A Putative 12 Transmembrane Domain
Cotransporter Expressed in Thymic Cortical
Epithelial Cells
This information is current as
of June 18, 2017.
Moon Gyo Kim, Francis A. Flomerfelt, Kee-Nyung Lee,
Chuan Chen and Ronald H. Schwartz
J Immunol 2000; 164:3185-3192; ;
doi: 10.4049/jimmunol.164.6.3185
http://www.jimmunol.org/content/164/6/3185
Subscription
Permissions
Email Alerts
This article cites 30 articles, 10 of which you can access for free at:
http://www.jimmunol.org/content/164/6/3185.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2000 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
References
A Putative 12 Transmembrane Domain Cotransporter
Expressed in Thymic Cortical Epithelial Cells
Moon Gyo Kim,1 Francis A. Flomerfelt, Kee-Nyung Lee,2 Chuan Chen, and
Ronald H. Schwartz3
We have isolated a full-length cDNA clone (thymic stromal origin (TSO)-1C12) from a SCID thymus library using a probe from
a PCR-based subtractive library enriched for sequences from fetal thymic stromal cells. TSO-1C12 mRNA is expressed mainly in
the thymic cortex and is highly enriched in SCID thymus. Expression per cell is highest during fetal thymus development and
decreases after day 16. Antipeptide Abs immunoprecipitated a hydrophobic, plasma membrane glycoprotein (thymic stromal
cotransporter, TSCOT) whose translated sequence has weak homology to bacterial antiporters and mammalian cation cotransporters with 12 transmembrane domains. TSCOT represents a new member of this superfamily that is highly expressed in thymic
cortical epithelial cells. The Journal of Immunology, 2000, 164: 3185–3192.
Laboratory of Cellular and Molecular Immunology, National Institute of Allergy and
Infectious Diseases, National Institutes of Health, Bethesda MD 20892
Received for publication October 1, 1999. Accepted for publication January 5, 2000.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
Current address: National Creative Research Initiative Center for Genetic Reprogramming, Institute of Molecular Biology and Genetics, Seoul National University,
Seoul, Korea.
2
Current address: Protein Design and Control Research Unit, Korea Research Institute of Bioscience and Biotechnology, P.O. Box 115, Yusong, Taejon 305-600,
Korea.
3
Address correspondence and reprint requests to Dr. Ronald H. Schwartz, Building
4, Room 111, Laboratory of Cellular and Molecular Immunology, National Institutes
of Health, Bethesda MD, 20892-0420. E-mail address: [email protected]
4
Abbreviations used in this paper: FTOC, fetal thymic organ culture; 2-dGuo, 2-deoxyguanosine; RAG, recombinase activating gene; TM, transmembrane; Endo-H, endoglycosidase H; TSO, thymic stromal origin; TSCOT, thymic stromal cotransporter.
Copyright © 2000 by The American Association of Immunologists
protein it encodes with several antipeptide antisera, and determined where and when the molecule was expressed in the thymus.
Materials and Methods
Mice
Fetal thymi of 14.5-day gestation were obtained from timed matings of
C57BL/6 (B6) mice (National Cancer Institute, Frederick, MD). C.B-17
mice bearing the SCID mutation were bred in our animal facility (National
Institute of Allergy and Infectious Diseases, Frederick, MD). Mice bearing
the following gene-targeted mutations were derived into our breeding colony at Taconic Farms (Germantown, NY) by embryo transfer and backcrossed when necessary to C57BL/6 or C57BL/10 mice. The N number is
the number of crosses at the time the mice were used: the recombinase
activating gene 2 (RAG2)⫺/⫺ (N11) (11), ␤2-microglobulin⫺/⫺ (N11) (12),
invariant chain⫺/⫺ (N10) (13), IFN-␥⫺/⫺ (GKO) (N7) (14), and TCR-␣⫺/⫺
(N12) (15).
Antibodies
Abs against the HPLC-purified (99%) peptides acetyl-Gln-Asp-Lys-Gln-AsnVal-Pro-Arg-Asn-Pro-Arg-Thr-Pro-Arg-Lys-Gly-Cys-amide (from the cytoplasmic loop) and acetyl-Cys-Val-Pro-Arg-Ser-Gln-Gln-Gly-Glu-Cys[Acm]Ala-Glu-Lys-Gln-Pro-Ser-COOH (C terminus) were generated by immunizing
rabbits with both peptides (Quality Controlled Biochemicals, Hopkinton, MA).
The antisera were purified on peptide affinity columns.
Ab staining
Deparaffinized thymic sections were treated with a methanol-acetone mixture for 2 min at 22°C, washed with 0.2% Tween in PBS, and stained with
10 ␮g/ml of antiloop or anti-C-terminal peptide Abs for 1 h at 22°C. After
washing four times with Tween-PBS, a goat anti-rabbit HRP conjugate
(Vector Laboratories, Burlingame, CA) was added and the color was developed with an ImmunoPure metal-enhanced diaminobenzidine (DAB)
substrate kit (Pierce, Rockford, IL). Thymic stromal cells prepared from
2-dGuo-treated FTOC were trypsinized and cultured for 2wk in IMDM
containing 10% FBS. The cells were then subcultured into chamber slides
and fixed and stained as above.
