Human Vascular Endothelial Cells Favor
Clonal Expansion of Unusual Alloreactive
CTL
This information is current as
of June 18, 2017.
Subscription
Permissions
Email Alerts
J Immunol 1999; 162:7022-7030; ;
http://www.jimmunol.org/content/162/12/7022
This article cites 35 articles, 15 of which you can access for free at:
http://www.jimmunol.org/content/162/12/7022.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 1999 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
References
Barbara C. Biedermann and Jordan S. Pober
Human Vascular Endothelial Cells Favor Clonal Expansion of
Unusual Alloreactive CTL1
Barbara C. Biedermann2 and Jordan S. Pober3
E
ndothelial cell-selective CTL have been isolated and
propagated from endomyocardial biopsies of acutely rejecting heart transplants (1). We have shown previously
that cultured human endothelial cells (EC)4 induce peripheral
blood CD81 T cells to differentiate into allospecific, class I MHCrestricted CTL in vitro (2). Moreover, these EC-stimulated polyclonal CTL lines preferentially lysed EC, but not B lymphoblastoid
cell (BLC) targets. Our EC-stimulated CTL lines also appeared
atypical in that they secreted little or no IFN-g upon target cell
recognition. Since these lines were propagated continuously in the
presence of EC, it was unclear whether the unusual properties of
these lines, namely EC selectivity and low IFN-g secretion, resulted from stable, characteristic features of unusual CTL that had
been preferentially expanded in the presence of EC, or whether
they were consequences of transient EC-mediated phenotypic
modulations of conventional (i.e., cell type-unrestricted, IFN-gsecreting) CTL. The present study was designed to answer this
question by cloning T cells from the polyclonal CTL lines at limiting dilution and then propagating these T cell clones in the absence of EC. In this study, we report that the presence of EC in the
initial polyclonal T cell culture favors the expansion of phenotypically stable CTL clones that display both EC selectivity and poor
Program in Molecular Cardiobiology, Boyer Center for Molecular Medicine, Yale
University School of Medicine, New Haven, CT 06510
Received for publication January 14, 1999. Accepted for publication March 26, 1999.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This word was supported by a grant from the National Institutes of Health (HL43364).
2
Current address: Medizinische Universitaetsklinik, Bruderholzspital, 4101 Bruderholz, Switzerland.
3
Address correspondence and reprint requests to Dr. Jordan S. Pober, Boyer Center
for Molecular Medicine, Yale University School of Medicine, 295 Congress Ave.,
New Haven, CT 06510. E-mail address: [email protected]
4
Abbreviations used in this paper: EC, endothelial cells; BLC, B lymphoblastoid
cells; CD40L, CD40 ligand; FasL, Fas ligand.
Copyright © 1999 by The American Association of Immunologists
IFN-g secretion. We also observed that a significant number of
EC-stimulated CTL express CD40 ligand (CD40L, officially designated CD154) at rest. This marker correlated strongly with poor
IFN-g secretion. BLC also stimulated EC-selective CTL and
CD40L1 CTL, but this was much less common. We conclude that
EC promote the expansion of unusual CTL at the expense of conventional CTL and that these unusual CTL clones do not require
subsequent EC contact to maintain their unusual phenotypes.
Materials and Methods
Cell isolation
PBMC were obtained from healthy volunteers by density-gradient centrifugation of leukapheresis products and stored in liquid nitrogen, as described previously (3). These populations were used to isolate responder
cells for the CTL differentiation cultures as well as feeder cells for cloning
at limiting dilution. CD81 T lymphocytes were isolated by positive selection (2). In brief, Dynabeads (Dynal, Lake Success, NY) coated with an
anti-CD8 mAb were incubated with the PBMC suspension to bind CD81
T cells, and nonbinding cells were removed by extensive washing. The
magnetic beads were detached from the responder cells by applying Detachabead according to the manufacturer’s instructions. The responder population obtained by this procedure was routinely .98% CD8/CD3 positive
and .99% viable, as shown by trypan blue exclusion.
HUVEC were obtained from umbilical cords by enzymatic digestion
and maintained in culture, as described (3). Such EC cultures are free from
detectable CD451 contaminating leukocytes and uniformly express von
Willebrand factor and CD31. B lymphoblastoid cells (BLC) from the same
donor as the EC were grown from EBV-immortalized cord blood mononuclear cells (4). After 6 – 8 wk in culture, BLC lines were uniformly CD19
positive. HUVEC and BLC were used as stimulator cells in cocultures and
as target cells in effector assays. When BLC were used as stimulator or
feeder cells, they were pretreated with mitomycin C (Sigma, St. Louis,
MO) to prevent proliferation (2). The erythroleukemia cell line K562 was
obtained from American Type Culture Collection (Manassas, VA) and
grown in RPMI 1640, 10% FCS, 2 mM L-glutamine, 100 U/ml penicillin,
and 100 mg/ml streptomycin (all from Life Technologies, Grand Island, NY).
CTL differentiation and cloning
The procedure for CTL differentiation has been described previously (2). In
brief, purified CD81 T cells were incubated with stimulator cells (EC,
BLC, or both) in 96-well microculture plates (Falcon; Becton Dickinson,
0022-1767/99/$02.00
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
We have shown previously that cultured HUVEC or mixtures of endothelial cells (EC) and B lymphoblastoid cells (BLC) induce
the differentiation of purified CD81 PBL into allospecific, class I MHC-restricted CTL that lyse EC, but not BLC autologous to
EC. Furthermore, these EC-selective CTL lines secrete little IFN-g after target cell contact. In the present study, we have analyzed
these polyclonal populations at a single cell level by cloning at limiting dilution and propagating the resulting CTL clones in the
absence of EC. Phenotypically stable, alloreactive EC-selective CTL preferentially emerge from cocultures in which EC or EC 1
BLC are the initial stimulating cell types compared with cocultures stimulated by BLC alone (p 5 0.005). Compared with
BLC-stimulated CTL, EC-stimulated CTL clones often fail to secrete IFN-g after target cell contact (p 5 0.0006) and constitutively
express CD40 ligand (CD40L) at rest (p 5 0.0006). The absence of IFN-g secretion does not result from a switch to IL-4 secretion.
The expression of CD40L inversely correlates with the secretion of IFN-g after target cell contact (p 5 0.0001), but correlations
of CD40L expression and failure to secrete IFN-g with EC-selective killing did not reach statistical significance. We conclude that
in a microenvironment in which allogeneic EC are in close contact with infiltrating CD81 T cells, such as within a graft arterial
intima, CTL subsets may emerge that display EC selectivity or express CD40L and secrete little IFN-g after Ag contact. The
Journal of Immunology, 1999, 162: 7022–7030.
