Park,
K.Y., Kim, W.T., Choe, S., Lee, C.-B. and An, G. (2003) Generation and
analysis of end-sequence database for T-DNA tagging lines in rice. Plant
Physiol. 133, 2040–2047.
Azpiroz-Leehan, R. and Feldmann, K.A. (1997) T-DNA insertion mutagenesis in
Arabidopsis: going back and forth. Trends Genet. 13, 152–156.
Bao, G., Rhee, W.J. and Tsourkas, A. (2009) Fluorescent probes for live-cell RNA
detection. Annu. Rev. Biomed. Eng. 11, 25–47.
Bohanec, B., Luthar, Z. and Rudolf, K. (2002) A protocol for quantitative
analysis of green fluorescent protein-transformed plants, using
multiparameter flow cytometry with cluster analysis. Act Biolog
Cracoviensia Ser Botanica, 44, 145–153.
, J.A. and
Borges, F., Gomes, G., Gardner, R., Moreno, N., McCormick, S., Feijo
Becker, J.D. (2008) Comparative transcriptomics of Arabidopsis sperm cells.
Plant Physiol. 148, 1168–1181.
Bouchard, R., Bailly, A., Blakeslee, J.J., Oehring, S.C., Vincenzetti, V., Lee, O.R.,
Paponov, I., Palme, K., Mancuso, S., Murphy, A.S., Schulz, B. and Geisler, M.
(2006) Immunophilin-like TWISTED DWARF1 modulates auxin efflux activities
of Arabidopsis P-glycoproteins. J. Biol. Chem. 281, 30603–30612.
Bustin, S.A., Benes, V., Garson, J.A., Hellemans, J., Huggett, J., Kubista, M.,
Mueller, R., Nolan, T., Pfaffl, M.W., Shipley, G.L., Vandesompele, J. and Wittwer,
C.T. (2009) The MIQE guidelines: minimum information for publication of
quantitative real-time PCR experiments. Clin. Chem. 55, 611–622.
Cao, Y.C., Jin, R. and Mirkin, C.A. (2002) Nanoparticles with Raman
spectroscopic fingerprints for DNA and RNA detection. Science, 297,
1536–1540.
Carter, M.G., Sharov, A.A., VanBuren, V., Dudekula, D.B., Carmack, C.E.,
Nelson, C. and Ko, M.S. (2005) Transcript copy number estimation using a
mouse whole-genome oligonucleotide microarray. Genome Biol. 6, R61.
Choi, Y., Kim, H.P., Hong, S.M., Ryu, J.Y., Han, S.J. and Song, R. (2009) In situ
visualization of gene expression using polymer-coated quantum-dot-DNA
conjugates. Small, 5, 2085–2091.
Darzacq, X., Yao, J., Larson, D.R., Causse, S.Z., Bosanac, L., de Turris, V., Ruda,
V.M., Lionnet, T., Zenklusen, D., Guglielmi, B., Tjian, R. and Singer, R.H.
(2009) Imaging transcription in living cells. Annu. Rev. Biophys. 38, 173–
196.
Dilkes, B.P. and Feldmann, K.A. (1998) Cloning genes from T-DNA tagged
mutants. Methods Mol. Biol. 82, 339–351.
Dirks, R.W. and Tanke, H.J. (2006) Advances in fluorescent tracking of nucleic
acids in living cells. Biotechniques, 40, 489–496.
Errampalli, D., Patton, D., Castle, L., Mickelson, L., Hansen, K., Schnall, J.,
Feldmann, K. and Meinke, D. (1991) Embryonic Lethals and T-DNA Insertional
Mutagenesis in Arabidopsis. Plant Cell, 3, 149–157.
Faulds, K., Smith, W.E., Graham, D. and Lacey, R.J. (2002) Assessment of silver
and gold substrates for the detection of amphetamine sulfate by surface
enhanced Raman scattering (SERS). Analyst, 127, 282–286.
Faulds, K., Littleford, R.E., Graham, D., Dent, G. and Smith, W.E. (2004)
Comparison of surface-enhanced resonance Raman scattering from
unaggregated and aggregated nanoparticles. Anal. Chem. 76, 592–598.