Northern blotting analysis
Total RNAs were prepared by using the Triozol reagent (Molecular Research Center, Cincinnati, OH). Poly(A)⫹ RNAs were prepared using a
FastTrack 2.0 kit (Invitrogen, Carlsbad, CA). Ten micrograms of total or 2
␮g of poly(A)⫹ RNA were electrophoresed on a 1% agarose-formamide
gel, blotted onto a nylon membrane, and hybridized with a 32P-labeled
probe using QuikHyb (Stratagene, La Jolla, CA). The membrane was then
washed with 2⫻ SSC and 0.1% SDS followed by 0.1⫻ SSC and 0.1%
SDS, and analyzed on a PhosphorImager (Molecular Dynamics,
Sunnyvale, CA).
0022-1767/00/$02.00
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
N
ormal thymopoiesis is a tightly regulated multistep process that involves interactions between thymocytes at
different developmental stages and surrounding cells localized in particular compartments of the thymic microenvironment (reviewed in Refs. 1 and 2). At each step, genetic programs
for thymocyte survival, traffic, lineage commitment, and selection
are regulated by the stromal cells. The molecules on or secreted by
these cells are directly or indirectly responsible for inducing or
modifying all of these processes. Thus, knowledge of the identity
and expression of the genes that encode such molecules is important for understanding how T cell differentiation takes place.
The few spontaneous (e.g., nu/nu)) (3–5) and gene-targeted
(e.g., IL-7 and MHC class II) (6 –9) mutations of thymic stromal
cell genes have provided important insights into the mechanisms
by which stromal cells function. In an attempt to identify more
such molecules, we have created a PCR-based subtracted cDNA
library from stromal cells prepared from fetal thymic organ cultures (FTOC)4 treated with 2-deoxyguanosine (2-dGuo) (10). The
library was found to contain a large fraction of unknown genes
upon limited random screening by DNA sequencing. The expression of one of those genes, thymic stromal origin (TSO)-1C12, was
detected by Northern blotting only in the thymus and was greatly
enriched in the SCID thymus. In the present work we sequenced a
full-length cDNA clone from a SCID thymus library, examined the
3186
A NEW MEMBRANE PROTEIN FROM THYMIC STROMA
Isolation of the cDNA
32
A SCID cDNA library (16) was screened using a [ P]dATP-labeled 0.7-kb
fragment isolated from the PCR-based subtractive library as previously
described (10).
In situ hybridization
RT-PCR
MHC class II⫹ and MHC class II⫺ thymic stromal cells were prepared by
sorting cell suspensions made from 2-dGuo-treated FTOC (10). CD45⫹
thymocytes were prepared by sorting cells from parallel FTOC not treated
with 2-dGuo (16). Total RNA was prepared and resuspended at a concentration equal to 1000 cells/␮l. Twenty-five microliters of these RNAs or 10
␮g of total RNA from a 2-dGuo-treated thymus were reverse transcribed
using Mouse Mammary Tumor Virus reverse transcriptase (Stratagene) in
a total volume of 50 ␮l. 0ne microliter of cDNA product was then amplified for 36 cycles with the DNA polymerase Tag2000 (Stratagene) using
TSO-1C12-specific primers (5⬘ primer, nt 787– 808, TTGTGCTGAAG
GTCCCTGAGTC; and 3⬘ primer, nt 1277–1256, TGTGATCGGAATA
AGCGCAAAC). The PCR product obtained with these primers can include a 1.15-kb intron, which allows one to distinguish between genomic
and cDNA. The sequences of primers used for the GAPDH controls are
GGTGAAGGTCGGTGTGAACGGA for the 5⬘ primer, and TGTTAGT
GGGGTCTCGCTCCTG for the 3⬘ primer.
Quantitative competitive PCR
The method was adapted from Scheuerman and Bauer (17) and is described
in detail in Ambion’s Technical Report 151 (Austin, TX). Primers F84
(CAGTCTTCCAATAACCTGCTTTGGCCT) and B83 (CGATTCCAT
GTGCCCCATTG) were used to create a 310bp amplicon from the TSO1C12 cDNA. The 10% smaller competitor fragment was generated with
deletion primer one (GAACACCTGTGCAAGCAGCTCAGAGGCATC
TGAGAACTAGG) paired with the F84 fragment and deletion primer
two (CCTAGTTCTCAGATGCCTCTGAGCTGCTTGCACAGGTGTTC)
paired with the B83 fragment. The same procedure was used to prepare
primers specific for mouse cyclophilin. Here the amplicon was a 322-bp
fragment generated with F14 (TGTGCCAGGGTGGTGACTTTACACGC)
and B15 (TCAAAAGAAATTAGAGCTGTCCACAGTCGG). The deletion
consisted of 39 bp and was generated with deletion primer five (CACCTTC
CCAAAGACCACATGGCAGATAAAAAACTGGGAACCG) paired with
F14 and deletion primer three (CGGTTCCCAGTTTTTTATCTGCCATGT
GGTCTTTGGGAAGGTG) paired with B15.
Total RNA (5 ␮g) of each sample was converted to cDNA with Superscript II (Life Technologies, Gaithersburg, MD) and a mixture of random
hexamer and oligo(dT) primers. The cDNA was combined with a complete
PCR master mix containing the primers and a series of 2-fold dilutions of
the competitor. The PCR was conducted for 30 cycles, the products run on
a 10% acrylamide gel, and the point of equivalence determined with an
Eagle Eye video system (Stratagene). To control for genomic DNA contamination, samples were run without reverse transcriptase. The data obtained with cyclophilin primers were used for normalization; typically, the
correction factor was less than 2-fold.