The Journal of Immunology
7023
Table I. PCR product size, primer sequences, and annealing temperature for RT-PCR
Gene
Full-Length
Size (bp)
Competitor
Size (bp)
Upper Primer (59)
Lower Primer (39)
Annealing
Temperature (°C)
CD3«
Perforin
FasL
IFN-g
CD40L
820
770
830
770
770
730
677
740
680
700
CCCATGAAACAAAGATGCAG
GTCTGCTCCTCCTGGGCATC
ATGCAGCAGCCCTTCAATTA
ACTTCTTTGGCTTAATTCTC
ATGATCGAAACATACAACCA
GGTACCAGCAGAGAAGGCAG
GACAGTCAGGCAGTCCTCCA
CCGAAAAACGTCTGAGATTC
TGTAATCACATAGCCTTGCC
CCAAAGGACGTGAAGCCAGT
55
59
54
47
50
Cytotoxicity assay
Cytotoxicity by CTL was measured at least 7 days after the last restimulation with feeder cells and PHA by a calcein fluorescence release assay
(5), as described (2). In brief, target cells were loaded with calcein-AM
(Molecular Probes, Eugene, OH), washed, and incubated with effector CTL
at titered E:T ratios (30:1, 10:1, 3:1) for 4 h at 37°C. The supernatant was
then harvested and calcein release was measured using a fluorescence plate
reader (Cytofluor 2; Perseptive Biosystems, Framingham, MA; excitation
wavelength 485 nm, emission wavelength 530 nm). Percent specific killing
was calculated as (release sample 2 spontaneous release)/(maximal release 2 spontaneous release) 3 100%. Spontaneous release was obtained
by adding medium alone; maximal release was obtained by adding lysis
buffer (50 mM sodium borate, 0.1% Triton X-100, pH 9).
Cytokine measurements
IFN-g, TNF, and IL-4 were measured in the CTL assay supernatant that
was collected 18 –24 h after the cytotoxicity assay was started. After harvesting the supernatant to measure calcein release, medium was replaced
(RPMI 1640, 10% human serum AB, without IL-2) and the cultures were
further incubated at 37°C. The supernatant was collected from all E:T
ratios tested per each individual clone, pooled, and stored frozen at 270°C.
Cytokine concentration was determined by an ELISA using commercially
available Ab pairs (monoclonal mouse anti-human IFN-g (MAB285),
monoclonal mouse anti-human TNF (MAB610), monoclonal mouse antihuman IL-4 (MAB604), biotinylated polyclonal goat anti-human IFN-g
(BAF285), biotinylated polyclonal goat anti-human TNF (BAF210), and
biotinylated mouse anti-human IL-4 (BAF204), all from R&D Systems),
according to the manufacturer’s instructions.
Immunophenotyping of the CTL clones
CTL were collected for immunophenotyping at least 7 days after restimulation with feeder cells and PHA. CTL were either fixed with paraformaldehyde, spun onto gelatin-coated slides, permeabilized, and double stained
for CD8 and perforin as described previously (2), or processed unfixed for
FACS analysis. In the latter case, 50,000 CTL/sample were washed once
with ice-cold PBS/1% BSA and incubated with saturating concentrations
of directly FITC- or PE-conjugated mouse anti-human CD8, CD3, CD25,
CD2, CD28 (all from Coulter Immunotech, Miami, FL), or CD40L
(TRAP1; PharMingen, San Diego, CA)), or nonconjugated anti-human
FasL, Fas (both PharMingen), or Mac-1 (LM2/1, gift from Dr. D. Altieri,
Yale Medical School, New Haven, CT) mAbs for 30 min at 4°C. Cells
were washed three times with ice-cold PBS/BSA and either fixed with 1%
paraformaldehyde in PBS (conjugated first Ab) or incubated with an FITCconjugated, goat anti-mouse IgG (H 1 L) secondary Ab (F(ab9)2) (50 ml/
sample, 1/50 dilution; Boehringer Mannheim, Indianapolis, IN) for another
30 min at 4°C. Cells were washed three times before fixation with 1%
paraformaldehyde in PBS. Samples were analyzed using FACSort (Becton
Dickinson, San Jose, CA) by gating on viable cells and collecting 3000
events per sample.
Quantitative competitive RT-PCR
Total RNA was isolated from 5 3 106 resting CTL using a guanidinium
isothiocyanate-based RNA isolation kit (RNeasy mini kit; Qiagen, Santa
Clarita, CA), according to the manufacturer’s instructions. A total of 2 mg
of total RNA (final volume: 20 ml) was suspended in 50 mM Tris-HCl (pH
8.3), 75 mM KCl, 3 mM MgCl2, 20 mM DTT, 16.5 mg/ml oligo(dT)15
(Program for Critical Technology in Molecular Medicine, Yale University
Department of Pathology, New Haven, CT), 0.5 mM dNTP (New England
Biolabs, Beverly, MA), and 40 U RNAsin (Promega, Madison, WI), and
reverse transcribed with 200 U Superscript (Life Technologies) for 60 min
at 45°C. After 15 min of heat inactivation at 70°C, the reaction tubes were
incubated for 5 min on ice. A total of 3 U RNase H (Life Technologies)
was added, and the reaction was incubated for 20 min at 37°C. A total of
80 ml TE buffer (10 mM Tris, 1 mM EDTA, pH 8) was added, and the
samples were stored at 4°C and analyzed within 1 mo. The sequences for
the genes of interest (CD3e, perforin, FasL, IFN-g, and CD40L) were
analyzed for primer annealing sites using the primer analysis software
Oligo version 4.0 (National Biosciences, Plymouth, MN). To easily rule
out amplification of genomic DNA, the 59 and 39 primer annealing sites
were placed on two different exons of the gene. Table I shows the primer
pairs (all 59 to 39 direction) that were used for PCR. All full-size templates
could be amplified from cDNA obtained from PHA-treated PBMC, and
competitor cDNA was shortened by 70 –100 nucleotides applying rPCR.
The competitor cDNA was amplified and the weight concentration was
determined by comparison with the known amount of nucleotide size standard (Lambda DNA BstEII digest; New England Biolabs) on the same gel.
