Journal of Experimental Botany, Vol. 57, No. 11, pp. 2887–2897, 2006
doi:10.1093/jxb/erl057 Advance Access publication 12 July, 2006
RESEARCH PAPER
Divergence in spatial expression patterns and in response
to stimuli of tandem-repeat paralogues encoding a novel
class of proline-rich proteins in Oryza sativa
Rong Wang1,2, Kang Chong1 and Tai Wang1,*
1
Key Laboratory of Photosynthesis and Environmental Molecular Physiology, Institute of Botany,
Chinese Academy of Sciences, 20 Nanxincun, Xiangshan, Haidianqu, Beijing 100093, China
2
Graduate School, Chinese Academy of Sciences, Beijing 100049, China
Received 13 March 2006; Accepted 12 May 2006
Abstract
Gene duplication has been recognized as a major route
to supply raw sequences for genome novelty in evolution, but the mechanism underlying the retention of
duplicate genes is not fully understood yet. Divergence
in spatial expression patterns was investigated here
and in response to stimuli of the four members of a
rice proline-rich protein gene family (OsPRP1), which
encode a class of proline-rich proteins. The four paralogues are tandemly organized within a 20 kbp range
of chromosome 10 without any interval of other open
reading frames and with a median KS value of 0.474.
These paralogues showed little similarity in their regulatory regions but high conservation in coding
regions. Search of an intergenomic cis-element database predicted their promoter regions with divergent
cis-element fingerprints. Further expression analyses
involving different tissues/organs and nine types of
stimuli by a promoter::GUS-fusion strategy revealed
that the four paralogues were expressed mainly in
vascular cylinders of different organs and showed diversity in tissue/organ specificity and in response to
these stimuli, with some overlapping expression. Furthermore, these data show that OsPRP1.2 appeared to
inherit most of the functions from their multifunctional
progenitor, whereas the other three genes diverged
after duplication events. Thus, the retention of paralogues in a multigene family seems to require a
more complicated diversification process than originally thought. In addition, the promoter::GUS strategy
is a powerful way to explore function divergence of
a tandem-repeat gene family.
Key words: Divergence, gene duplication, gene expression,
Oryza sativa, proline-rich proteins (PRPs), tandem duplication.
Introduction
The widespread existence of duplicated genes in all
sequenced genomes (Zhang, 2003) has supported the
notion that gene duplication is an important source of
new genes and hence plays a vital role during the evolution
of organisms (Gilbert et al., 1997; Bowers et al., 2003;
Gu et al., 2003, 2005). Duplication of individual genes
(tandemly repeated or dispersedly duplicated), of large
chromosomal regions (segmentally duplicated), or of complete genomes (polyploidization) accounts for the generation of sequence redundant copies (see review by Adams
and Wendel, 2005; Hurles, 2004). In rice, the model plant
of grasses, and significant grain species, duplicated segments cover more than half of the whole genome (Guyot
and Keller, 2004; Yu et al., 2005).
Functional divergence between duplicates is generally
accepted as being required for their long-term retention in
a genome, yet the evolutionary mechanism underlying the
divergence is not well understood. Ohno (1970) has proposed the fate of two duplicates: one gene maintains the
ancestor’s function and the other can freely mutate and
evolve. Therefore pure retention, gain of new function
(neofunctionalization) and loss of function (pseudogenization or non-functionalization) are possible fates for duplicates. An alternative model, the duplication–degeneration–
complementation (DDC) model (Force et al., 1999; Lynch
and Force, 2000), suggests another fate (subfunctionalization), whereby all duplicates partition the ancestral functions,
* To whom correspondence should be addressed. E-mail: [email protected]
ª The Author [2006]. Published by Oxford University Press [on behalf of the Society for Experimental Biology]. All rights reserved.
For Permissions, please e-mail: [email protected]
2888 Wang et al.
complement each other, and together carry out the same
functions of the ancestral gene. In addition, the functional
preservation of all duplicates without diversification can
provide more expression products (Gu et al., 2003).
Recent expression analyses at the genome scale have
revealed that, in yeast, humans, and Arabidopsis, most
duplicated gene pairs have diverged in expression and the
divergence seems to be correlated positively with evolution
time (with KS used as a proxy of evolution time) (Li, 1997;
Gu et al., 2002; Makova and Li, 2003; Blanc and Wolfe,
2004), which supports the notion that expression divergence might be a key step toward the retention of duplicated
genes (Ohno, 1970; Ferris and Whitt, 1979; Force et al.,
1999). Further studies in yeast and Arabidopsis genomes
showed that these duplicated pairs diverging in transcriptional regulation regions take up a higher proportion
than those diverging in coding sequences (Conant and
Wagner, 2003). Therefore, the effect of selection pressure
on coding regions is probably greater than that on regulatory sequences (Haberer et al., 2004). The mutations
in regulatory regions of duplicates may alter temporal
and/or spatial expression patterns or transcriptional responses to internal and external stimuli, thus resulting
in partitioning the ancestral functions between the duplicates (Moore and Puruggannan, 2005). Therefore, the expression divergence of duplicates represents an important aspect
of their functional diversification.