Biochemistry of the protein
In vitro translation of the protein was performed using 35S-labeled methionine (Amersham, Arlington Heights, IL) and a TNT T3 coupled reticulocyte lysate system (Promega, Madison, WI). Immunoprecipitation was
conducted by mixing the radiolabeled protein with 0.5 ␮g of an antipeptide
Results and Discussion
TSO-1C12 is expressed in cortical thymic stromal cells
Fig. 1A shows a Northern blot with 2 ␮g of poly(A)⫹ RNA isolated from several different tissues of normal mice. TSO-1C12
message was only found in the thymus. Two major mRNA species
were observed, a strong band at 2 kb and a weaker one at 4 kb. The
expression of both was 10-fold higher in the thymus of SCID mice
and RAG2⫺/⫺ mice, which lack TCR-bearing double-positive and
single-positive thymocytes (Fig. 1, A and B). Conversely, enrichment was not seen in thymuses from ␤2-microglobulin⫺/⫺, invariant chain⫺/⫺, or IFN-␥⫺/⫺ mice, which have mostly normal thymocyte numbers. Thymuses from TCR␣⫺/⫺ mice showed a slight
enrichment (Fig. 1B). TSO-1C12 mRNA was not detected in five
SV40-transformed thymic stromal cell lines (10, 18), five thymic
epithelial cell lines derived from p53⫺/⫺ mice, or a kidney epithelial cell line, even after adding IFN-␥ or conditioned medium
from a T cell clone (data not shown).
To localize the expression of the TSO-1C12 gene in the thymus,
in situ hybridization was employed (Fig. 2, A–D). An antisense
TSO-1C12 probe stained mainly the cortical areas of the thymus,
although there was some scattered staining of cells within the medulla (Fig. 2B). The staining was specific because a TSO-1C12
sense probe did not stain the thymus (Fig. 2, A and C). Staining of
RAG2⫺/⫺ thymus showed TSO-1C12 expression throughout the
organ (Fig. 2D). This result is consistent with the enrichment seen
in Northern blots and may reflect the fact that the medulla in these
mutant mice is underdeveloped (19, 20).
To be certain that TSO-1C12 was only expressed in stromal
cells, double FACS purification of MHC class II⫺ CD25⫹ thymocytes (99.3% pure) from RAG2⫺/⫺ mice was performed. Quantitative RT-PCR on this population revealed a 320-fold depletion of
TSO-1C12 mRNA relative to intact RAG2⫺/⫺ thymus. In contrast,
6-Bq whole body radiation of RAG2⫺/⫺ mice, which depletes
about 95% of the double-negative thymocytes by 24 h, enriched
for the expression of TSO-1C12 by 2-fold (data not shown). Finally, MHC class II⫹ stromal cells (98%) from 2-dGuo-treated
fetal thymuses showed a detectable signal after 30 cycles of PCR
amplification, whereas MHC class II⫺ stromal cells (98%) and
CD45⫹ thymocytes (99%) did not, even at 36 cycles (Fig. 2E).
Overall, these observations demonstrate that TSO-1C12 is expressed in MHC class II⫹ stromal cells and not in the RAG2⫺/⫺
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
Sense and antisense RNA probes containing the 3⬘ 240 bases of the TSO1C12 cDNA were generated using the MEGA-SCRIPT kit (Ambion, Austin, TX), and photobiotinylated using a psoralin cross-linking system
(Schliecher & Schuell, Keene, NH). The specific activities of the probes
were determined on a slot blot using a chemiluminescent assay and only
those sets of equal activity were used.
Deparaffinized slides of thymus sections were treated for 10 min at 60°C
with unmasking solution (Dako, Carpinteria, CA), rinsed in water, and
treated with acetic anhydride (10 min with 0.25% acetic anhydride, 100
mM triethylamine/HCl, and 0.09% NaCl followed by addition of more
0.25% acetic anhydride for another 10 min). After washing with 2⫻ SSC,
the slides were prehybridized for 4 h at 42°C with an RNA hybridization
solution (Dako), and then hybridized with 400 ␮l of fresh solution containing 1 ng/ml of biotinylated probe (heated to 90°C for 3 min and then
incubated at 42°C overnight). The slides were then washed twice in 2⫻
SSC followed by a wash in 0.1⫻ SSC at 45°C, and finally developed using
the In Situ hybridization detection system K600 (Dako).
Ab ⫾ peptide in 500 ␮l. Protein A-Sepharose CL 4B beads were added for
2 h at 4°C and the eluted supernatant analyzed on 12% gels by SDS-PAGE.
Glycosylation was performed by adding a canine microsomal fraction (Promega) to the in vitro translation system. For endoglycosidase H (Endo-H)
(New England Biolabs, Beverly, MA) treatments, the radiolabeled glycoproteins were resuspended in 50 mM sodium citrate (pH 5.5) and incubated
with 10 units of Endo-H for 1 h at 37°C.