For each competitor, a 100 pg/ml and a 100 fg/ml stock solution was
prepared in TE buffer and stored at 4°C. The cDNA obtained from the CTL
clones (1 ml) was mixed with the same volume of competitor cDNA, added
at four different concentrations (10-fold dilutions). This template mix was
amplified in a PCR reaction (final volume: 10 ml) containing 0.2 mM
dNTP, 250 nM of each primer, and 5 U/ml Taq (Boehringer Mannheim,
Indianapolis, IN) through the following protocol: 5-min initial denaturation
at 95°C, then 35 cycles of denaturing 30 s at 95°C, annealing 30 s at the
gene-specific annealing temperature, and elongating 1 min at 72°C, with
incubating for 10 min at 72°C for final extension. The PCR products were
resolved on a 1.5% agarose gel, stained with ethidium bromide, and photographed under UV transillumination (Eagle Eye; Stratagene, La Jolla,
CA). The resulting pictures were scanned (Scan Jet IIcx; Hewlett Packard,
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
Bedford, MA) at a responder to stimulator cell ratio of 2.5–7.5:1. All cultures were maintained at 37°C in 5% CO2 room air. In each experiment,
18 –30 microculture replicates per stimulator-responder combination were
initiated. The medium for coculture consisted of RPMI 1640 supplemented
with 10% human AB serum (Irvine Scientific, Santa Ana, CA), 2 mM
L-glutamine, 100 U/ml penicillin, and 100 mg/ml streptomycin. The medium was supplemented with exogenous IL-2 (R&D Systems, Minneapolis, MN) on day 3 (final concentration: 5–10 ng/ml). On day 7, the medium
was changed and the CTL were transferred to fresh stimulator cells. Cultures were again fed with fresh medium plus IL-2 on day 10. On day 14,
the CTL microcultures were tested for cytotoxicity against the stimulator
cell type (EC or BLC, respectively) using a calcein fluorescence release
assay (5), as described below.
From each experiment, the three microcultures that displayed the highest level of cytotoxicity were chosen for cloning by limiting dilution following published protocols (6), (7), with minor modifications as follows.
The lymphocytes were counted and suspended in complete cloning medium (RPMI 1640, 10% FCS, 2 mM L-glutamine, 100 U/ml penicillin, 100
mg/ml streptomycin, 20 ng/ml IL-2, and 1 mg/ml PHA-L (Sigma) at 1000,
100, or 10 cells/ml). These cell suspensions were distributed to roundbottom 96-well plates (100 ml/well), resulting in input cell numbers of 100
(24 replicates), 10 (24 replicates), and 1 (48 replicates) per well. Each well
was additionally supplemented with feeder cells consisting of 50,000 irradiated (30 Gy) PBMC autologous to the responder CD81 T cells and 2,000
mitomycin C-treated BLC autologous to the stimulator cell. In most experiments, EC-stimulated CTL were distributed into 96-well plates that
also contained stimulator EC at subconfluent density (5–10,000 cells/well).
On day 7, the clones were fed with the same medium, except that PHA was
not included. Beginning on day 14, cultures were inspected daily for the
presence of expanding clones. These were collected into 5 ml complete
cloning medium plus fresh feeder cells and expanded in tissue culture
flasks. The CTL clones were maintained in culture by repetitive weekly
restimulations (0.5 3 106 CTL/ml complete cloning medium plus feeder
cells). On day 21, the cloning plates were analyzed for the final number of
expanded clones per dilution to assess cloning efficiency and conformance
to “single hit” responses.
7024
ENDOTHELIAL CELLS EXPAND UNUSUAL ALLOREACTIVE CTL
Palo Alto, CA), band intensities were quantified (National Institute of
Health Image 1.61), and the competitor concentration of equivalent band
intensity to the test samples was determined. This concentration was taken
as the full-size cDNA concentration present in the sample. For each sample, the concentration of perforin, FasL, IFN-g, and CD40L was normalized to the concentration of CD3e (arbitrarily set to be 100,000 U (8)).
TCRVb determination
The TCRVb profile of the clones was determined by RT-PCR, according
to published methods applying a set of 22 Vb family-specific primers (9).
A total of 1 ml of cDNA was amplified in a PCR reaction (final volume: 10
ml) containing 0.2 mM dNTP, 250 nM of each primer, and 5 U/ml Taq
(Boehringer Mannheim, Indianapolis, IN) through the following protocol:
5-min initial denaturation at 95°C, then 30 cycles of denaturing 30 s at
95°C, annealing 30 s at 55°C, and elongating 1 min at 72°C with final
extension for 10 min at 72°C.
Statistical analysis
Results
Cloning of CTL from EC-stimulated polyclonal lines
To generate clonal lines, primary 2-wk cultures of CD81 T cells
stimulated by EC, BLC, or EC 1 BLC (see Materials and Meth-
FIGURE 1. Generation of CTL clones. A, CTL grown in microcultures
positive for cytotoxicity against the stimulator cell line were cloned by
limiting dilution. On day 21, clonal growth was assessed. Percentage of
negative microcultures per input cell number and frequency of growth
competent cells are shown for six representative cloning experiments.
These data conform to single hit events. B, The fraction of growth-competent cells in the 2-wk microcultures as a function of the initial stimulator
cell type is shown. C, 18 CTL clones were analyzed for the expression of
20 TCRVb-chain families using 22 family-specific PCR primers. With the
exception of 2 lines showing 3 and 5 TCRVb-chains, the other 18 lines
appear to be true clones by this analysis.
FIGURE 2. EC-selective CTL exist at a clonal level. A total of 94 human CTL clones were grown from cocultures with purified CD81 T cells
and allogeneic stimulator cells and were tested for cell type-specific cytolysis. Stimulator cells were EC (F), EC 1 BLC (‰), and BLC (E).
Between 5 and 8 wk after the coculture was started, the clones were tested
at least once for lysis of EC or BLC, both derived from the original donor
of stimulator cells. For each individual clone, percent specific lysis of EC
is displayed on the y-axis, and percent specific lysis of BLC on the x-axis.
Ten percent specific lysis was taken as threshold ofsignificant killing for
both target cell types (dotted lines). CTL that lysed both target cells ,10%
were defined as nonkillers. For those clones that were tested in more than
one CTL assay, the mean values of cytolysis are displayed.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
Data analysis of limiting dilution cloning was performed according to likelihood maximization using a computer program kindly provided by Dr. C.