Genome-scale analyses have depicted a general picture
of expression divergence between duplicate gene pairs, but
the expression datasets may underestimate the proportion
of divergently expressing duplicates because (i) these studies mainly involved two members or duplicate pairs of
multigene families (Makova and Li, 2003; Hughes and
Friedman, 2005; Haberer et al., 2004); (ii) tandem-repeated
genes share high similarity over their transcripts, so completely excluding cross-hybridization is difficult (Blanc and
Wolfe, 2004); and (iii) datasets used in these studies were
possibly from partial tissues (Gu et al., 2002) and did not
include the expression information of duplicates responding to environmental stimuli and plant growth substances
(Haberer et al., 2004). Therefore, studies of expression
divergence between members of multigene families, which
represent a large proportion of duplicates in higher eukaryotes, is essential to understand how duplicates were
retained. However, present knowledge of divergent expression in multigene families is derived only from several
limited examples, such as the Arabidopsis MADS box
family of 105 genes, with retention involving divergent
expression and putative silencing (Kofuji et al., 2003;
Parenicova et al., 2003; Irish and Litt, 2005).
Expression divergence in spatial specificity has been
investigated here and in response to plant growth substances and environmental stresses among the four members of the OsPRP1 of rice family exhibiting tandem
duplication, which encodes a class of proline-rich proteins
(PRPs). The four paralogues show little similarity in their
regulatory regions, but their coding regions are highly
conserved. These data revealed non-uniform expression in
tissue/organ specificity and in response to additional stimuli.
These results, combined with the preferential expression of
the genes in the vascular cylinders of the tissues/organs
examined, indicated the possibly important role of this
family in plant development. These data also suggest
a multiform and/or mixed divergence mode (degeneration,
subfunctionalization, and part functional redundancy) for
these duplicates, and the functional divergence of multigene families may be more complicated than the theoretical
models suggest.
Materials and methods
Plant materials
Rice cultivar Zhonghua10 (Oryza sativa L .cv japonica) was used for
all genetic transformations. For seed germination and callus inducement, seeds were husked manually and then surface-sterilized by
soaking in 70% ethanol for 30 s and 0.1% HgCl2 for 10 min, then
rinsed several times with sterile distilled water. The seedlings were
planted in a greenhouse and grown under 12/12 h light/dark at 28 8C.
T-DNA construction
The promoter regions of OsPRP1.1, OsPRP1.2, OsPRP1.3, and
OsPRP1.4 (from OSJNBa0031A07, chromosome 10) were amplified
with the primer pairs P1F/R P2F/R, P3F/R, and P4F/R (Table 1),
Table 1. Primer pairs used for PCR
The adopted Restriction Enzyme (RE) sites are underlined.
Primer pair
Sequence
RE
P1F
P1R
P2F
P2R
P3F
P3R
P4F
P4R
PGF
PGR
59>AAGCTTGAAGCTAGACAGCGAGATG<39
59>CCCGGGTTTCCAGTGGCCTTGCTCTC<39
59>CTGCAGTTTGACCACACGGGATAATCG<39
59>TCTAGACCACCTGGAGATCTGCACAA<39
59>TTAAGCTTTAGTTGCTTTCTTGCTTAGTGGG<39
59>AATCCCGGGAGGTCTGCATAGTAAAATTCC<39
59>ATCAAGCTTACCACAATAGTGCACGTGCCTTC<39
59>TTACCCGGGCACTTGATCGCCACCTGGAG<39
59>CAAAGCCAGTAAAGTAGAACGGT<39
59>GCATGTTACGTCCTGTAGAAACCC<39
HindIII
SmaI
PstI
XbaI
HindIII
SmaI
HindIII
SmaI
Spatial expression patterns in rice
2889
Fig. 1. Characterization of the OsPRP1 family. (A) Tandem arrangement of OsPRP1 family in chromosome 10 and its flanking regions. Arrows
indicate the transcription direction of the respective paralogues. (B) Multiple alignments of the amino acid sequences. Arrowhead marks the cleavable
sites of signal peptidase, and the two 18 amino acid repeats are marked by ‘stars’. (C) Multiple alignments of 50 bp 59 and 39 termini of the introns show
the introns spliced out at the canonical GT-AG site (marked by ‘stars’) and flanking exons (italics). (D) Pairwise comparison of similarity among the
promoters (a), 59 UTRs (b), coding region (c), introns (d), and 39 UTRs (e). (E) Synonymous divergence (KS) computed by pairwise combinations
of OsPRP1 members.
respectively, and ligased into pGEM-T vector (Promega) through
T/A cloning after being gel purified. Because recent studies
have indicated that introns may be implicated in the regulation of
gene expression (Majewski and Ott, 2002; Rose, 2004; Seoighe
et al., 2005), these amplified fragments containing predicted
promoter regions, 59 untranslated regions, and the first exon and
the intron, covered 2.5 kbp upstream of nucleotide 62 of the
second exon for OsPRP1.1, 2.7 kbp upstream of nucleotide 19 of the
second exon for OsPRP1.2, 2.5 kbp upstream of nucleotide 1 of
the second exon for OsPRP1.3, and 2.6 kbp upstream of nucleotide
24 of the second exon for OsPRP1.4. After being confirmed by sequencing, each of the cloned fragments in T-vectors was cut and
then ligased into pBI121 (Clonetech, San Francisco) to replace the
CaMV 35S promoter, generating an immediate vector containing
the OsPRP1.n promoter::GUS::TerN8S fusion sequence. Finally, this
fusion sequence was inserted into the HindIII–EcoRI site of
pCAMBIA1300 (CAMBIA, Canberra, Australia), resulting in the
expected constructs, designated as pPRP1.1P-GUS, pPRP1.2P-GUS,
2890 Wang et al.
pPRP1.3P-GUS, and pPRP1.4P-GUS. All these constructs were
confirmed by DNA sequencing.