Surface biotinylation was performed using an enhanced chemiluminescence (ECL) biotinylation module (Amersham). Thymic stromal cotransporter (TSCOT⫹) rat basophilic leukemia cells (107) were washed twice
with cold PBS, resuspended in 3 ml of 40 mM bicarbonate buffer, and
biotinylated for 30 min at 4°C. The reaction was stopped by washing twice
with cold PBS and the cells lysed in 3 ml of lysis buffer (250 mM NaCl,
25 mM Tris-HCl (pH 7.5), 5 mM EDTA (pH 8.0), 1% Nonidet P-40, 2
␮g/ml aprotinin, and 100 ␮g/ml PMSF) for 20 min at 4°C. For immunoprecipitation, the cell lysate was spun (10,000 ⫻ g) to remove the nuclei
and the remaining extract precleared with a preimmune serum. After separating the immunoprecipitated proteins by SDS-PAGE, the proteins were
transferred to a nitrocellulose membrane (Novex, San Diego, CA). Biotinylated proteins were detected by incubation with a Streptavidin-HRP conjugate and a chemiluminescence substrate (Amersham). The protein bands
were examined by exposing the membranes to x-ray film for 1–10 min.
The Journal of Immunology
3187
double-negative thymocyte population. Based on the in situ hybridization results, the most likely cell type to be expressing this
gene is the cortical epithelial nurse cell.
TSO-1C12 gene expression pattern during development
Using a quantitative RT-PCR technique, we followed the expression of the TSO-1C12 gene during embryonic development by
isolating the RNA of whole fetuses from timed pregnant females at
days 9 –16 after plug formation (Table I). As early as day 9, a very
weak signal could be detected in the whole embryo. The amount of
TSO-1C12 mRNA began to increase, relative to the level of cyclophilin mRNA (21) beginning at day 13, and peaked at a 125fold higher level by day 16. In the newborn the message level had
dropped 2-fold from that at day 16. The weak signal detected at
day 9, before the known existence of thymic stromal cells, suggests that other cells in the embryo are expressing TSO-1C12. A
recent Blast search has revealed an expressed sequence tag generated from mouse skin cDNA that matches with the TSO-1C12
sequence. A Northern blot by us of adult skin and intestinal mRNA
failed to detect a signal, but a preliminary experiment with day 14
fetal skin did detect the 1C12 message (data not shown). Thus,
similar to the nu gene (22–24), TSO-1C12 might be expressed in
both skin and thymus.
Direct examination of the expression in thymuses from fetal,
neonatal, and adult mice by Northern blotting (Fig. 2F) revealed
high levels of TSO-1C12 mRNA at fetal days 13–16. After day 16,
when many thymocytes have reached the double-positive stage
and the thymic stromal cells have slowed their growth and begun
to separate into cortex and medulla (25), the level of TSO-1C12
mRNA begins to decline (relative to GAPDH mRNA). By 2 wk
after birth the level had decreased 5-fold. In two other experiments
this decline was 2- and 3-fold (data not shown). In contrast, the
difference in expression between SCID thymus and normal adult
thymus was always greater, 5- to 10-fold (Fig. 1A shows 10 fold as
quantitated on a PhosphorImager). These observations suggest that
the developmental block caused by the SCID mutation results in an
enhanced level of expression of the TSO-1C12 message in comparison to expression at a comparable state in development (day
14/15) in the fetus. Overall, these observations suggest that the
gene’s primary function is during the early stages of T cell development in both the fetus and the adult.
Cloning of the full-length TSO-1C12 cDNA and the predicted
protein structure
Our original TSO-1C12 clone from the PCR-based subtracted
cDNA library contained a 0.7-kb insert (16). Using this fragment
as a probe, we isolated a full-length cDNA from a library prepared
from SCID thymus. The frequency of this cDNA in the library was
relatively high (about 1 positive plaque out of 1000). Most of the
clones sequenced contained a 2.0-kb insert with a single open reading frame (GenBank accession no. AF148145). This reading frame
encodes a 479-aa protein with an estimated molecular mass of 52
kDa, starting from the putative ATG initiation codon at nucleotide
position 108 and ending with a stop codon at position 1547 (Fig.
3A). The 3⬘ untranslated region is 422 nt long and contains an
unconventional poly(A)⫹ addition signal. This cDNA sequence
has recently been verified by genomic sequencing.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 1. The tissue-specific
expression of TSO-1C12 detected
by Northern blotting. A, Poly(A)⫹
RNA from different tissues was hybridized with a 0.7-kb TSO-1C12
probe. B, Total RNAs from thymus
(T) and spleen (S) of normal,
SCID, and RAG2, ␤2-microglobulin chain of MHC class I (␤2M), invariant chain of MHC class II molecule (Ii), IFN-␥ (GKO), and TCR
␣-chain (TCR␣) deficient mice are
shown. The signals from a GAPDH
probe of the same blot are shown at
the bottom.
3188
A NEW MEMBRANE PROTEIN FROM THYMIC STROMA
The predicted protein from the translation of the open reading
frame is extremely hydrophobic. Almost half (48%) of the amino
acids are nonpolar and 85% are noncharged. Using the TopPredII
program (26), the predicted membrane topology was found to
match that of a type III membrane protein, with more than one
transmembrane (TM) region. There appear to be 11 certain and one
putative TM domains (Fig. 3B). The weak TM domain is located
near the N terminus of the molecule. There are many examples of
transporter proteins that possess 12 TM regions in which the first
TM domain is not strongly predicted to insert into the membrane.