Orosz (Ohio State University, Columbus, OH). The outcome of various
treatments between paired groups was tested for significant differences
using x2 analysis. Results from different groups in multivariable experiments were compared by ANOVA.
ods) were cloned by limiting dilution. The cloning conditions included irradiated PBMC as feeder cells (autologous to the responder T cells), mitomycin C-treated BLC (autologous to the
stimulator cells), IL-2 (20 ng/ml), and PHA-L (1 mg/ml). Pilot
experiments in the absence of PHA led to CD31CD82CD42
clones that failed to display cytotoxicity. Stimulator EC were usually present during the limiting dilution cloning if EC were present
in the initial stimulator cultures, but their absence did not seem to
influence the cloning efficiency ( p 5 0.71) nor change the phenotype ( p 5 0.30) of the emerging CTL clones. Therefore, the data
from cloning in the absence and presence of EC have been pooled
for purposes of statistical analysis. Overall, 66 CTL lines were
cloned using cells from 10 different donors and resulting in 7 different allocombinations. With only one exception, all 66 limiting
dilution clonings conformed to single hit kinetics for clonal growth
(Fig. 1A). The observed frequencies were much higher than in
primary cultures, reported previously (2), indicating that clonal
expansion of CTL precursors had occurred during the initial 2-wk
coculture. The fraction of alloreactive T cells present in the 2-wk
microcultures that were capable of expansion varied between 0.2%
and 25%. Surprisingly, this frequency was significantly higher for
cultures stimulated with EC, which expanded least during the 2-wk
primary culture than for cultures stimulated with both cell types or
BLC alone (Fig. 1B). Eighteen of these CTL clones were studied
by identifying the TCRVb-chain expressed by these cells (Fig.
1C). A total of 4 of 18 CTL lines expressed two, 8 of 18 expressed
one TCRVb-chain, and 4 of 18 CTL lines were negative for all of
the 20 TCRVb families tested, consistent with expected frequencies for human CD81 T cell clones (10). Only 2 of 18 CTL lines
expressed more than two TCRVb-chains, suggesting that they
were in fact oligoclonal. For the cytolytic functional studies reported in this work, all of the cloned CTL lines (including the
confirmed oligoclonal ones) were included in the analysis, but only
The Journal of Immunology
7025
Table II. EC favor the emergence of EC-selective CTL clonesa
Stimulator
EC, EC 1 BLC
BLC
Clones
(n)
EC Specific
(%)b
Conventional
(%)c
Table IV. EC favor the emergence of CTL clones that express CD40L
at resta
Nonkilling
(%)d
Stimulator
46
48
28
4
52
83
20
4
For all data, p 5 0.005.
Percent specific lysis of EC $23 BLC.
Percent specific lysis of EC ,23 BLC.
d
Percent specific lysis ,10%.
a
CD40L1
(%)b
CD40L2
(%)
23
21
52
5
48
95
EC
BLC
b
a
c
b
For all data, p 5 0.0006.
Measured by FACS.
the CTL, supporting the conclusion that EC select for expansion of
particular unusual but stable CTL phenotypes rather than transiently modulate the behavior of established CTL.
About 50% of the clones analyzed continued to expand for at
least 8 wk. We defined such clones as being long-term CTL. We
tested some of the long-term EC-selective CTL clones for NK-like,
allospecific, and class I MHC-dependent killing (Fig. 3). EC-selective CTL clones did not lyse the NK cell target K562. Pooled
EC were not lysed by EC-selective CTL clones, consistent with
allospecificity (Fig. 3A). EC-selective CTL clones were inhibited
by mAb against class I MHC and CD8 to the same extent as conventional, i.e., cell type-unrestricted CTL clones tested in parallel
(i.e., by about 35–50% at E:T ratios of 30:1; Fig. 3B). Unfortunately, HLA-typed EC lines were not available to directly test class
I MHC restriction of these clones. However, these data are consistent with alloreactive, class I MHC-restricted CTL that lack NK
activity. The pattern of EC-selective, alloreactive, class I MHCrestricted CTL clones is also consistent with the characteristics of
the 2-wk CTL lines described previously (2), some of which were
tested on HLA-typed EC cultures, supporting the interpretation
that alloreactive EC-selective killing exhibited by EC-stimulated
CTL lines results from characteristics of individual CTL clones
that have been expanded within the original cultures.
Phenotype of the CTL clones
We applied FACS analysis, immunostaining, and competitive RTPCR to analyze the phenotypes of long-term (8-wk) CTL clones.
All long-term CTL clones analyzed were CD3/CD8 double positive, but the level of CD8 was variable (Fig. 4B). Specifically,
Table III. EC favor the emergence of CTL clones that are not able to
secrete IFN-g after target cell contacta
Stimulator
Clones
(n)
IFN-g1
(%)b
IFN-g2
(%)
EC, EC 1 BLC
BLC
22
21
41
90
59
10
For all data, p 5 0.0006.
A total of more than 25 pg/ml supernatant 18 –24 h after target cell
lysis was assessed.
a
b
FIGURE 3. EC-selective CTL clones are allospecific and clsss I MHC
dependent. A, EC-selective CTL clone 12.2.1. was tested for cytolysis of
the stimulator EC, pooled third party EC, and K562, a typical NK cell
target. B, EC-selective CTL clone 19.1.3. was tested for cytolysis in the
presence of anti-class I MHC Ab (W6/32), anti-CD8 Ab (OKT 8), and a
nonbinding control Ab (K16/16). Representative of three experiments evaluating six EC-selective CTL clones.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
true clones, confirmed by TCRVb analysis, are presented in the
analysis of CTL phenotype.
From 66 cloning experiments, a total of 94 T cell clones were
successfully propagated. A total of 37 clones were expanded from
lines stimulated by EC alone, 48 clones were expanded from lines
stimulated by BLC alone, and 9 clones were expanded from lines
stimulated by EC 1 BLC. The cytotoxicity profile versus EC or
BLC targets (autologous to the original stimulator cells) of these
94 clones is shown in Fig. 2, in which the data are separated according to the initial allogeneic stimulator cell type (EC, BLC, or
EC 1 BLC). Only 11 T cell clones of the 94 were not cytolytic for
EC or BLC. These clones arose from EC (n 5 6), BLC (n 5 3),
and EC 1 BLC (n 5 2) lines and were not further characterized in
this study. We operationally defined EC-selective clones as those
that display percent specific lysis of EC $23 percent specific lysis
of BLC. By this definition, 17 of 94 CTL clones were EC selective.
Nine of these EC-selective CTL clones were derived from lines
stimulated with EC alone, four from lines stimulated with EC 1
BLC, and, surprisingly, four arose from lines stimulated with BLC
alone that had never been in contact with cultured EC before the
cytotoxicity assay. As shown in Table II, the presence of EC in the
initial cocultures increased the frequency of outgrowth of EC-selective CTL clones ( p , 0.005). Mixed stimulator cell populations
(i.e., EC 1 BLC) seem to be even more efficient inducers of ECselective CTL than EC alone (not shown), although the number of
clones analyzed is too small to allow separate statistical analysis.