Feldmann, K.A. (1991) T-DNA insertion mutagenesis in Arabidopsis –
mutational spectrum. Plant J. 1, 71–82.
Forsthoefel, N.R., Wu, Y., Bennett, M.J., Schulz, B. and Feldmann, K.A. (1992)
T-DNA insertion mutagenesis in Arabidopsis; prospects and perspectives.
Aust. J. Plant Physiol. 19, 353–366.
Geisler, M., Kolukisaoglu, H.U., Bouchard, R., Billion, K., Berger, J., Saal, B.,
Frangne, N., Koncz-Kalman, Z., Koncz, C., Dudler, R., Blakeslee, J.J., Murphy,
A.S., Martinoia, E. and Schulz, B. (2003) TWISTED DWARF1, a unique plasma
membrane-anchored immunophilin-like protein, interacts with Arabidopsis
multidrug resistance-like transporters AtPGP1 and AtPGP19. Mol. Biol. Cell,
14, 4238–4249.
Geisler, M., Girin, M., Brandt, S., Vincenzetti, V., Plaza, S., Paris, N., Kobae, Y.,
Maeshima, M., Billion, K., Kolukisaoglu, U.H., Schulz, B. and Martinoia, E.
(2004) Arabidopsis immunophilin-like TWD1 functionally interacts with
vacuolar ABC transporters. Mol. Biol. Cell, 15, 3393–3405.
Goda, H., Sasaki, E., Akiyama, K., Maruyama-Nakashita, A., Nakabayashi, K., Li,
W., Ogawa, M., Yamauchi, Y., Preston, J., Aok, K., Kiba, T., Takatsuto, S.,
Fujioka, S., Asami, T., Nakano, T., Kato, H., Mizuno, T., Sakakibara, H.,
Yamaguchi, S., Nambara, E., Kamiya, Y., Tkahashi, H., Hirai, M.Y., Sakurai,
T., Shinozaki, K., Saito, K., Yoshida, S. and Shimada, Y. (2008) The
AtGenExpress hormone- and chemical-treatment data set: Experimental
design, data evaluation, model data analysis, and data access. Plant J. 55,
526–542.
Graham, D., Thompson, D.G., Smith, W.E. and Faulds, K. (2008) Control of
enhanced Raman scattering using a DNA-based assembly process of dyecoded nanoparticles. Nat. Nanotechnol. 3, 548–551.
Hartwig, T., Chuck, G.S., Fujioka, S., Klempien, A., Weizbauer, R., Potluri, D.P.,
Choe, S., Johal, G.S. and Schulz, B. (2011) Brassinosteroid control of sex
determination in maize. Proc. Natl. Acad. Sci. USA, 108, 19814–19819.
Hartwig, T., Corvalan, C., Best, N.B., Budka, J.S., Zhu, J.Y., Choe, S. and Schulz,
B. (2012) Propiconazole is a specific and accessible brassinosteroid (BR)
biosynthesis inhibitor for Arabidopsis and maize. PLoS ONE, 7, e36625.
Hsu, L.M. (2009) Monitoring abortive initiation. Methods, 47, 25–36.
Kadam, U.S., Lossie, A.C., Schulz, B. and Irudayaraj, J. (2013) Gene expression
analysis using conventional and imaging methods. In DNA and RNA
Nanobiotechnologies in Medicine: Diagnosis and treatment of diseases
(Erdmann, V.A. and Barciszewski, J., eds.) RNA Technologies 8, 141–162.
Kamphausen, T., Fangh€anel, J., Neumann, D., Schulz, B. and Rahfeld, J.U.
(2002) Characterization of Arabidopsis thaliana AtFKBP42 that is membranebound and interacts with Hsp90. Plant J. 32, 263–276.
Kilian, J., Whitehead, D., Horak, J., Weinl, S., Batistic, O., D’Angelo, C.,
Bornberg-Bauer, E., Kudla, J. and Harter, K. (2006) The AtGenExpress global
stress expression data set: protocols, evaluation and exemplary data analysis
of UV-B light, drought and cold stress responses. Plant J. 50, 347–363.
Kneipp, K. and Kneipp, H. (2006) Single molecule Raman scattering. Appl.