Agrobacterium-mediated transformation of rice
Each resulting construct was introduced into Agrobacterium tumefaciens strain EHA105 by a freeze–thaw method described previously (An, 1987), and then into rice embryonic calli to generate
transgenic plants by following the methods of Hiei et al. (1994) and
Toki (1997). The desired transgenic lines were determined by two
methods: (i) PCR with the GUS-specific primer pair PGF/R (Table 1)
and the genome DNA templates of T0 plants; and (ii) GUS activity
detected in T1 plants by histochemical staining (see below). T1
seeds from T0 plants were germinated and grown on a solid half-
strength MS medium containing 30 mg lÿ1 hygromycin (Hyg) for the
selection of transgenic progeny. T2 seeds were harvested from
independent T1 plants and put on plates on the same medium
for screening of homozygous T2 plants. Homozygous T2 seeds
were used for further experiments.
GUS histochemical staining
Different tissues from transgenic lines and wild-type plants were used
for histochemical detection of GUS as described by Jefferson et al.
(1987). Staining reactions were conducted at 37 8C for 1–4 h, then the
stained materials were dipped into 95% ethanol to clear the chlorophyll and observed under a stereomicroscope. To define the type of
cells showing GUS signals, the stained root materials were embedded
into Spurr resin and sectioned for optical microscopy.
Treatment of plant growth substances and stresses
T2 generation seedlings harbouring each construct were grown on
half-strength MS salt solution under 12/12 h light/dark at 28 8C.
Seedlings at the 2-leaf stage were transferred into a half-strength MS
salt solution containing either 0.1 lM IAA (indole acetic acid), 1 lM
GA3 (gibberellin A3), 1 lM ABA (abscisic acid), 1 lM KT (kinetin),
300 lM SA (salicylic acid), 10 lM ET (ethephon), 50 mM NaCl
(sodium chloride), or 200 mM Sor (sorbitol), with only roots
immersed completely in this solution and cultured for 12 h at
28 8C. For cold treatment, seedlings were exposed to 10 8C, with
controls exposed to 28 8C for 12 h. Treated seedlings were used to
extract total proteins for the GUS fluorogenic assay described next.
For each treatment, the experiments were repeated three times.
Fig. 2. Homology tree of OsPRP1 and other known or annotated PRPs.
A multiple alignment by the full alignment method (default parameters).
Sequences include OsPRP1.1;OsPRP1.4 (this study, Oryza sativa,
accession no. NP_919846; NP_919847; NP_919848; NP_919849),
annotated proteins (accession no. NP_919831, NP_919834, NP_919837,
NP_919838, NP_919839, NP_919840, NP_919842, NP_919843,
NP_919845 and AAD29802), a maize PRP (Zea mays, accession
no. CAB65536), AtPRP2 and AtPRP4 (Arabidopsis thaliana, accession no.
AAF64549 and AAF64551), NtGPP1 (Nicotiana tabacum, accession no.
AAF28387), and StGPP1 (Solanum tuberosum, protein_id: CAA04449).
GUS fluorogenic assay
GUS fluorogenic assay was performed as described by Jefferson
(1987). Briefly, total soluble proteins were extracted by grinding the
seedlings into a fine powder in liquid N2 and homogenating with
GUS extraction buffer (100 mM sodium phosphate buffer, pH 7.0,
10 mM EDTA, 10 mM DTT, 0.1% (v/v) Triton X-100, 0.1% sodium
lauryl sarcosine). Supernatant was collected by centrifuging at 15 000
g for 5 min at 4 8C and stored at ÿ80 8C in aliquots after being quickfrozen in liquid N2 until the enzyme activity assay.
For enzyme activity assay, 5 mM 4-methylumbelliferyl glucuronide (4-MUG) in the GUS extraction buffer was added to the enzyme
samples to a final concentration of 1 mM. All the reactions were
carried out on 96-well plates at 37 8C. Relative fluorescence units
(RFU) were read by the use of a fluorometer (DTX 880 Multimode
Detector, Beckman Coulter) with a 360 nm Exfilter and 465 nm
Emfilter every 30 min. The total soluble protein was determined by
Bradford assay (Bradford, 1976).
Table 2. Classification of known PRPs in higher plants on the basis of motifs, domains and biochemical characteristics
Class
Motif type
Distribution and
number of motif
Proline-rich
domains
I
PPXZ(K/T)
(X, Z=V, Y, H or E)
Tandem or in cluster
C-terminal
II
PPYV and PPTPRPS
Dispersed or in cluster
or no
N-terminal
III
IV
PPV, P(V/I)YK, KKPCPP
PEPK
Dispersed or in cluster
Tandem or dispersed
V
PKPE, P(V/E)PPK
Dozens of repeats
Dispersed
Several repeats
C-terminal
Whole protein
chain
C-terminal
Other characteristics
Examples and
references
SbPRP1/2 (Hong et al., 1989)
C-terminal hydrophobic
domain
Containing Cys
No distinct
proline-rich/poor domain
MsPRP5 (Györgyey et al., 1997)
ZmHyPRP1 (Josè-Estanyol
et al., 1992)
AtPRP2/4 (Fowler et al., 1999)
WPRP1 (Raines et al., 1991)
OsPRP1.1;4 (This study)
Spatial expression patterns in rice
Statistical analysis
Experiments were conducted in triplicate. ANOVA was used to
analyse relative activity of the GUS enzyme. P <0.05 was considered
significant.