In some cases this domain acts as a leader sequence and is cleaved
Table I. TSO-1C12 expression during development
Age (embryonic day)
E9
E10
E11
E12
E13
E14
E15
E16
Newborn
Relative TSO-1C12 Expressiona
4
1
4
4
16
16
31
500
250
a
Values are normalized using cyclophilin RNA and expressed relative to the
lowest value at day E10.
after successful integration of the protein into the membrane (reviewed in Ref. 27).
Based on these topological predictions, as well as other predicted structural features (27, 28), a model for the TSO-1C12encoded protein (TSCOT) is shown in Fig. 3C. The protein contains two potential glycosylation sites in the first predicted
extracellular loop at amino acid positions Asn57 and Asn61. The
predicted N-terminal and C-terminal ends both reside inside of the
plasma membrane, and there is a major cytoplasmic loop predicted
in the middle of the protein (aa 228 –285). These structural features
are also found in the family of Na⫹/Ca2⫹ cotransporters among the
known mammalian transporter families (29). The primary sequence of the protein, however, does not have similarity to any of
the known mammalian transporters (Fig. 3A). TSCOT also lacks
an ATP binding motif, a conserved amino acid sequence that is a
prominent feature of ATP-dependent pump proteins with 12 TM
spanning regions. The closest match to the primary amino acid
sequence in the protein data base is the bacterial tetracycline antiporter, which showed 25% identity at the amino acid level (probability of mismatch ⫽ 5.1 ⫻ e⫺7). The homologous regions are
spread over the entire protein and mostly reside in the TM regions.
The longest stretch of amino acid identity is seven residues. The
homology to a bacterial antiporter as well as the structural conservation with the mammalian cotransporters suggests that TSCOT
may be a member of a new family of 12 TM spanning transporters.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 2. The location of
TSO-1C12 expression in the
thymus. A–D, In situ hybridization of TSO-1C12 on thymic
sections (magnification, ⫻100).
A and B, Sense and antisense
probes on a normal adult thymus
section. C and D, Sense and antisense probes on a RAG2⫺/⫺
adult thymus section. E, RTPCR of FACS-sorted cells from
2-dGuo-treated FTOC. The
amount of RNA used in these reactions was equivalent to the average yield from 500 cells of either MHC class II⫹ or II⫺
stroma or CD45⫹ thymocytes.
The positive control shows the
signal following 36 cycles of
PCR from 0.2 ␮g of total RNA
extracted from 2-dGuo-treated
FTOC. RT-PCR products for
GAPDH are shown at the bottom. F, A Northern blot showing
the levels of TSO-1C12 expression during thymic development. The ratio of TSO-1C12
expression (2 kb mRNA) to that
of GAPDH in the same sample
is shown at the bottom, normalized relative to the signal from
adult thymus which is set to one.
RNAs were prepared from pools
of thymic tissue at different ages
before and after birth. The last
lane is RNA extracted from a
thymocyte cell suspension derived from adult thymus, which
shows no detectable signal.
The Journal of Immunology
3189
Biochemical characterization of the TSCOT protein
To investigate the physical nature of the protein, we first produced
it by in vitro transcription and translation, labeling the protein with
[35S]methionine. As shown in Fig. 4A, the recombinant protein,
translated from three different constructs using two eukaryotic expression promotor/enhancers or an excised clone from the ␭ library, migrated with an apparent molecular mass of 45 kDa in
reduced SDS-PAGE. This is 7 kDa less than the predicted mass
from the cDNA sequence. A construct with a sequence tag at the
C-terminal end of the protein showed a slightly slower migration
in the gel, indicating that the protein was fully translated to the end
of the coding region. The pBK1C12.35a plasmid, which is entirely
sequenced, showed exactly the same migration pattern as the eukaryotic expression construct pBKCMV1C12. This indicates that
the abnormal migration of the protein is not a cloning artifact that
led to the production of a truncated protein. When the sample was
boiled before electrophoretic separation, the protein migrated even
faster, (Fig. 4B, second lane). Furthermore, the protein tended to
aggregate when stored in the cold or in a urea containing solution
(data not shown). We think that these anomalies are due to the very
hydrophobic nature of the protein. Similar gel migration anomalies
have been noticed for many integral membrane proteins containing
a high percentage of nonpolar residues. For example, lactose permease migrates with an apparent molecular mass of 33 kDa on
SDS-PAGE, whereas its calculated molecular mass is 46 kDa (30).
The physical explanation for this is thought to be an effect on
mobility resulting from either an excess number of SDS molecules
binding to the hydrophobic portions of the protein or to an incomplete unfolding of the protein (31).
We next prepared two antisera against peptides that reside in the
putative hydrophilic cytoplasmic portion of the protein, as indicated in Fig. 3C, and used them to immunoprecipitate the in vitro
translated protein. Both of the affinity-purified, antipeptide Abs
immunoprecipitated a protein running at 45 kDa, or slightly faster
when the samples were boiled (Fig. 4B). The preimmune serum
did not immunoprecipitate this protein and the immunoprecipitation was selectively inhibited if the specific peptide was added into
the reaction mixture, i.e., the loop peptide inhibited precipitation with
the antiloop antisera, but not precipitation with the anti-C-terminal
antisera, and vice versa for the C-terminal peptide (Fig. 4C).
