Volume 11 Number 21 1983 Nucleic Acids Research Transcription regulatory elements In the late region of bacteriophage T5 DNA Franchise Brunei, Vinh Ha Thi, Marie-Francpise Pilaete and John Davison Unit of Molecular Biology, International Institute of Cellular and Molecular Pathology, 75 Avenue Hippocrate, B-1200 Brussels, Belgium Received 27 June 1983; Accepted 23 September 1983 ABSTRACT Transcription promoters and terminators have been cloned from the late region of bacteriophage T5 DNA and their strengths determined in vivo in plasmid derivatives.DNA sequence analysis shows these transcription signals to be remarkable in that,in all four cases studied in detail,the promoters and terminators overlapped or were very close together. INTRODUCTION The ' 'in vivo" transcription of bacteriophage T5 DNA is a well regulated phenomenon which occurs in three steps (1). Immediately after infection, the pre-early mRNAs are synthesized from the left-hand 8X of the genome, which is the first to penetrate the bacterial cell (first step transfer) (2, 3 ) . As soon as the rest of the molecule has been injected (four minutes later) the transcription of early mRNAs also takes place. Late mRNA transcripts,on the contrary, only begin to appear some 10 to 12 minutes after infection. Experiments using rifampicin (4) and RNA polymerase purified from T5 infected cells (5,6) suggest that the E.Coli RNA polymerase serves to transcribe the T5 DNA throughout infection though,at late tiroes,it does so in association with T5 coded polyoeptides.Analysis of T5 mutants shows that at least three T5 gene products (C2, D5, D15) are needed for late transcription.The C2 gene codes for a 90K polypeptide that binds to RNA polymerase, as do two unidentified polypeptides of 1 IK and 15K (5,6). The D15 product is a 5'-3' exonuclease (7,8) able to introduce endonucleolytic scissions in T5 DNA (9). The T5 gene product is a DNA binding protein,involved in DNA synthesis and turn-off of early gene expression as well as turn-on of late gene expression (10,11). The molecular mechanisms by which C2, D5 and D15 positively control transcription are unknown. However,efficient expression of late genes may be obtained in the absence of these nositive control factors when the genes are cloned on phage or plasmid vectors. In several cases,it is clear that © IRL Press Limited, Oxford, England. 7649 Nucleic Acids Research the expression is from a promoter located on the cloned T5 fragment rather than on the vector (12, 13, 14). If late promoters normally interact with the modified RNA polymerase in vivo, it is possible that their DNA sequences may be somewhat different to those of classical RNA polymerase recognition sites or that their neighbouring sequences carry special information. In order to test this, we isolated late regulatory sequences and characterized their structures and biological properties. To do so, advantage was taken of the observation (12, 14) that they are functional proteins. in a plasmid in the absence of any T5 regulatory Thus, the late T5 DNA fragments Hindlll-L and Pstl-G were sub- cloned in the expression probe vectors pKO-1 and pKG1800 (15). Promoters (and terminators) were then characterized by their ability to turn-on (or off) the galactokinase gene carried by these plasmids and by DNA sequence analysis. MATERIALS AND METHODS Plasmids and bacteria pBR322::T5HindIII-L and pBR322::T5PstI-G have been described previously (12, 13, 14). Plasmids pKO-1, pKG1800 and E.coli C600 galK were obtained from McKenney et al., (15). C600 galK derivatives carrying various plasmids are defined in Table 1. Cloning and DNA sequencing General procedures for the cloning of DNA fragments, rapid extraction of