2891
regions. Signal peptides were predicted by use of SMART (Schultz
et al., 1998; Letunic et al., 2004).
Results
Sequence analysis
TBLASTN in the dbEST of GenBank and BLASTP (Altschul et al.,
1997) were tried using OsPRP1.1 amino acid sequence as a query to
search for similar sequences of the OsPRP1 family. DNA and amino
acid sequence alignments, hydrophobicity profiles, and secondary
structures of proteins were analysed by use of DNAMAN5.2.2
(Lynnon Biosoft Corp.), with which a homology tree was developed,
with a distance matrix following the UPGMA method (Sneath
and Sokal, 1973). The putative cis-elements in each promoter were
predicted by use of the PLACE database (Higo et al., 1999;
Prestridge, 1991) to estimate the divergence degree in promoter
Organization of the OsPRP1 families
A previous study revealed that OsPRP1 is present in the
rice genome as a small gene family of four members (Wu
et al., 2003). Interestingly, the members are constrained
within a 20 kbp range, and arranged tandemly, without any
interval of other open-reading frames (ORFs). They have an
identical structure of two exons interrupted by one intron
(Fig. 1A), with relatively identical sizes of exons (154 kbp
for exon 1; 536 kbp for exon 2, except 521 kbp for
Fig. 3. The cis-element fingerprints in each promoter of the paralogues. Cis-elements were predicted by use of the PLACE database to estimate the
variation of the promoters during evolution. Their relevant functions and species origin are listed. Ruler marks the location upstream of transcription
initiation sites (+1). Listed is the frequency (a) of each type of element per 1.5 kbp random sequence and number of each type of matched elements within
the promoters of OsPRP1.1 (b), OsPRP1.2 (c), OsPRP1.3 (d), and OsPRP1.4 (e). Ar, Agrobacterium; As, Avena sativa; At, Arabidopsis thaliana; Bn,
Brassica napus; Dc, Daucus carota; Gm, Glycine max; Hv, Hordeum vulgare; Le, Lycopersicon esculentum; Nt, Nicotiana tabacum; Os, Oryza sativa;
Pc, Petroselinum crispum; Ph, Petunia hybrida; Ps, Pisum sativum; Pv, Phaseolus vulgaris; So, Spinacia oleracea; Vf, Vicia faba; Zm, Zea mays.
2892 Wang et al.
Table 3. A summary of the expression characteristics of the four
paralogues detected by GUS staining of transgenic rice lines
‘+’ and ‘ÿ’ indicate positive and negative staining results, respectively.
The more ‘+’, the relatively denser the colour blue is.
Young leaf
Mature leaf
Stamen/anther
Pistil
Glume
Lodicule
Stem/shoot
Node/internode
Root
Germination
Seed maturation
OsPRP1.1
OsPRP1.2
OsPRP1.3
OsPRP1.4
ÿ
ÿ
ÿ
ÿ
ÿ
+
+
+
ÿ
ÿ
ÿ
+++
+++
++
+
+++
ÿ
+++
+++
+
+++
+
+
ÿ
+
ÿ
ÿ
+
++
++
ÿ
+
ÿ
+
+
+
ÿ
+
ÿ
++
++
ÿ
+
+
OsPRP1.1). The intron of each is spliced at a canonical
GT-AG site and the splicing site occurs in the same amino
acid position (K51-N52) of the four deduced polypeptides
(Fig. 1B). But the introns showed great variation in similarity and size (114, 148, 353, and 114 kbp for OsPRP1.1,
OsPRP1.2, OsPRP1.3, and OsPRP1.4, respectively). All
but OsPRP1.1 share the same transcriptional direction
(Fig. 1A). All these data indicate that this family originated by gene duplication. Pairwise analysis of synonymous
substitutions per synonymous site (KS), which has been
accepted as the best proxy of evolution time (Gu et al.,
2002), revealed that OsPRP1.2 is distant from the other
three genes in evolution (Fig. 1E).
Furthermore, the promoter sequences (1.5 kbp upstream
of transcription initiation site), 59 UTR, intron, 39 UTR, and
coding region of each paralogue was extracted manually.
Pairwise comparison revealed high identity (>88.2%) between coding sequences (Fig. 1D), which is consistent with
high identity values (>90%) between amino acid sequences (Fig. 1B). By contrast, promoters, introns, or 39 UTRs
showed less sequence similarity (Fig. 1D), which suggests
that these sequences diverged more than did the coding
regions after gene duplication.
Further analysis revealed that proximal to the OsPRP1
family is one retroviral gag-pol-like gene, one potential
transposable element similar to Wanderer_110 type miniature inverted-repeat transposable element (MITE) (Turcotte
et al., 2001), and several simple repeats, including
(ATGC)n, G340, and (AT)n (Fig. 2A). Simple repeats and
transposable elements can help with unequal crossing over,
which results in DNA rearrangement or duplication
(Walker et al., 1995; Parniske et al., 1997). Accordingly,
illegal crossing over and inversion may be involved in
OsPRP1 members being produced from the same progenitor.