This trend is consistent with our previous observation that mixed
stimulator cells accentuate EC selectivity of polyclonal CTL lines
(2).
The target cell profiles support the idea that EC selectivity is a
stable phenotypic trait of unconventional CTL. We have shown
previously that EC suppress the expansion of conventional CTL in
primary cocultures. To determine whether EC also alter the behavior of stable conventional CTL, we also examined whether the
addition of EC at the time of cloning by limiting dilution could
influence the phenotype of BLC-stimulated CTL clones. Seven
BLC-stimulated 2-wk microcultures were cloned both in the presence or absence of EC. None of the 16 CTL clones that arose in
these groups displayed an EC-selective phenotype whether or not
EC were present during cloning. These experiments suggest that
EC exert their selective effects during the initial differentiation of
Clones
(n)
7026
ENDOTHELIAL CELLS EXPAND UNUSUAL ALLOREACTIVE CTL
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 4. Surface phenotype of EC-selective and conventional CTL clones. Resting CTL clones, i.e., at least 7 days after restimulation with PHA and feeder cells, were
surface stained for CD8, CD3, and CD40L,
and analyzed by FACS. Shown are three representative EC-selective (4.1.2., 6.1.2.,
7.2.2.) and conventional (5.4.1., 10.1.1.,
12.3.1.) CTL clones. A, The cytolytic profile
of these clones using EC or BLC as targets is
displayed. Note that only the three EC-selective clones show some heterogeneity of CD8
expression (B) and express CD40L at rest (C).
some EC-selective CTL clones seemed to contain a CD8dim subpopulation, whereas conventional CTL clones were uniformly
CD8bright1. Interestingly, CD31CD8dim cells were present in populations established as monoclonal by TCRVb analysis and probably do not represent a differential T cell population.
All of the CTL clones expressed perforin1 granules detectable
by immunofluorescence microscopy (data not shown), and all
clones tested expressed perforin mRNA (Fig. 5). FasL was detectable on only 4 of 39 resting CTL clones: 2 EC-selective CTL
clones contained a subpopulation of FasL1 cells, and 2 BLC-stimulated conventional CTL clones were weakly FasL1 (not shown).
However, mRNA for FasL was detectable even in surface FasL2
cells and varied over a broad range (Fig. 5). It is possible that such
mRNA1, surface2 clones contain intracellular pools of FasL protein (11), but this was not explored in the present study.
CD40L is typically thought of as a Th cell costimulatory molecule (12, 13). Surprisingly, 7 of 9 of the first EC-stimulated, ECselective CTL clones analyzed expressed CD40L at rest, i.e., at
least 7 days after the last restimulation with PHA and feeder cells
(Fig. 4C). mRNA levels for CD40L were 10 –100-fold higher in
CTL clones that expressed CD40L on their surface than on
CD40L-negative cells (Fig. 5B). CD40L was also found on some
The Journal of Immunology
7027
EC-stimulated CTL clones that did not display EC selectivity, but
not on BLC-stimulated CTL clones. To determine whether EC
stimulators favored the emergence of CD40L1 CTL, we prospectively analyzed the next 44 CTL clones, including 23 that were
stimulated by EC and 21 that were stimulated by BLC. As shown
in Table IV, CTL that have been initially stimulated by EC are
much more likely to express CD40L at rest than CTL that were not
( p 5 0.0006).
Several additional molecules were analyzed on some samples of
the CTL clones produced in this study. All clones analyzed were
positive for CD2 (14 conventional and 3 EC selective) and negative for TCRg-chain (4 conventional and 2 EC selective) and
CD45RA (4 conventional and 2 EC selective). A total of 12 of 16
cytolytic CTL clones tested (10 conventional and 2 EC selective)
were positive for Mac-1 (CD11b/CD18). A total of 3 of 7 tested
CTL clones (1 conventional and 2 EC selective) expressed CD28.
Only 2 of 7 (both EC selective) were CD251 7 days after the last
restimulation, but all CTL clones (13 conventional, 1 EC selective)
tested expressed Fas (CD95) on their surface.
Cytokine secretion by the CTL clones
Forty-one long-term CTL clones were analyzed for their capacity
to secrete IFN-g. All clones tested secreted IFN-g in response to
PHA (not shown). However, differences emerged when CTL
clones were activated by target cells (Fig. 6). None of the 10 ECselective clones, but 8 of 14 EC-stimulated and 16 of 17 BLCstimulated conventional CTL clones secreted significant amounts
of IFN-g (.25 pg/ml), irrespective of the target cell in the assay
(Fig. 6B). The level of secretion of IFN-g did not correlate with
cytotoxicity at the single clone level in any of the groups analyzed.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 5. mRNA levels for T cell activation genes in resting EC-selective and conventional CTL clones. Total RNA was isolated from resting CTL
clones and reverse transcribed, and cDNA levels for various T cell activation genes were quantified by competitive PCR. For each gene of interest, the
cDNA level was normalized to the amount of CD3e (arbitrarily set to be 100,000 U) present in the sample. A, A representative competitive RT-PCR analysis
of two clones, one EC selective (6.1.2.) and one not (12.3.1.). B, Normalized data for 12 clones analyzed. 2, Unidentified; n.d., not determined; b.d., below
detection.
7028
ENDOTHELIAL CELLS EXPAND UNUSUAL ALLOREACTIVE CTL
Table V. IFN-g secretion and CD40L expression correlate with each
other but not with EC-selective killing
Phenotype
Clones IFN-g1 IFN-g2
(n)
(%)a
(%)
CD40L1d
CD40L2
13
30
IFN-g1a
IFN-g2
CD40L1d
CD40L2
27
8
10
25
23*
83*
EC Selective
(%)b
Conventional
(%)c
4**
25**
20***
4***
96**
75**
80***
96***
77*
17*
a
A total of 25 pg/ml in supernatant was collected 18 –24 h after target cell lysis
was assessed.
b
Percent specific lysis of EC $23 BLC.
c
Percent specific lysis of EC ,23 BLC.
d
Measured by FACS.
* p 5 0.0001, ** p 5 0.06, *** p 5 0.12.