The potential of the protein to be glycosylated was tested in the
translation reaction by including a canine microsomal fraction
(Fig. 4D). This addition generated a larger band with an apparent
molecular size of 52 kDa. This band was reduced back down to the
original 45-kDa size by Endo-H treatment. These results indicate
that the molecule is a glycoprotein.
Finally, we asked whether the protein could be found on the cell
surface. A rat basophilic leukemia cell line was stably transfected
with the eukaryotic expression construct pBKCMV1C12Flag,
which was shown to produce protein in the in vitro translation
system (Fig. 4A). The surface proteins of this cell were biotinylated and immunoprecipitated after cell lysis with Abs against either the loop or C-terminal peptides (Fig. 4E). Reaction with enzyme-conjugated streptavidin revealed two bands on SDS-PAGE
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 3. Sequence analysis and modeling of the protein. A, Nucleotide and deduced amino acid sequence of the full-length TSO-1C12 clone from
pBK1C12.35a. The nucleotide sequence was translated using a program published in the Genetic Computer Group (GCG, Madison, WI) package (Wisconsin Sequence Analysis Package, version 8). TM regions predicted by the TopPredII program are underlined. The one “putative” TM region is indicated
with a dashed line. B, Prediction of the TM topology by the TopPredII program. The indicator lines for the probability levels of “certain” and “putative”
TM regions are shown with arrows. C, A working model for the structure of the TSCOT protein. Two glycosylation sites (N57 and N61) are indicated in
the first external loop. The first weak TM region is striped and the regions used to make the antipeptide Abs (loop peptide 251–267, and C-terminal peptide
465– 479) are indicated by shaded boxes.
3190
A NEW MEMBRANE PROTEIN FROM THYMIC STROMA
gels under reducing conditions, with apparent molecular masses of
65 and 58 kDa. The larger masses compared with the in vitrotranslated protein might be related to the presence of N-linked
carbohydrates. The two bands could represent differential glycosylation states as the cDNA predicts two N-linked carbohydrate
addition sites that are located very close to one another. Alternatively, the protein may have another form of posttranslational modification or be bound to another molecule whose association is
stable in SDS-PAGE. Still another possibility is that a second protein co-associates only on the cell surface, where it would be biotinylated and then coprecipitated with TSCOT (32).
Protein expression in the adult thymus and in primary thymic
stromal cell lines
TSCOT protein was detected in normal tissues by using the antiloop peptide Ab to stain permeablized paraffin sections of the thymus (Fig. 5, A–D). Expression was observed at low magnification
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 4. Biochemical characterization of the
TSCOT protein. A, SDS-PAGE of the recombinant
protein generated by in vitro transcription and translation using different constructs. pBKCMV1C12,
TSO-1C12 cDNA under the control of a eukaryotic
promotor. pBKCMV1C12Flag, the same construct
with an in frame FLAG (Asp-Tyr-Lys-Asp-AspAsp-Asp-Lys) sequence at the C-terminal end.
pBK1C12.35a, a full-length cDNA clone isolated
from the SCID library. All were transcribed with T3
RNA polymerase. Note that the flag-tagged protein
(open arrow) migrated slightly slower than the other
two untagged proteins (filled arrow). B, Immunoprecipitation of the recombinant protein. The first
two lanes are in vitro-translated proteins without
immunoprecipitation. Immunoprecipitation with the
preimmune serum, the immune serum, or affinitypurified, antipeptide Abs are shown on the right.
Boiling the samples before electrophoresis increased the mobility of the protein (open arrow)
compared with that of unboiled samples (filled arrow). C, Peptide competition of the immunoprecipitation. The amount (nM) of the peptide competitor
(loop 251–267 or C-terminal 465– 479) used in each
immunoprecipitation reaction is shown on the top
of each lane. D, In vitro glycosylation and deglycosylation of the protein. The glycosylated form of
the protein made in the presence of the microsomal
fraction is indicated with the open arrowhead.
Endo-H was added to one sample to remove
N-linked oligosaccharides before SDS-PAGE. E,
The cell surface biotinylation of the protein expressed in rat basophilic leukemia cells by stable
transfection. Biotinylated proteins on the cell surface were immunoprecipitated with antiloop or antiC-terminal peptide Abs and detected by an enhanced
chemiluminescent method using streptavidin-HRP.
The control vector and the pBKCMV1C12 construct
used for transfection are indicated on the top.
mostly in the cortical area (Fig. 5B), similar to what was observed
for the mRNA by in situ hybridization (Fig. 2B). At higher magnification of the cortex a typical thymic stromal staining pattern
was observed (Fig. 5D). Anti-C-terminal Ab showed the same pattern (data not shown). When no Ab or a normal rabbit IgG fraction
was used in place of the primary Ab, there was no staining in
consecutive serial sections (Fig. 5, A and C, and data not shown).
Both antipeptide Abs were also used to stain primary thymic stromal cell cultures. Positive staining was observed with either antiloop
(Fig. 5F) or anti-C-terminal Ab (Fig. 5H) in only a fraction of the
stromal cells. Control experiments with normal rabbit IgG or no Ab as
the first reagent showed no staining (Fig. 5, E and G). These results
suggest that only a subpopulation of thymic stromal cells express
TSCOT; however, the possibility that some of the stromal cells lost
their ability to express the protein during the culture period has not
been ruled out. Overall, these experiments show that the TSCOT protein is normally expressed in the cortical stromal cells of the thymus.