recombinant DNA, purification of the plasmid DNA and characterization of the clones by restriction enzyme analysis have been described previously (12, 13, 16). The subcloning into pKO-1 and pKG1800 blunt-end Smal sites of fragments with sticky ends was achieved in three steps : firstly, the sticky ends were filled in using E.coli DNA polymerase Klenow fragment and deoxynucleoside triphosphates using the method of Wartell and Reznikoff (17); secondly, they were separated on agarose gels and extracted by the method of Dretzen et al., (18); finally, they were ligated to the Smal site by blunt-end ligation. DNA sequencing followed the method of Maxam and Gilbert (19) and was analysed on a Textronix 4051 micro-computer using a programme designed by Mr. Richard Robert-Shaw. Galactokinase assays The galactokinase assays were performed following the method of Wilson 14 C galactose was and Hogness (20) except that the specific activity of the 1.77 x 10 7650 dpm/ymole and the final concentration of galactose in the assay Nucleic Acids Research _2 mixture was 2 x 10 M. A galactokinase unit represents the amount of enzyme necessary to convert one nanomole of galactose to galactose-1 P in 1 hour at 32° C. Enrymes and chemicals All restriction enzymes and DNA ligase were purchased from New England Biolabs, Boehringer Mannheim or Amershaa and were used according to the manufacturerft instructions. Biochemicals. 32 Polynucleotide kinase was obtained from P. L. B-dATP P-dATP (3000 (3000 Ci/t Ci/mmole) and D- C galactose (40-60 mCi/mmole) were purchased from Amersham Ltd. RESULTS Regulatory signals in T5 The present study makes use of two vectors designed to facilitate the screening of promoters and terminators : pKO-1 and pKG1800 (15). In pK0-l, the gene coding for galactokinase is not expressed so that E.coli FDBIOO (C600 galK carrying pKO-1) gives white colonies on McConkey galactose plates. The cloning of a promoter upstream of galK activates galactokinase expression and results in the formation of red colonies. In contrast, pKG1800 already carries a promoter (pgal) transcribing the galK gene and the cloning of a terminator between galK and its promoter changes the colony colour from red to white. The T5 Hindlll-L fragment (3.9 kb) has been cloned and characterized previously (12, 14, 21). It is known to contain at least one promoter since the corresponding recombinant clones express the gene D21 as well as another unidentified gene (14). The work presented here concentrates on the 1.9 kb PvuII fragment contained within Hindlll-L (Fig. 1). This PvuII fragment was cut into four sub-fragments of 504, 490, 135 and 770 bp respectively (Fig. lc) and these were subcloned into the Smal site of the two expression probevectors. They were recovered in each plasmid in both possible orientations except for the Taql-PvuII fragment (770 bp) which was cloned in both directions in pKG1800 but only in one direction in pKO-1. When in pKO-1, all of the fragments (except the 135 bp Xbal-TaqI) showed a red phenotype irrespective of orientation, suggesting promoter activity for each of them in both directions. 2-9). The galactokinase assays confirm these results (Table 1A, lines The promoters are of moderate strength causing a 10-12 fold increase over the negative control and producing about 20 X of the level of galactokinase synthesized from the pgal promoter (Table IB, line 1). All the pKG1800 sub-clones retained the parental FDB200 red (galK+) 7651 Nucleic Acids Research F B E I A I E A D J I O H L K C P H I I O F H C N K B P O 1 J L >-%• Fig. 1 Physical and regulatory maps of the T5 PvuII fragments subcloned in pKO-1 and pKG1800. A- PstI and Hindlll restriction maps of the bacteriophage T5 DNA