Correlations among EC-stimulated characteristics
FIGURE 6. Long-term, EC-selective CTL do not secrete IFN-g after
target cell contact. A total of 41 long-term stable, cytolytic CTL clones (10
EC-selective (left panel), 31 conventional (middle and right panels)) were
tested for cell type-selective target cell lysis (A) and target cell-dependent
secretion of IFN-g (B). Seventeen long-term stable CTL clones were also
tested for target cell-dependent TNF secretion (C). A, For each of these
clones, cell type-specific cytolysis was determined in at least two independent cytotoxicity assays performed in weekly intervals, and the mean value
for each individual clone is displayed. B and C, In the second CTL assay,
in which cell type selectivity was confirmed, supernatant was also harvested and analyzed for secretion of IFN-g and TNF.
To test whether EC stimulators favored the emergence of CTL,
which were poor secretors of IFN-g, we prospectively analyzed the
next 43 CTL clones, including 22 that were stimulated by EC and
21 that were stimulated by BLC. As shown in Table III CTL that
have been initially stimulated by EC are much more likely to be
poor IFN-g secretors than CTL that were not ( p 5 0.0006).
In the preceding analyses, we prospectively analyzed the effects of
EC upon CTL differentiation. The conclusions of our initial experiments, which held up through completion of the analyses, indicated that EC stimulation favors EC selectivity, poor IFN-g secretion, and CD40L expression. A retrospective analysis of the
initial clones suggested that these three traits were linked. In a final
series of experiments, we prospectively analyzed more than 40
additional clones to determine the statistical significance of the
relationships among EC selectivity, poor IFN-g production, and
CD40L expression (Table V). We found that CD40L expression
correlated strongly with poor secretion of IFN-g after target cell
lysis ( p 5 0.0001). However, neither CD40L expression nor poor
secretion of IFN-g after target cell lysis reached statistical significance as indicators of EC selectivity ( p 5 0.12 and p 5 0.06,
respectively). Apparent dissociation of IFN-g secretion and EC
selectivity would be surprising since polyclonal CTL lines appeared to display both characteristics (2). It is more likely that
these traits are linked, albeit less tightly than poor IFN-g secretion
and CD40L expression, and that if we had further increased the
numbers of clones prospectively analyzed, the correlation between
poor IFN-g secretion and EC selectivity would have reached statistical significance.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
IFN-g mRNA levels at rest were not significantly lower in ECselective CTL clones ( p 5 0.22), and they did not correlate at all
with the capacity to secrete IFN-g after target cell contact (Fig.
5B). Interestingly, we observed several clones that had IFN-g
mRNA levels .2000 CD3e units at rest, but did not secrete measurable amounts of IFN-g even after target cell lysis (e.g., clone
11.3.2.; Fig. 5B). This suggests that additional translational or
posttranslational control mechanisms of IFN-g production must be
occurring.
The pattern of TNF secretion by CTL after lysis of EC was
similar to the pattern observed for IFN-g. However, the EC-selective CTL clones produced TNF after BLC contact, indicating a
partial dissociation of cytokine production and cytotoxicity in
these CTL clones (Fig. 6C). These data also suggest that EC-selective clones can recognize BLC, but it was not tested whether
such recognition is allorestricted. None of the CTL clones analyzed (EC selective and conventional) secreted measurable
amounts of IL-4 after target cell contact (not shown). Thus, lack of
IFN-g secretion does not reflect immune deviation to a Tc2-like
phenotype (14).
The Journal of Immunology
Discussion
a majority of our EC-selective and conventional CTL clones.
CD40L is also an effector cell marker, but more typically on CD41
Th cells (12, 13). We identified CD40L as the most consistent
surface marker for EC-stimulated CTL. However, the correlation
of CD40L expression with EC-selective killing pattern did not
reach statistical significance. Although we think these traits are
probably linked, and that statistical significance would become
clearer in a larger analysis, the points remain that some CD40Lexpressing CTL may exhibit a conventional target cell profile, and
that not all EC-selective CTL are CD40L positive. CD40L-CD40
signals have been shown to induce B cell activation and Ab isotype
switching (22, 23), dendritic cell maturation (24, 25), as well as
macrophage (26) and EC activation (27). Transiently expressed
CD40L on CD81 T cell clones has been shown to be functionally
active (28). If EC-stimulated CTL express this important costimulatory molecule so persistently in vivo, it may well substitute for
CD41 T cells and amplify immune responses in the absence of
class II MHC-restricted signals.
The second major difference between EC- and BLC-stimulated
CTL was the capacity to secrete IFN-g after target cell lysis. Longterm EC-selective CTL did not secrete IFN-g in response to EC
nor BLC. The threshold of integrated TCR activation events required for IFN-g secretion has been reported to be orders of magnitude higher than that for cytolysis (29). Our data would conform
with this model if EC-selective CTL were activated by a very rare
EC-specific Ag signal, sufficient to trigger killing, but insufficient
to induce cytokine secretion. However, EC-selective CTL clones
can secrete TNF in response to BLC, but not EC. This observation
indicates EC-selective CTL are responsive to BLC, and supports
the notion that peptide recognition is not the basis of the cell typeselective killing by EC-selective CTL clones, although we did not
show that TNF synthesis was actually alloantigen dependent.
The effects of EC upon CTL differentiation reported in our previous study and extended here to the clonal level have implications
for both transplantation and vascular biology. For example, our
data suggest that the differentiation and/or expansion of conventional CTL precursors are likely to be suppressed in a microenvironment in which EC are in close apposition to infiltrating T cells,
e.g., in the intima of the arterial wall. Those CTL that do emerge
may be EC selective, poorly secrete IFN-g after activation, and
constitutively express CD40L. In allografts, EC-selective CTL
may mediate endothelialitis, the harbinger of therapy-resistant
acute vascular rejection (30). Acute endothelialitis may evolve into
chronic graft arteriosclerosis, the principal cause of cardiac and
renal graft failure (31, 32). On the other hand, IFN-g has been
shown in mouse heart transplant models to be essential for intimal
expansion in subacute/chronic allograft rejection, despite the fact
that it is not required for acute parenchymal rejection (33). In
contrast, elevated CD40L and perforin mRNA levels have been
shown to be independent risk factors for acute kidney transplant
rejection (34, 35). CD40L is also relevant in chronic pathobiology
of the arterial intima, contributing to the formation of atheromata
in hyperlipidemic mice (36), possibly triggering acute coronary
syndromes in humans by promoting macrophage production of
tissue factor and matrix metalloproteinases (26) and mediating arterial intimal expansion in a heterotopic heart transplantation
model in mice (37). Finally, our new data suggest that coexpression of CD40L and perforin may be a useful marker to identify
unusual, EC-stimulated CTL in situ in the setting of intimal disease. We conclude by noting that endothelial cells may not only be
activators of circulating memory T cells, but may influence the
outcome of immune reactions by mediating novel forms of immune deviation.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
Cell type-selective effector T cells may play a role in tissue-specific injury during solid organ transplant rejection (15–17) or graft
versus host disease (18). EC-selective CTL have been isolated
from acutely rejecting heart transplants (1). We have described
previously that polyclonal CTL lines, which differentiated in the
presence of EC as stimulator cells, lyse EC, but not BLC autologous to the EC. We have now cloned individual CTL from these
polyclonal CTL lines to determine whether EC-selective killing is
a feature of an unusual subset of CTL clones. To do this, we first
developed culture conditions that allow limiting dilution and subsequent propagation of human CD31CD81perforin1 CTL clones
from our primary cocultures. Our initial analysis of Ag specificity
indicates that EC preferentially stimulate expansion of CTL clones
that are EC selective, class I MHC dependent, and allospecific. We
have not yet positively identified the restricting element that is
recognized by these clones as a conventional class I MHC molecule since we did not have a panel of class I MHC-typed EC
available to screen for specificity. This presents a logistical problem since EC are not immortal and each new culture must be
individually typed. Nevertheless, it is likely that these clones are
class I MHC restricted since we had shown previously that the
polyclonal, EC-selective lines, similar to the ones used for cloning
in the present study are, in fact, class I MHC restricted. We also
have not yet shown that these CTL are specific for particular peptides displayed by allogeneic class I MHC molecules. The precise
specificity of these clones will be investigated in future studies.