The Journal of Immunology
3191
toxin secretion, and ion balance. These actions are all directly related to critical survival functions at the cell or organismal level.
Therefore, we suspect that TSCOT may primarily function for homeostasis of the thymic microenvironment, possibly by providing
optimal conditions for the differentiation of early thymocytes.
TSCOT might do so by providing yet-to-be identified molecules to
thymocytes for their survival or by bringing nutrients to the stromal cells themselves for a self-supporting function. Future work
will focus on developing tools to study the function of the protein
in the thymus. Approaches will include gene targeting, stromal cell
ablation, and mAb production.
Acknowledgements
We thank Drs. Ronald Germain and John Ashwell for critically reading this
manuscript. We also thank members of the Laboratory of Cellular and
Molecular Immunology for discussions and encouragement on this project.
References
In conclusion, our analysis shows that TSCOT is a hydrophobic
plasma membrane glycoprotein expressed on cortical epithelial
cells in the thymus. The topology prediction programs suggest that
it has 12 TM domains and other structural features resembling
members of the cation cotransporter family. Although TSCOT is
only very distantly related to any of the known proteins in this
superfamily, it is well known that proteins carrying out a single
type of transporter function do not necessarily exhibit homology at
the primary amino acid sequence level, even though they have
similar secondary and tertiary structures (27, 33). Preliminary experiments undertaken to try and use the TSCOT protein to complement the tetracycline transporting function in a D(⫹)-arabinoseinducible pBAD expression system were negative (data not
shown). Thus, at this point in time, we have no experimental evidence that TSCOT actually has any transporter function.
It is well known that proteins in the transporter families in
higher organisms are involved in the energization of nutrient capture and waste efflux in a tissue-specific manner (33). In addition,
transporter families play important roles in antibiotic resistance,
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 5. TSCOT protein expression in the thymic cortex of normal
adult thymus and in primary thymic stromal cell cultures. A–D, Antiloop
peptide staining pattern in paraffin sections of a normal adult thymic lobe.
A, Negative control with only secondary Ab staining (⫻100); B, antiloop
peptide staining (⫻100); C and D, higher magnification (⫻630) of the
same section. E–H, Staining pattern of isolated thymic stromal cells from
2-dGuo-treated thymic rudiments. E, secondary anti-rabbit HRP conjugate
without the first Ab; F, antiloop peptide as first Ab; G, normal rabbit IgG
as first Ab; and H, anti-C-terminal peptide as the first Ab.
1. Boyd, R. L., and P. Hugo. 1991. Towards an integrated view of thymopoiesis.
Immunol. Today 12:71.
2. Anderson, G., N. C. Moore, J. J. Owen, and E. J. Jenkinson. 1996. Cellular
interactions in thymocyte development. Annu. Rev. Immunol. 14:73.
3. Nehls, M., D. Pfeifer, M. Schorpp, H. Hedrich, and T. Boehm. 1994. New member of the winged-helix protein family disrupted in mouse and rat nude mutations.
Nature 372:103.
4. Boehm, T., M. Nehls, and B. Kyewski. 1995. Transcription factors that control
development of the thymic microenvironment. Immunol. Today 16:555.
5. Nehls, M., B. Kyewski, M. Messerle, R. Waldschutz, K. Schuddekopf,
A. J. Smith, and T. Boehm. 1996. Two genetically separable steps in the differentiation of thymic epithelium. Science 272:886.
6. Van Ewijk, W., Y. Ron, J. Monaco, J. Kappler, P. Marrack, M. Le Meur,
P. Gerlinger, B. Durand, C. Benoist, and D. Mathis. 1988. Compartmentalization
of MHC class II gene expression in transgenic mice. Cell 53:357.
7. Laufer, T. M., J. DeKoning, J. S. Markowitz, D. Lo, and L. H. Glimcher. 1996.
Unopposed positive selection and autoreactivity in mice expressing class II MHC
only on thymic cortex. Nature 383:81.
8. Perumal, N. B., T. W. Kenniston, Jr., D. J. Tweardy, K. F. Dyer, R. Hoffman,
J. Peschon, and P. M. Appasamy. 1997. TCR-␥ genes are rearranged but not
transcribed in IL-7R␣-deficient mice. J. Immunol. 158:5744.
9. von Freeden-Jeffry, U., N. Solvason, M. Howard, and R. Murray. 1997. The
earliest T lineage-committed cells depend on IL-7 for Bcl-2 expression and normal cell cycle progression. Immunity 7:147.
10. Kim, M. G., C. Chen, F. A. Flomerfelt, R. N. Germain, and R. H. Schwartz. 1998.
A subtractive PCR-based cDNA library made from fetal thymic stromal cells.
J. Immunol. Methods 213:169.
11. Shinkai, Y., G. Rathbun, K. P. Lam, E. M. Oltz, V. Stewart, M. Mendelsohn,
J. Charron, M. Datta, F. Young, A. M. Stall, and F. W. Alt. 1992. RAG-2deficient mice lack mature lymphocytes owing to inability to initiate V(D)J rearrangement. Cell 68:855.