Showing the location of the cloned restriction fragments (thick lines) from which the PvuII fragments were obtained. The arrows above the diagram represent the pre-early (PE), early (E), and late (L) parts of the genome. B- The regulatory map of the subcloned PvuII (564 bp) fragment derived from Pstl-G showing the promoters ("iw—-) and terminators (|—) and the restriction sites used for the sequencing. The dotted line shows the pKO-1 vector and the position of galK in orientation £ (Table 1). C- Restriction map of the PvuII-PvuII (1.9 kb) fragment derived from Hindlll-L (21 and unpublished data). D- The regulatory map of the subcloned PvuII-Xbal (504 bp) fragment showing promoters (vWV—) and terminators ( I — ) and the restriction sites used for sequencing. The dotted line shows the vector and the position of galK in orientation a. (Table 1). Abbreviations : Hd, Hindlll; Hf, Hinfl; Be, Bell; Ec, EcoRI; Pv, PvuII; Xb, Xbal, Sm, Smal. phenotype. Such a result can be obtained in three different ways : either there, are no terminators on these fragments; of terminators are present but not fully efficient so that transcriptional read-through takes place from the pgal promoter. Finally, it is also possible that the terminators are followed by active T5 promoters responsible for galK expression. Measuring the quantity of galactokinase synthesized by each strain enabled us to differentiate between the first hypothesis and the other two, as can be seen in Table IB (lines 2-9). All FDB200 derivatives make the enzyme in sufficient amounts to account for their red phenotype. nant to recombinant. In FDB205 and FDB206 they are identical to that of the parental strain (FDB200). Therefore, the Xbal-TaqI 135 bp fragment does not contain any terminator sequences. 7652 However, theae amounts vary from recombi- In FDB2O7 and FDB2O8, the quantity of galac- Table 1. Galactokinase levels in the pKO-1 and pKG1800 aubclones B. DNA inserted in pKG1800 A. DNA inserted in pKO-1 Strain fragment number size source o r i 5 kinase bP .raits 1 FDB100 2 FDB101 PvuII-Xbal it ii 3 FDB102 4 FDB103 Xbal-Xbal II II 5 FDB104 6 FDB105 Xbal-TaqI *i n 7 FDB106 8 9 10 11 504 tt 490 II 135 H FDB107 Taql-PvuII II n FDB108 770 FDB109 564 FDB110 PvuII-PvuII II II It II Hindlll-L II Hindlll-L ti Hindlll-L 11 Hindlll-L II Pstl-G II a) o) a) number 295 317 279 FDB201 FDB202 PvuII-Xbal FDB203 FDB204 FDB205 Xbal-Xbal a) b) a) 238 nt 110 b) 20 FDB206 source o r i 6 kinase units 1630 II II II II Xbal-TaqI it II FDB207 Taql-PvuII II II FDB208 FDB209 PvuII-PvuII FDB210 size bp FDB200 b) a) fragment 25 311 33 15 P) Strain II 11 504 II 490 11 135 II 770 II 564 II Hindlll-L II Hindlll-L tl Hindlll-L It Hindlll-L II Pfltl-G II a) b) a) b) a) b) 1520 469 .1350 580 1449 1367 403 110 a) b) a) 1450 b) 50 CD n' Galactokinase units are given per OD of bacteria and represent the mean of five independent measurements. Orientations a and b of the fragments are defined in Fig. 1. Q) O Nucleic Acids Research tokinase made is reduced, independently of the orientation of the 770 bp TaqlPvuII fragment, suggesting terminator activity in both orientations. Follo- wing the same reasoning, the PvuII-Xbal 504 bp and Xbal-Xbal 490 bp fragments should contain terminator sequences in only one orientation (FDB202, FDB204). The DNA sequence of the 504 bp PvuII-Xbal fragment that contains both a promoter and a terminator was examined for the presence of sequences analogous to the consensus promoter and terminator structures as defined by Rosenberg and Court (22). Regions of DNA were defined as potentially capable of promoter activity when their sequences followed three criteria. Firstly, they contain a Pribnow box (-10 region) having the general