A novel class of small PRPs
The four deduced polypeptides with their molecular mass
of 24 kDa shared high amino acid identity (>90%) and had
an identical primary structure, including one hydrophobic
head lacking proline at the N terminus (;40 amino acids),
one transition domain in the middle region and one hydrophilic tail rich in proline at the C terminus (;70 amino
acids) (Fig. 1B). In the N terminus, a signal peptide of
22 amino acids was a probable target of signal peptidase
(Fig. 1B). Within the C terminus, a length of ;100 amino
acids contains some proline-rich motifs, including five
PKPE, three P(V/E)PPK, and two 18-amino acid repeats of
DHFHKKPVPPKPEPKPEP (except in OsPRP1.2, where
the first E in the first repeat and the sixth P in second are
replaced by D and S, respectively) (Fig. 1B). These prolinerich motifs are distinct from those identified from the
known four classes of plant PRPs (Table 2).
In addition, it was found that all EST (top100 hits) are
from rice. If the number of alignments is set as 1000, all the
EST (1168 hits) are from poaceous species, of which 49%
are from rice and the rest is from other cereal plants. It
seemed that the OsPRP1 family was restricted to rice, at
least to cereal species, so far. Moreover, a BLASTP search
in nrNCBI (non-redundant polypeptide sequence database)
indicated only 15 matches (E-value <7e-05) with partial
similarity. These hits included 10 unknown proteins annotated from the rice genome and five known PRPs from other
genomes. Homology analysis revealed that these sequences
can be sorted into different groups (Fig. 2). The four
OsPRP1 members, along with a maize PRP (accession no.
CAB65536), were grouped into a clade, which suggests
that the maize PRP is a maize homologue of OsPRP1. But
the maize PRP has a much higher molecular mass (54.5
kDa) and more complicated repetitive proline-rich motifs
both in type and number (e.g. 7 times PEPK, 8 times KPEP,
and 5 times TPIYHPP) (Table 2) than OsPRP1 proteins.
The four paralogues display non-uniform
tissue/organ specificity
1.5 kbp promoter regions were analysed upstream of the
putative transcriptional initiation sites predicted by a
comparison with cDNA sequences (Wu et al., 2003). These
promoters showed different cis-element fingerprints
(Fig. 3) with 51 predicted elements for OsPRP1.1, 61 for
OsPRP1.2, 50 for OsPRP1.3, and 62 for OsPRP1.4. All
these elements were matched to 31 consensus sequences,
of which seven were identified from rice and the other 24
from other plant species. This finding suggests potential non-uniformity of their expression, although some,
possibly most, of these elements may be false positive or
functionless.
Because the four paralogues show high similarity in their
cDNA sequences, it is almost impossible to distinguish
their expression sites in different tissues by the use of RNAbased strategies such as in situ hybridization. Therefore,
four fusions of OsPRP1.n promoter::GUS (also see
Materials and methods) were constructed to examine their
Spatial expression patterns in rice
2893
Fig. 4. GUS staining of transgenic rice lines carrying each promoter::GUS construct. The expression specificity of OsPRP1.1 (A, B), OsPRP1.2 (C–X),
OsPRP1.3 (Y–AC), and OsPRP1.4 (AD–AJ) in leaves (C, D, E, Y, AD), shoots (F, X, AJ), nodes (G, H, I, J, Z), stems (G, I, J, Z), roots (K–N), and
flowers (O, P, Q, R, S, AA, AB, AE, AF, AG). (M), (N), (Q), (R), and (S) were observed under an optical microscope and the others under
a stereomicroscope. Preparation of transverse sections of roots involved resin Spurr-embedded tissues (N). The materials in (M), (J), and (Z) were
sectioned manually. The glumes were removed before staining (P, AB, AG). The mature pollen grains were not stained (Q). (V), (W), (X), (AC), (AI),
and (AJ) show the germinating seeds of T1 generation. (T), (U), and (AH) indicate the seed maturing process of T2 generation. An, anther; AR,
adventitious root; Co, coleoptile; Cx, cortex; Ep, epidermis; Ex, exodermis; EZ, elongation zone; Fi, filament; Le, lemma; Lo, lodicule; LR, lateral root;
LS, leaf sheath; MZ, meristematic zone; Ov, ovule; Pa, palea; Pe, peduncle; PG, pollen grain; PR, primary root; Sc, scutellum; Se, seed; Sh, shoot; VC,
vascular cylinder.
expression patterns by GUS histochemical staining. The
organs examined included shoots/stems, young leaves,
nodes/internodes and roots from seedlings, and flowers
and mature leaves from flowering plants. All the four
paralogues were expressed in young vegetable organs,
including shoots and nodes/internodes (Table 3). In detail,
OsPRP1.2 was expressed in almost all the organs examined (Fig. 4C–X), with OsPRP1.1 in lodicules (Fig. 4B);
OsPRP1.3 in young leaves (Fig. 4Y), stamens (Fig. 4A, B)
and the interconnecting sites of stems and new adventitious
2894 Wang et al.
roots (Fig. 4Z); and OsPRP1.4 in mature leaves (not
shown), young leaf sheaths (Fig. 4A, D), glumes (Fig.
4A, F), expanding lodicules (Fig. 4A, G), and stamens
(Fig.4AG). None of these paralogues was expressed in
mature pollen grains and mature embryos (data not
shown). Only OsPRP1.2 was expressed in roots (Fig.
4K–N).
Members of OsPRP1 also showed differential expression
profiles during seed maturation and germination. Within
5 d after pollination, no GUS signal was detected for all
the four paralogues. As this phase proceeded, OsPRP1.2
(Fig. 4U) and OsPRP1.4 (Fig. 4A, H) were expressed in the
upper part of young seeds. In mature seeds, no GUS signal
was detected. OsPRP1.1 and OsPRP1.3 were not expressed
in developing seeds. In germinating seeds, OsPRP1.2 (Fig.