12. Zijlstra, M., E. Li, F. Sajjadi, S. Subramani, and R. Jaenisch. 1989. Germ-line
transmission of a disrupted ␤2-microglobulin gene produced by homologous recombination in embryonic stem cells. Nature 342:435.
13. Bikoff, E. K., L. Y. Huang, V. Episkopou, J. van Meerwijk, R. N. Germain, and
E. J. Robertson. 1993. Defective major histocompatibility complex class II assembly, transport, peptide acquisition, and CD4⫹ T cell selection in mice lacking
invariant chain expression. J. Exp. Med. 177:1699.
14. Dalton, D. K., S. Pitts-Meek, S. Keshav, I. S. Figari, A. Bradley, and
T. A. Stewart. 1993. Multiple defects of immune cell function in mice with
disrupted interferon-␥ genes. Science 259:1739.
15. Mombaerts, P., A. R. Clarke, M. A. Rudnicki, J. Iacomini, S. Itohara,
J. J. Lafaille, L. Wang, Y. Ichikawa, R. Jaenisch, M. L. Hooper, and
S. Tonegawa. 1992. Mutations in T-cell antigen receptor genes ␣ and ␤ block
thymocyte development at different stages. Nature 360:225.
16. Kim, M. G., C. Chen, M. S. Lyu, E. G. Cho, D. Park, C. Kozak, and
R. H. Schwartz. 1999. Cloning and chromosomal mapping of a gene isolated
from thymic stromal cells encoding a new mouse type II membrane serine protease, epithin, containing four LDL receptor modules and two CUB domains.
Immunogenetics 49:420.
17. Scheuerman, R. H., and S. R. Bauer. 1993. Polymerase Chain Reaction-Based
mRNA Quantification Using an Internal Standard: Analysis of Oncogene Expression. Academic Press, Inc., New York.
18. Faas, S. J., J. L. Rothstein, B. L. Kreider, G. Rovera, and B. B. Knowles. 1993.
Phenotypically diverse mouse thymic stromal cell lines which induce proliferation and differentiation of hematopoietic cells. Eur. J. Immunol. 23:1201.
19. Shores, E. W., W. Van Ewijk, and A. Singer. 1991. Disorganization and restoration of thymic medullary epithelial cells in T cell receptor-negative scid mice:
evidence that receptor-bearing lymphocytes influence maturation of the thymic
microenvironment. Eur. J. Immunol. 21:1657.
3192
20. Shores, E. W., W. Van Ewijk, and A. Singer. 1994. Maturation of medullary
thymic epithelium requires thymocytes expressing fully assembled CD3-TCR
complexes. Int. Immunol. 6:1393.
21. Hasel, K. W., and J. G. Sutcliffe. 1990. Nucleotide sequence of a cDNA coding
for mouse cyclophilin. Nucleic Acids Res. 18:4019.
22. Blackburn, C. C., C. L. Augustine, R. Li, R. P. Harvey, M. A. Malin, R. L. Boyd,
J. F. Miller, and G. Morahan. 1996. The nu gene acts cell-autonomously and is
required for differentiation of thymic epithelial progenitors. Proc. Natl. Acad. Sci.
USA 93:5742.
23. Brissette, J. L., J. Li, J. Kamimura, D. Lee, and G. P. Dotto. 1996. The product
of the mouse nude locus, Whn, regulates the balance between epithelial cell
growth and differentiation. Genes Dev. 10:2212.
24. Schlake, T., M. Schorpp, M. Nehls, and T. Boehm. 1997. The nude gene encodes
a sequence-specific DNA binding protein with homologs in organisms that lack
an anticipatory immune system. Proc. Natl. Acad. Sci. USA 94:3842.
25. Anderson, K. L., N. C. Moore, D. E. McLoughlin, E. J. Jenkinson, and J. J. Owen.
1998. Studies on thymic epithelial cells in vitro. Dev. Comp. Immunol. 22:367.
A NEW MEMBRANE PROTEIN FROM THYMIC STROMA
26. Claros, M. G., and G. von Heijne. 1994. TopPred II: an improved software for
membrane protein structure predictions. Comput. Appl. Biosci. 10:685.
27. Reithmeier, R. A. F. 1995. Characterization and modeling of membrane protein
using sequence analysis. Curr. Opin. Struct. Biol. 5:491.
28. von Heijne, G. 1994. Membrane proteins: from sequence to structure. Annu. Rev.
Biophys. Biomol. Struct. 23:167.
29. Reithmeier, R. A. F. 1994. Mammalian exchangers and co-transporters. Curr.
Opin. Cell Biol. 6:583.
30. Buchel, D. E., B. Gronenborn, and B. Muller-Hill. 1980. Sequence of the lactose
permease gene. Nature 283:541.
31. Gennis, R. B. 1989. Characterization and structural principles of membrane proteins. In Biomembranes, Molecular Strucutre and Function. C. R. Canter, ed.
Springer-Verlag, New York, p. 91.
32. Mastroberardino, L., B. Spindler, R. Pfeiffer, P. J. Skelly, J. Loffing,
C. B. Shoemaker, and F. Verrey. 1998. Amino-acid transport by heterodimers of
4F2hc/CD98 and members of a permease family. Nature 395:288.
33. Griffith, J. K., and C. E. Sansom. 1998. The Transporter Facts Book. Academic
Press, San Diego.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017