sequence TAtaaT (where the final T ia always present, the other upper case letters usually present and the lower case letters often present). Secondly, they have a -35 region with the general structure TTGaca. Thirdly, the distance between the end of the -35 region and the beginning of the Pribnow box is not larger than 18 bp or smaller than 16 base pairs as these have been shown to correspond to the maximal and minimal spacings compatible with promoter activity (23, 24). Studying the 504 bp PvuII-Xbal fragment along these lines shows two promoter-like sequences, one in each orientation : p . situated between bp 385 and 412 and p. - situated between bp 222 and 193 (Fig. 2), p j and p,_ are therefore most probably responsible for galK expression in FDB101 (Table IA, line 2) and FDB102 (Table IA, line 3) respectively. The presence of terminators on the fragment was investigated by looking for the characteristic stem and loop structure followed by a series of Ts (22). Two such sequences can be found; one between coordinates 225-212 (t.) and the other between coordinates 397-381 (t T1 ) (Fig. 2 ) . 1J These are posi- 1 tioned such that either one or the other would cause termination of transcription from pgal in FDB202. The residual transcription in FDB202 would be from p.„ which is on the galK proximal side of these terminators. Indirect confir- mation of such a transcriptional pattern may be found in the fact that the amounts of galactokinase produced in FDB102 and FDB202 are very nearly identical. No terminator-like sequences were found in the reverse orientation, in agreement with the observation that FDB201 shoved no terminator activity. Regulatory sequences in T5 Patl-G The 7000 bp T5 Pstl-G DNA is cleaved by PyuII to give a subset of four fragments of 6000, 564, 250 and 150 bp (data not shown). Cloning of the 564 bp fragment into pKO-1 gives galactokinase expression in one orientation (FDB109) but not in the other (FDB110) (Table IA, lines 10 and 11). Conversely cloning this fragment into pKG1800 shows transcription terminator 7654 Nucleic Acids Research TGCTACTGCTTAATAATCTAncCAAATCTG€lTrilirc:AGGTAATAAAAGACGATTATTT^ 250 300 CAArcCTCAAGAAAAGACACAACTCAACACTCAAACAAAATCAGCATTCGCAACGTTCTTATAATGGC CTTAGGACTT€TU ICTCTCTlEACTTCTGAll 1101 lUACTCCTAAGCGTTCC^GAATATTACCCAAAATTTTCCACCTAATGACTTTTCCATTTAG *" "*~ 350 400 CGGCTt^CCTATTATAAC^CATGCACCAGTTAGTCATCGCACTAACCGTAAGCCTTTTACI^CTCKACAACC^ 450 500 AACTGCTAATATtXrrTATAGAIAGTGCGGCGGACTGTTCTTATACTCTCCCAGATAAATATAATATTGTTAC^ TTGACGATTATACCAATATCTATCACGCCGCCTCACAAGAATATGACACCCTCTATTTATATTATAACAATGCATCCCATTACCGCAOl H I G H 1CTAA CTAG 3" CATC 5' Figure 2. The DNA sequence of the 504 hp PvuII-Xbal fragment. The promoter-like sequences are enclosed in boxes and the terminator-like sequences are underlined by arrows, indicating the hairpin loop. The sequencing strategy is given in Figure 1. activity in one orientation (FDB210) but not in the other (FDB209) (Table IB, lines 11 and 10). These results suggest a promoter on one strand and a transcription terminator in the other. expectation. The sequencing data confirm this Two terminator-like sequences (t^. and t^o) can be found on the Gl GZ fragment (coordinates 484-501 and 194-213, Fig. 3) any obvious promoter-like sequence. cause termination in FDB210. and are not followed by Both are orientated such that they would On the other hand, two promoter-like sequences (pG1 and p G 2 ) are present on the other strand (coordinates 203-232 and 437 466, Fig. 3). These are appropriately orientated so as to promote galactokinase expression in FDB109 (Table 1). DISCUSSION This publication describes the identification of transcription promoter and terminator signals from the late region of