4V–X), OsPRP1.3 (Fig. 4AC), and OsPRP1.4 (Fig. 4AI,
AJ) were expressed in scutella and the first true leaves. Both
OsPRP1.2 (Fig. 4V–X) and OsPRP1.4 (Fig. 4AI, AJ) were
expressed in coleoptiles. In addition, only OsPRP1.2 was
expressed in primary (Fig. 4K, W), adventitious (Fig. 4L,
X) and lateral roots (Fig. 4L, X) and only OsPRP1.4 in the
peduncles of inflorescences and solitary flowers (Fig. 4AE).
Of the four paralogues, OsPRP1.1 showed expression at
the lowest levels while OsPRP1.2 showed expression at the
highest levels on the basis of relative intensity of GUS
staining. Finally, the transverse sections of GUS-stained
Fig. 5. The relative proportion (%) of GUS enzyme activity induced by
different treatments compared with their respective controls. Fluorescent
units of three aliquots of each sample were read. Error bars show the
standard deviations (SDs) of three replicates.
roots (Fig. 4N) revealed much denser GUS signals in the
vascular tissues than in other parts. This similar situation
was also observed in leaves/leaf sheaths (Fig. 4D, H, I),
styles (Fig. 4S), and anther filaments (Fig. 4S), which
suggests that OsPRP1 was expressed predominantly in
vascular tissues.
The four paralogues respond to additional
stimuli differently
The predicted cis-elements from each promoter contain
those potentially responsible for responding to plant growth
substances and environmental stresses, such as PBF-core,
DRE2-core, MART-box, MYB/C, and PYRIMIDINEbox for ABA; ASF1, and CATATG for IAA; GARE,
PYRIMIDINE-box, and WRKY71 for GA; ASF1, ELRE,
GT1-consensus, and W-box for SA; ARR1 for KT; GCCcore for ET; CDTDRE and LTRE for cold stress;
GT1GMSCAM4 for salt stress; and MYB/C and MYBcore for water stress (Fig. 3). Different cis-element fingerprints in the four promoters (Fig. 3) implied their diverse
abilities to respond to these additional stimuli.
The responses of the four paralogues to nine different
additional stimuli were examined here by the use of the
fluorogenic assay of GUS. The four paralogues had
differential responses to these stimuli (Fig. 5; Table 4):
(i) OsPRP1.1 was up-regulated by SA, and coldness,
while down-regulated by NaCl and Sor. (ii) SA and IAA
promoted the expression of OsPRP1.2, while GA3, ABA,
NaCl, Sor, and coldness depressed its expression; (iii) KT,
NaCl, and Sor up-regulated OsPRP1.3 whereas GA3, ABA,
SA, ET, and coldness down-regulated it. (iv) OsPRP1.4
was down-regulated by IAA, GA3, SA, ET, NaCl, and
coldness, and no stimulus up-regulated this gene (Fig. 5;
Table 4). Obviously, a given factor had different or even
reverse effects on the expression of the paralogues; for
example, SA promoted the expression of OsPRP1.1 and
OsPRP1.2 but repressed that of OsPRP1.3 and OsPRP1.4.
Discussion
PRPs have been identified in several plants including the
cereals wheat and maize (Hong et al., 1989; Raines et al.,
Table 4. Generalization of the effects of the different plant growth substances and environmental stresses on expression of each
paralogue
The ‘+’ means up-regulation while ‘ÿ’ indicates down-regulation (P <0.05). The symbol ‘n’ represents that there is no prominent difference (P >0.05)
between a given treatment and its control.
OsPRP1.1
OsPRP1.2
OsPRP1.3
OsPRP1.4
IAA
GA
ABA
KT
SA
ET
NaCl
Sor
Cold
n
+
n
ÿ
n
ÿ
ÿ
n
n
ÿ
ÿ
ÿ
n
n
+
n
+
+
ÿ
ÿ
n
n
ÿ
ÿ
ÿ
ÿ
+
ÿ
ÿ
ÿ
+
n
+
ÿ
ÿ
ÿ
Spatial expression patterns in rice
1991; Sheng et al., 1991; Fowler et al., 1999; Vignols
et al., 1999) and proposed to be implicated in the integrity
of the cell wall, the structural maintenance of organs
(Cheung et al., 1993), and defence reaction to pathogen
infection (Brisson et al., 1994). Thus, they are generally
accepted as a type of cell wall proteins (Showalter, 1993).
Several data also suggest that these proteins have other
functions (Cheung et al., 1993; Fowler et al., 1999). But
their determinate functions are ambiguous so far.
OsPRP1 reported here is a tandemly duplicated family
of four members encoding PRPs in rice. It is believed that
this is the first report of a PRP gene family in monocots.
Our previous comparisons of primary structures between
OsPRP1 and other known PRPs indicated that OsPRP1
represents a novel class of PRPs (Wu et al., 2003). The
joint expression sites of the four paralogues covered
almost all the examined tissues, with preferential expression in the vascular cylinder, and suggests the importance
of the family in regulating plant development. Furthermore, their ability to respond to multiple internal and/or
external stimuli indicates that this family may play roles
in regulating the adaptation of plants to environmental
conditions, such as defence reactions to adverse environmental conditions or/and pathogen infection elicited by
SA, which up-regulated OsPRP1.1 and OsPRP1.2 by 3fold and 6-fold, respectively. Obviously, OsPRP1.2 is
a main member of this family and may perform most of
the physiological functions of the family. The other three
can complement OsPRP1.2 in some expression sites and
responses to some internal and/or external stimuli. For
instance, OsPRP1.3 may function in responses to salt or
osmotic stress, and OsPRP1.1 may protect plants from
chilling injury on exposure to lower temperatures.