Although EC-selective CTL preferentially emerged from ECstimulated cultures, a majority of long-term CTL clones from these
same cultures actually displayed a cell type-unrestricted, i.e., conventional pattern of killing. We had noted previously that EC suppress growth of conventional CTL stimulated by BLC (2). The
simplest explanation of our results is that EC also suppress growth
of conventional CTL stimulated by EC, but that such clones can be
expanded under the conditions of limiting dilution culture in the
presence of feeder cells. In other words, the cloning conditions
allow emergence of conventional CTL that were silent (or poorly
expanded) in the polyclonal lines. However, we cannot rule out
that the cloning conditions that we optimized for growth at limiting
dilution allow some EC-selective CTL to convert to a more conventional specificity.
A major surprise of these studies was the production of four
EC-selective clones from cultures that had never seen EC in vitro.
In theory, EC-selective killing could arise from a target structure
formed by a peptide derived from an EC-specific protein (e.g., von
Willebrand factor) not synthesized by BLC (15). If so, it is hard to
imagine how such clones could be activated by BLC. Alternatively, cell-selective CTL may arise from a requirement for unusual accessory or adhesive interactions that would favor killing of
EC over BLC (e.g., binding to E-selectin or ICAM-2, adhesion
molecules expressed on EC, but not BLC (19)). Such an accessory
molecule-based explanation has recently been offered to account
for cell-selective killing of renal epithelial cells by CTL (20). It is
possible that the BLC-stimulated clones that display EC selectivity
also fit into this category. If this explanation is true, the generation
of EC-selective CTL arising from stimulation by BLC raises the
possibility that some or all EC-stimulated CTL that display EC
selectivity are also selective because of accessory interactions
rather than cell-specific peptides. This possibility will also be explored in our future studies.
Cytolytically active CTL clones fulfill the definition of an effector T cell. Expression of Mac-1 and perforin is a recognized
marker of effector CTL (21), and these molecules are also found in
7029
7030
ENDOTHELIAL CELLS EXPAND UNUSUAL ALLOREACTIVE CTL
Acknowledgments
We thank Louise Benson, Gwen Davis, and Lisa Gras for excellent technical assistance in cell culture.
References
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
1. Jutte, N. H., C. J. Knoop, P. Heijse, A. H. Balk, B. Mochtar, F. H. Claas, and
W. Weimar. 1996. Human heart endothelial-cell-restricted allorecognition.
Transplantation 62:403.
2. Biedermann, B. C., and J. S. Pober. 1998. Human endothelial cells induce and
regulate cytolytic T cell differentiation. J. Immunol. 161:4679.
3. Epperson, D. E., and J. S. Pober. 1994. Antigen-presenting function of human
endothelial cells: direct activation of resting CD8 T cells. J. Immunol. 153:5402.
4. Tosato, G. 1994. Generation of Epstein-Barr-virus (EBV)-immortalized B cell
lines. In Current Protocols in Immunology, Vol. 7. J. E. Coligan,
A. M. Kruisbeck, D. H. Margulies, E. M. Shevach, and W. Strober, eds. John
Wiley & Sons, New York, pp. 22.1–22.3.
5. Lichtenfels, R., W. E. Biddison, H. Schulz, A. B. Vogt, and R. Martin. 1994.
CARE-LASS (calcein-release-assay), an improved fluorescence-based test system to measure cytotoxic T lymphocyte activity. J. Immunol. Methods 172:227.
6. Wang, W., S. Man, P. H. Gulden, D. F. Hunt, and V. H. Engelhard. 1998. Class
I-restricted alloreactive cytotoxic T lymphocytes recognize a complex array of
specific MHC-associated peptides. J. Immunol. 160:1091.
7. Van de Griend, R. J., and R. L. Bolhuis. 1984. Rapid expansion of allospecific
cytotoxic T cell clones using nonspecific feeder cell lines without further addition
of exogenous IL2. Transplantation 38:401.
8. Fitzpatrick, D. R., K. M. Shirley, L. E. McDonald, H. Bielefeldt-Ohmann,
G. F. Kay, and A. Kelso. 1998. Distinct methylation of the interferon g (IFN-g)
and interleukin 3 (IL-3) genes in newly activated primary CD81 T lymphocytes:
regional IFN-g promoter demethylation and mRNA expression are heritable in
CD44highCD81 T cells. J. Exp. Med. 188:103.
9. Seko, Y., S. Ishiyama, T. Nishikawa, T. Kasajima, M. Hiroe, N. Kagawa,
K. Osada, S. Suzuki, H. Yagita, K. Okumura, et al. 1995. Restricted usage of T
cell receptor Va-Vb genes in infiltrating cells in the hearts of patients with acute
myocarditis and dilated cardiomyopathy. J. Clin. Invest. 96:1035.
10. Padovan, E., G. Casorati, P. Dellabona, S. Meyer, M. Brockhaus, and
A. Lanzavecchia. 1993. Expression of two T cell receptor a chains: dual receptor
T cells. Science 262:422.