Spectrosc. 60, 322A–334A.
Kneipp, K., Kneipp, H. and Kneipp, J. (2006) Surface-enhanced Raman
scattering in local optical fields of silver and gold nanoaggregates-from
single-molecule Raman spectroscopy to ultrasensitive probing in live cells.
Acc. Chem. Res. 39, 443–450.
Koncz, C., Nemeth, K., Redei, G.P. and Schell, J. (1992) T-DNA insertional
mutagenesis in Arabidopsis. Plant Mol. Biol. 20, 963–976.
Lee, K. and Irudayaraj, J. (2013) Correct spectral conversion between SurfaceEnhanced Raman and Plasmon Resonance Scattering from nanoparticle
dimers for single-molecule detection. Small, 9, 1106–1115.
Lee, K., Drachev, V.P. and Irudayaraj, J. (2011) DNA-gold nanoparticle reversible
networks grown on cell surface marker sites: application in diagnostics. ACS
Nano. 5, 2109–2117.
Matsumoto, J. (1994) Evolutionary Role of abortive transcript as a primer for
DNA replication. J. Mol. Evol. 39, 620–624.
Park, S. and Hamad-Schifferli, K. (2010) Enhancement of in vitro translation by
gold nanoparticle-DNA conjugates. ACS Nano. 4, 2555–2560.
Park, S., Sinha, N. and Hamad-Schifferli, K. (2010) Effective size and zeta
potential of nanorods by Ferguson analysis. Langmuir, 26, 13071–13075.
ª 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd, Plant Biotechnology Journal, 12, 568–577
T-DNA insertions and mRNA quantification by SERS 577
Ravindranath, S.P., Henne, K.L., Thompson, D.K. and Irudayaraj, J. (2011)
Surface-enhanced Raman imaging of intracellular bioreduction of chromate
in Shewanella oneidensis. PLoS ONE, 6, e16634.
Ravindranath, S.P., Kadam, U.S., Thompson, D.K. and Irudayaraj, J. (2012)
Intracellularly grown gold nanoislands as SERS substrates for monitoring
chromate, sulfate and nitrate localization sites in remediating bacteria
biofilms by Raman chemical imaging. Anal. Chim. Acta, 745, 1–9.
Richards, C.L., Rosas, U., Banta, J., Bhambhra, N. and Purugganan, M.D. (2012)
Genome-wide patterns of Arabidopsis gene expression in nature. PLoS
Genet. 8, e1002662.
Romano, P., Grau, J., Horton, P. and Luan, S. (2005) Plant immunophilins:
functional versatility beyond protein maturation. New Phytol. 166, 753–
769.
Rosso, M.G., Li, Y., Strizov, N., Reiss, B., Dekker, K. and Weishaar, B. (2003) An
Arabidopsis thaliana T-DNA mutagenized population (GABI-Kat) for flanking
sequence tag-based reverse genetics. Plant Mol. Biol. 53, 247–259.
Sallaud, C., Gay, C., Larmande, P., Bes, M., Piffanelli, P., Piegu, B., Droc, G.,
Regad, F., Bourgeois, E., Meynard, D., Perin, C., Sabau, X., Ghesquiere, A.,
Glaszmann, C., Delseny, M. and Guiderdoni, E. (2004) High throughput TDNA insertion mutagenesis in rice: a first step towards in silico reverse
genetics. Plant J. 39, 450–464.
Samson, F., Brunaud, V., Balzergue, S., Dubreucq, B., Lepiniec, L., Pelletier, G.,
Caboche, M. and Lecharny, A. (2002) FLAGdb/FST: a database of mapped
flanking insertion sites (FSTs) of Arabidopsis thaliana T-DNA transformants.
Nucleic Acids Res. 30, 94–97.
Schena, M., Shalon, D., Davis, R.W. and Brown, P.O. (1995) Quantitative
monitoring of gene expression patterns with a complementary DNA
microarray. Science, 270, 467–470.
Schmid, M., Davison, T.S., Henz, S.R., Pape, U.J., Demar, M., Vingron, M.,
€lkopf, B., Weigel, D. and Lohmann, J.U. (2005) A gene expression map
Scho
of Arabidopsis thaliana development. Nat. Genet. 37, 501–506.