The tandem arrangement, identical structures, and high
conservation in both coding region and polypeptide
sequences suggest that the four paralogues originated by
tandem duplication from one common ancestor. Gene
duplication and translocation events could be responsible
for the birth of this gene family, because tandem duplication
may be introduced by unequal crossing over (paralogue
recombination) or non-homologous replication error
(Hurles, 2004), and the gene inversion may be the result
of some translocation-like events. The presence of simple
repeats and MITE sequences, which have been considered
potential illegal recombination sites (Fedoroff, 2000; Mao
et al., 2000; Turcotte et al., 2001), in the flanking regions
of the family provides support for this suggestion. A pairwise comparison indicated that KS values between
OsPRP1.2 and any one of the other three was much higher
than those between the other OsPRP1s, which suggests
that OsPRP1.2 might be ‘older’ than the other three genes.
In contrast to highly conserved coding sequences, the
predicted promoter regions, as well as other possible
regulatory sequences such as introns, showed less similarity. Further cis-element analysis revealed divergence in
2895
the predicted cis-elements in the four promoter regions. This
observation suggests that these promoters accumulated
mutations after the occurrence of the family, perhaps because
the regulatory sequences were subjected to lower selection
pressure than the coding regions (Haberer et al., 2004).
Compared with the more ubiquitously expressed OsPRP1.2,
the other three paralogues appeared to be expressed in limited
tissues and tended towards specialization in functions.
Seemingly, partial degradation in functions occurred during
the evolutionary processes of OsPRP1.1, OsPRP1.3, and
OsPRP1.4, whereas OsPRP1.2 preserved the most original
functions of their progenitor. These data support, in part,
the DDC model, which proposes that duplicated genes were
retained by the complementary loss of separate subfunctions of their multifunctional ancestor.
The responses of the four paralogues to the nine stimuli
showed obvious degenerate mutations, with OsPRP1.1
responding only to four, OsPRP1.2 to seven, OsRPR1.3
to eight, and OsPRP1.4 to six stimuli, which seems to be
compatible with the DDC model. However, besides the
functional degeneration of response to GA, ABA, KT, and
ET, the four members showed reverse response (up- versus
down-regulation) to the remaining factors. Because of the
complexity of transcriptional regulation, it is difficult to
explain the meaning of the phenomena in evolutionary
terms. Further experimental identification of functional
cis-elements involved in the responses is necessary.
Proper functional redundancy in duplicates is necessary
for an organism’s fitness by the increase in dosage of gene
products (Gu et al., 2003). During the evolution of the
duplicated OsPRP1, besides expression divergence, functional overlap between the four paralogues was seen from
their tissue/organ specificity and/or responses to different
stimuli. The redundancy in expression sites mainly occurred in fast-growing young tissues, such as shoots,
internodes, and young leaves (Table 3). This fact, together
with the expression preferential in vascular cylinders
detected by GUS staining (Fig. 4) and by in situ hybridization (Wu et al., 2003), indicates that their functional
redundancy may be essential for the normal development
of plants.
Acknowledgement
The study is supported by NSFC (Grant numbers 30370138 and
30270144).
References
Adams KL, Wendel JF. 2005. Polyploidy and genome evolution in
plants. Current Opinion in Plant Biology 8, 135–141.
Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z,
Miller W, Lipman DJ. 1997. Gapped BLAST and PSI-BLAST:
a new generation of protein database search programs. Nucleic
Acids Research 25, 3389–3402.
2896 Wang et al.
An G. 1987. Binary Ti vectors for plant transformation and promoter
analysis. Methods in Enzymology 153, 292–305.
Blanc G, Wolfe KH. 2004. Widespread paleopolyploidy in model
plant species inferred from age distributions of duplicate genes.
The Plant Cell 16, 1667–1678.
Bowers JE, Chapman BA, Rong JK, Paterson AH. 2003.
Unraveling angiosperm genome evolution by phylogenetic analysis of chromosomal duplication events. Nature 422, 433–438.
Bradford MM. 1976. A rapid and sensitive assay for the quantitation
of microgram quantitites of protein utilizing the principle of
protein–dye binding. Analytical Biochemistry 72, 248–254.
Brisson LF, Tenhaken R, Lamb C. 1994. Function of oxidative
cross-linking of cell wall structural proteins in plant disease
resistance. The Plant Cell 6, 1703–1712.
Cheung AY, May B, Kawata EE, Gu Q, Wu HM. 1993.
Characterization of cDNAs for stylar transmitting tissue-specific
proline-rich proteins in tobacco. The Plant Journal 3, 151–160.
Conant GC, Wagner A. 2003. Asymmetric sequence divergence of
duplicate genes. Genome Research 13, 2052–2058.
Fedoroff N. 2000. Transposons and genome evolution in plants.
Proceedings of the National Academy of Sciences, USA 97,
7002–7007.
Ferris SD, Whitt GS. 1979. Evolution of differential regulation of
duplicate genes after polyploidization. Journal of Molecular
Evolution 12, 267–317.
Force A, Lynch M, Pickett FB, Amores A, Yan Y-L, Postlethwait J.