11. Li, J. H., D. Rosen, D. Ronen, C. K. Behrens, P. H. Krammer, W. R. Clark, and
G. Berke. 1998. The regulation of CD95 ligand expression and function in CTL.
J. Immunol. 161:3943.
12. Grewal, I. S., and R. A. Flavell. 1998. CD40 and CD154 in cell-mediated immunity. Annu. Rev. Immunol. 16:111.
13. Mackey, M. F., R. J. Barth Jr., and R. J. Noelle. 1998. The role of CD40/CD154
interactions in the priming, differentiation, and effector function of helper and
cytotoxic T cells. J. Leukocyte Biol. 63:418.
14. Fowler, D. H., J. Breglio, G. Nagel, M. A. Eckhaus, and R. E. Gress. 1996.
Allospecific CD81 Tc1 and Tc2 populations in graft-versus-leukemia effect and
graft-versus-host disease. J. Immunol. 157:4811.
15. Steinmuller, D., M. E. Snider, R. L. Noble, and T. J. Waldschmidt. 1990. Dissociation of tissue destruction induced by cytolytic T cells in vivo and cytotoxicity as measured in vitro. Transplantation 50:663.
16. Heath, W. R., and L. A. Sherman. 1991. Cell-type-specific recognition of allogeneic cells by alloreactive cytotoxic T cells: a consequence of peptide-dependent
allorecognition. Eur. J. Immunol. 21:153.
17. Hadley, G. A., E. A. Rostapshova, and S. T. Bartlett. 1996. Dominance of tissuerestricted cytotoxic T lymphocytes in the response to allogeneic renal epithelial
cell lines. Transplantation 62:75.
18. Warren, E. H., P. D. Greenberg, and S. R. Riddell. 1998. Cytotoxic T-lymphocyte-defined human minor histocompatibility antigens with a restricted tissue
distribution. Blood 91:2197.
19. Springer, T. A. 1995. Traffic signals on endothelium for lymphocyte recirculation
and leukocyte emigration. Annu. Rev. Physiol. 57:827.
20. Hadley, G. A., S. T. Bartlett, C. S. Via, E. A. Rostapshova, and S. Moainie. 1997.
The epithelial cell-specific integrin, CD103 (aE integrin), defines a novel subset
of alloreactive CD81 CTL. J. Immunol. 159:3748.
21. Hamann, D., P. A. Baars, M. H. Rep, B. Hooibrink, S. R. Kerkhof-Garde,
M. R. Klein, and R. A. van Lier. 1997. Phenotypic and functional separation of
memory and effector human CD81 T cells. J. Exp. Med. 186:1407.
22. DiSanto, J. P., J. Y. Bonnefoy, J. F. Gauchat, A. Fischer, and G. de Saint Basile.
1993. CD40 ligand mutations in x-linked immunodeficiency with hyper-IgM.
Nature 361:541.
23. Kroczek, R. A., D. Graf, D. Brugnoni, S. Giliani, U. Korthuer, A. Ugazio,
G. Senger, H. W. Mages, A. Villa, and L. D. Notarangelo. 1994. Defective expression of CD40 ligand on T cells causes “X-linked immunodeficiency with
hyper-IgM (HIGM1).” Immunol. Rev. 138:39.
24. Bennett, S. R., F. R. Carbone, F. Karamalis, R. A. Flavell, J. F. Miller, and
W. R. Heath. 1998. Help for cytotoxic-T-cell responses is mediated by CD40
signalling. Nature 393:478.
25. Ridge, J. P., F. Di Rosa, and P. Matzinger. 1998. A conditioned dendritic cell can be
a temporal bridge between a CD41 T-helper and a T-killer cell. Nature 393:474.
26. Mach, F., U. Schonbeck, J. Y. Bonnefoy, J. S. Pober, and P. Libby. 1997. Activation of monocyte/macrophage functions related to acute atheroma complication by ligation of CD40: induction of collagenase, stromelysin, and tissue factor.
Circulation 96:396.
27. Dechanet, J., C. Grosset, J. L. Taupin, P. Merville, J. Banchereau, J. Ripoche, and
J. F. Moreau. 1997. CD40 ligand stimulates proinflammatory cytokine production
by human endothelial cells. J. Immunol. 159:5640.
28. Hermann, P., C. Van-Kooten, C. Gaillard, J. Banchereau, and D. Blanchard.
1995. CD40 ligand-positive CD81 T cell clones allow B cell growth and differentiation. Eur. J. Immunol. 25:2972.
29. Valitutti, S., S. Muller, M. Dessing, and A. Lanzavecchia. 1996. Different responses are elicited in cytotoxic T lymphocytes by different levels of T cell
receptor occupancy. J. Exp. Med. 183:1917.
30. Colvin, R. B., A. H. Cohen, C. Saiontz, S. Bonsib, M. Buick, B. Burke, S. Carter,
T. Cavallo, M. Haas, A. Lindblad, et al. 1997. Evaluation of pathologic criteria
for acute renal allograft rejection: reproducibility, sensitivity, and clinical correlation. J. Am. Soc. Nephrol. 8:1930.
31. Labarrere, C. A., D. R. Nelson, and W. P. Faulk. 1997. Endothelial activation and
development of coronary artery disease in transplanted human hearts. JAMA
278:1169.
32. 1997. Renal transplantation: access and outcomes. USRDS, United States Renal
Data System. Am. J. Kidney Dis. 30:S118.
33. Nagano, H., R. N. Mitchell, M. K. Taylor, S. Hasegawa, N. L. Tilney, and
P. Libby. 1997. Interferon-g deficiency prevents coronary arteriosclerosis but not
myocardial rejection in transplanted mouse hearts. J. Clin. Invest. 100:550.
34. Zheng, X. X., A. D. Schachter, L. Vasconcellos, J. Strehlau, Y. Tian, M. Shapiro,
W. Harmon, and T. B. Strom. 1998. Increased CD40 ligand gene expression
during human renal and murine islet allograft rejection. Transplantation 65:1512.
35. Strehlau, J., M. Pavlakis, M. Lipman, W. Maslinski, M. Shapiro, and T. B. Strom.
1996. The intragraft gene activation of markers reflecting T-cell-activation and
-cytotoxicity analyzed by quantitative RT-PCR in renal transplantation. Clin.
Nephrol. 46:30.
36. Mach, F., U. Schonbeck, G. K. Sukhova, E. Atkinson, and P. Libby. 1998. Reduction
of atherosclerosis in mice by inhibition of CD40 signalling. Nature 394:200.
37. Hancock, W. W., R. Buelow, M. H. Sayegh, and L. A. Turka. 1998. Antibodyinduced transplant arteriosclerosis is prevented by graft expression of antioxidant and anti-apoptotic genes. Nat. Med. 4:1392.