Schulz, B., Bennett, M.J., Dilkes, B.P. and Feldmann, K.A. (1995) T-DNA tagging
in Arabidopsis thaliana: cloning by gene disruption. Plant. Mol. Biol. Manual,
K3, 1–17.
Sessions, A., Burke, E., Presting, G., Aux, G., McElver, J., Patton, D., Dietrich, B.,
Ho, P., Bacwaden, J., Ko, C., Clarke, J.D., Cotton, D., Bullis, D., Snell, J.,
Miguel, T., Hutchinson, D., Kimmerly, B., Mitzel, T., Katagiri, F., Glazebrook,
J., Law, M. and Goff, S.A. (2002) A high-throughput Arabidopsis reverse
genetics system. Plant Cell, 14, 2985–2994.
Stephen, K.E., Homrighausen, D., Depalma, G., Nakatsu, C.H. and Irudayaraj, J.
(2012) Surface enhanced Raman spectroscopy (SERS) for the discrimination of
Arthrobacter strains based on variations in cell surface composition. Analyst,
137, 4280–4286.
Sun, L. and Irudayaraj, J. (2009a) PCR-free quantification of multiple splice
variants in a cancer gene by surface-enhanced Raman spectroscopy. J. Phys.
Chem. B, 113, 14021–14025.
Sun, L. and Irudayaraj, J. (2009b) Quantitative surface-enhanced Raman for
gene expression estimation. Biophys. J. 96, 4709–4716.
Tadege, M., Wang, T.L., Wen, J., Ratet, P. and Mysore, K.S. (2009) Mutagenesis
and beyond! Tools for understanding legume biology. Plant Physiol. 151,
978–984.
The MAQC Consortium. (2006) The MicroArray Quality Control (MAQC) project
shows inter- and intraplatform reproducibility of gene expression
measurements. Nat. Biotechnol. 24, 1151–1161.
Thole, V., Peraldi, A., Worland, B., Nicholson, P., Doonan, J.H. and Vain, P.
(2012) T-DNA mutagenesis in Brachypodium distachyon. J. Exp. Bot. 63, 567–
576.
Wang, Y. and Irudayaraj, J. (2013) Surface-enhanced Raman spectroscopy at
single-molecule scale and its implications in biology. Philos. Trans. R. Soc.
Lond. B Biol. Sci. 368, 20120026.
Wang, Y., Seebald, J.L., Szeto, D.P. and Irudayaraj, J. (2010) Biocompatibility
and biodistribution of surface-enhanced Raman scattering nanoprobes
in zebrafish embryos: in vivo and multiplex imaging. ACS Nano. 4, 4039–
4053.
Weizbauer, R., Peters, W.S. and Schulz, B. (2011) Geometric constraints and the
anatomical interpretation of twisted plant organ phenotypes. Front. Plant Sci.
2, 62.
Winter, D., Vinegar, B., Nahal, H., Ammar, R., Wilson, G.V. and Provart, N.J.
(2007) An “Electronic Fluorescent Pictograph” browser for exploring and
analyzing large-scale biological data sets. PLoS ONE, 2, e718.
Wu, G., Otegui, M.S. and Spalding, E.P. (2010) The ER-localized TDW1
immunophilin is necessary for localization of multidrug resistance-like
proteins required for polar auxin transport in Arabidopsis roots. Plant Cell,
22, 3295–3304.
Yang, M.G., Koliwad, K.M. and McGuire, G.E. (1975) Auger electron
spectroscopy of cleanup-related contamination on silicon surfaces.
J. Electrochem. Soc. 122, 675–678.
Supporting information
Additional Supporting information may be found in the online
version of this article:
Figure S1 Transmission electron microscopy (TEM) of gold
nanoparticles.
Figure S2 Schematic representation of the mRNA accumulation
of TWD1 in Arabidopsis thaliana using the AtGenExpress data set.
Figure S3 Schematic representation of mRNA accumulation of
TWD1 in Arabidopsis thaliana.
Figure S4 Sequence of the TWD1 gene.
Figure S5 Analysis of conjugation of AuNPs with ssDNA.
ª 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd, Plant Biotechnology Journal, 12, 568–577