the T5 genome. These were defined by two criteria : their capacity to initiate (or prevent) in vivo transcription and their similarities to the generally accepted consensus DNA sequences for such regulatory elements. Several sequences were found in sub- clones of Hindlll-L and Pstl-G that fulfill these requirements. The two promoters from the 504 bp PvuII-Xbal fragment (Fig. 2) of Hindlll-L cause a 10-12 fold increase in galactokinase production (FDB101 and FDB102, Table 1) compared to the negative control (FDB100) but are only of 7655 Nucleic Acids Research M 3 . 100 ' CACCTTCATACATTCCCATTATC<XTTCTC(rrCGAATTaTACCATTACTCTAMTATrrTGAACTCCTC(^AATCTCGTCGAAl 111 ICCTCCCTCm 150 200 GTCAMTGCAGCAACAarrAaiATCTrCTirrTGCCCCTiCTTATACTCCTACTACTGGGTTAATCGCACAAt^TAAAMTTTTCCTCATATCCA^ 250 AGTTCTCTCAGCCATCTrTACATACTACCTCTATC^TTCCTTCCGGTATGCAGACTGTAGCTTCTATGATTCAAT^^ TCAACAGAGTCCCTAGAAATCTATGATCCAGATACTAACCAAGCCCATAIXTCTGACATCCAAGATACTAACTTATCTCATGATCAGTCCTCCMTCAM 450 500 AATTCATCAGCCTATTCCACCAGAACACAAGCGTCAlTGGCAAATCTGAGGCATCTAAACCTAAG^ TTAACTAGTCCGATAACCTCCTCTTCTCTTCGCACTACCGTTTAGACTCCGTAGATTTCCATTCCAll111 UAATCTTCCACn TTCGACTTCTAACTC 550 CAAGATGCAGCIAAGAAACAGATCATCATTCAGACACCACTAGCACTAATGCMGCAGCAACAG 3 ' CTTCTACGTCCATTCTTTCTCTAGTACTAACrnrrGTCCTCATCGTCArrACCTTCGTCCTTCTC 5 ' Figure 3. The DNA sequence of the 564 bp PvuII-PvuII fragment. in Figure 2. moderate strength compared to that of pgal (FDB200). Legend as However, comparison of their DNA sequences with the consensus sequence for promoters indicates that the overall general structure is well preserved as 17/22 (p..) and 15/22 (pT_ ) bases are found in the expected positions. -35 region and the Pribnow box is in one The spacing between the case shorter (pLj:16 bp) and in the other, longer (p^.MS bp) than the optimal spacing (pgal : 17 bp) (23, 24, 25). And this may be the reason for the promoter's relative lack of strength. more observations may be made about p and P L2 - Two Firstly, they differ in that p.. shows more similarities to the consensus sequence than does P^2> P art i- Cu ~ larly in the -35 and Pribnow box regions, yet, their capacities to initiate transcription are about the same. terminator sequences (t_ Secondly, they both overlap with potential or t,~) . In the case of p., t^e terminator-like structure ( L . ) is on the same strand and in the case of p ^ the terminatorlike structure L. is on the opposite strand. Association of promoters and terminators has been previously described (26,27), and taken as an indication that certain features are common to sites where RNA polymerase begins or ends transcription (22). The functional reality of the t . and Lj, a s terminators is suggested by the fact that the PvuII-Xbal fragment causes termination in the b_ orientation (FDB202), the true magnitude of this effect being disguised by the p . promoter that initiates in the same direction after the termination s equences (FDB102). The 564 bp PvuII-PvuII fragmept (Fig. 3) derived from the Pstl-C fragment 7656 Nucleic Acids Research likewise has two promoter-like structures (p,,. and p _ ~ ) , both orientated in the same direction, and one or both of these is probably responsible for the increased amount of galactokinase made in FDB109. In these promoters the most conserved bases are present but others are badly represented, and the distance between the end of the -35 region and the beginning of the Pribnow box is 18 bp, possibly accounting for the weak promoter activity observed in FDB109. The 564 bp PvuII-PvuII fragment also shows terminator activity (FDB210), this being reflected in the DNA sequence by two terminator-like sequences t . and t ^ , characterized by an inverted repeat followed by a run of Ts. As in the case with L , and t^2' t G ] overlaps with the promoter-like sequence p t j is located within ~ 20 bp of P r 2 ) • (while Both t . and t.,. are orientated in the same way, resulting in efficient transcription termination (FDB210, Table IB). One of the surprising results of this study is the high frequency with which regulatory signals have been identified. Four potential promoters and four terminators have been found in the two small fragments (504 and 564 bp) which were completely studied. The biological data obtained for the other fragments indicate the presence of promoters in all but the smallest (Table 1). Another unexpected observation is the overlap of the terminators and promoters in three of the four cases studied, while the fourth case showed them in very close proximity. The in vivo significance of the promoters and terminators described here is difficult to assess since T5 late transcription normally takes place in the presence of T5 coded positive control factors, that are missing in the clones studied. It is not known why late T5 genes are not transcribed in the absence of these factors, nor the way in which the factors overcome this transcriptional block. The overlapping arrangement of the promoters and terminators could conceivably be part of this mechanism. REFERENCES 1. McCorquodale, D.J. (1975) Crit. Rev. Microbiol. 4, 213-234. 2. Lanni, Y.T., McCorquodale, D.J. and Wilson, C M . (1964) J. Mol. Biol. 10, 19-24. 3. Shaw, A.R. and Davison, J. (1979) J. Virol. 30, 933-935. 4. Beckman, L.D., Witonsky, P. and McCorquodale, D.J. (1972) J. Virol. 10, 179-183. 5. Szabo, C , Dharmgrongartama, B. and Moyer, R.W. (1975) Biochem. 14, 989996. 6. Szabo, C. and Moyer, R.W. (1975) J. Vir. 15, 1042-1051. 7. Frenkel, G.D. and Richardson, C.C. (1971) J. Biol. Chem. 246, 4839-4846. 8. Chinnadurai, G. and McCorquodale, D.J. (1973) Proc. Natl. Acad. Sci. 70, 3502-3511. 9. Moyer, R.W. and Rothe, C.T. (1977) J. Virol. 24, 177-193. 10. Chinnadurai, G. and McCorquodale, D.J. (1974) Nature 247, 554-558. 7657 Nucleic Acids Research 11. McCorquodale, D.J., Gosling, J., Benringer, R., Chesney, R., Lawhorne, L. and Moyer, R.H. (1979) J. Virol. 29, 322-328. 12. Brunei, F., Davison, J. and Merchez, M. (1979) Gene 8, 53-68. 13. Davison, J., Brunei, F., Merchez, M. and Ha Thi, V. (1981) Gene 16, 99106. 14. Brunei, F., Davison, J., Ha Thi, V. and Reeve J. (1981) Gene 16, 107118. 15. McKenney, K., Shimatake, H., Court, D., Schmeissner, U., Bradv, C. and Rosenberg, M. (1981) in Gene Amplification and Analysis, Chir Icjian, J.C. and Papas, T.S. eds, Vol. II, pp. 383-414, Elsevier North Holland. 16. Davison, J., Brunei, F., Merchez, M. and Ha Thi V. (1982) Gene 17, 101106. 17. Wartell, R.M. and Reznikoff, W.S. (1980) Gene 9, 307-315. 18. Dretzen, G., Bellard, M., Sassone-Corsi, P. and Chambon, P. (1981) Anal. Biochem. 112, 295-298. 19. Maxam, A. and Gilbert, W. (1977) Proc. Natl. Acad. Sci. US 74, 560-564. 20. Wilson, D.B. and Hogness, D. (1966) in Methods in Enzymology, Grossman, L. and Moldave, K. eds., Vol 8 pp. 229-240, Academic Press, New York. 21. Brunei, F., Heusterspreute, M., Mercher, M., Ha Thi V., Pilaete M.F. and Davison, J. (1983) Plasmid 9, 201-214. 22. Rosenberg, M. and Court, D. (1979) Ann. Rev. Genet. 13, 319-353. 23. Berman, M.L. and Landy, A. (1979) Proc. Natl. Ac. Sci. US 76, 4303-4307. 24. Russel, DR. and Bennett, G.N. (1982) Gene 20, 231-243. 25. Musso, R.E., Di Lauro, R., Rosenberg, M. and de Crorabrugghe, B. (1981) Proc. Natl. Ac. Sci. US. 74, 106-110. 26. Sugimoto, K., Sugisaki, H., Okamoto, T. and Takanami, M. (1977) J. Mol. Biol. 110, 487-507. 27. Post, L.E., Arfsten, A.E., Reusser, F. and Nomura, M. (1978) Cell 15, 215-221. 7658
© Copyright 2024 Paperzz