1999. Preservation of duplicate genes by complementary, degenerative mutations. Genetics 151, 1531–1545.
Fowler TJ, Bernhardt CB, Tierney ML. 1999. Characterization
and expression of four proline-rich cell wall protein genes in
Arabidopsis coding two distinct subsets of multiple domain
proteins. Plant Physiology 121, 1081–1091.
Gilbert W, de Souza SJ, Long M. 1997. Origin of genes.
Proceedings of the National Academy of Sciences USA 94,
7698–7703.
Gu X, Zhang Z, Huang W. 2005. Rapid evolution of expression and
regulatory divergences after yeast gene duplication. Proceedings
of the National Academy of Sciences, USA 102, 707–712.
Gu Z, Cavalcanti A, Chen FC, Bouman P, Li WH. 2002. Extent of
gene duplication in the genomes of Drosophila, nematode, and
yeast. Molecular Biology and Evolution 19, 256–262.
Gu Z, Steinmetz LM, Gu X, Scharfe C, Davis RW, Li WH. 2003.
Role of duplicate genes in genetic robustness against null
mutations. Nature 421, 63–66.
Guyot R, Keller B. 2004. Ancestral genome duplication in rice.
Genome 47, 610–614.
Györgyey J, Németh K, Magyar Z, Kelemen Z, Alliotte T, Inzé D,
Dudits D. 1997. Expression of a novel-type small proline-rich
protein gene of alfalfa is induced by 2,4-dichlorophenoxyacetic
acid in dedifferentiated callus cells. Plant Molecular Biology 34,
593–602.
Haberer G, Hindemitt T, Meyers BC, Mayer KFX. 2004.
Transcriptional similarities, dissimilarities, and conservation of
cis-elements in duplicated genes of Arabidopsis. Plant Physiology
136, 3009–3022.
Hiei Y, Ohta S, Komari T, Kumashiro T. 1994. Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium
and sequence analysis of the boundaries of the T-DNA. The Plant
Journal 6, 271–282.
Higo K, Ugawa Y, Iwamoto M, Korenaga T. 1999. Plant cis-acting
regulatory DNA elements (PLACE) database. Nucleic Acids
Research 27, 297–300.
Hong JC, Nagao RT, Key JL. 1989. Developmentally regulated
expression of soybean proline-rich protein genes. The Plant Cell 1,
937–943.
Hughes AL, Friedman R. 2005. Expression patterns of duplicate
genes in the developing root of Arabidopsis thaliana. Journal of
Molecular Evolution 60, 247–256.
Hurles M. 2004. Gene duplication: the genomic trade in spare parts.
PLoS Biology 2, e206.
Irish VF, Litt A. 2005. Flower development and evolution: gene
duplication, diversification and redeployment. Current Opinion in
Genetics and Development 15, 1–7.
Jefferson RA. 1987. Assaying chimeric genes in plants: the GUS
gene fusion system. Plant Molecular Biology Reporter 5,
387–405.
Jefferson RA, Kavanagh TA, Bevan MW. 1987. GUS fusions: bglucuronidase as a sensitive and versatile gene fusion marker in
higher plants. EMBO Journal 6, 3901–3907.
Josè-Estanyol M, Ruiz-Avila L, Puigdomènech P. 1992. A maize
embryo-specific gene encodes a proline-rich and hydrophobic
protein. The Plant Cell 4, 413–423.
Kofuji R, Sumikawa N, Yamasaki M, Kondo K, Ueda K, Ito M,
Hasebe M. 2003. Evolution and divergence of the MADS-box
gene family based on genome-wide expression analyses. Molecular Biology and Evolution 20, 1963–1977.
Letunic I, Copley RR, Schmidt S, Ciccarelli FD, Doerks T,
Schultz J, Ponting CP, Bork P. 2004. SMART 4.0: towards
genomic data integration. Nucleic Acids Research 32, 142–144.
Li WH. 1997. Molecular evolution. Sunderland, MA: Sinauer
Associates.
Lynch M, Force A. 2000. The probability of duplicate gene
preservation by subfunctionalization. Genetics 154, 459–473.
Majewski J, Ott J. 2002. Distribution and characterization of
regulatory elements in the human genome. Genome Research 12,
1827–1836.
Makova KD, Li WH. 2003. Divergence in the spatial pattern of gene
expression between human duplicate genes. Genome Research 13,
1638–1645.
Mao L, Wood TC, Yu Y, Budiman MA, Woo SS, Sasinowski M,
Goff S, Dean RA, Wing RA. 2000. Rice transposable elements:
a survey of 73 000 sequence-tagged-connectors. Genome Research
10, 982–990.
Moore RC, Purugganan MD. 2005. The evolutionary dynamics of
plant duplicate genes, Current Opinion in Plant Biology 8,
122–128.
Ohno S. 1970. Evolution by gene duplication. New York, NY:
Springer-Verlag.
Parenicová L, de Folter S, Kieffer M, et al. 2003. Molecular and
phylogenetic analyses of the complete MADS-box transcription
factor family in Arabidopsis: new openings to the MADS world.
The Plant Cell 15, 1538–1551.
Parniske M, Hammond-Kosack KE, Golstein C, Thomas CM,
Jones DA, Harrison K, Wulff BBH, Jones JDG. 1997. Novel
disease resistance specificities result from sequence exchange
between tandemly repeated genes at the Cf-4/9 locus of tomato.
Cell 91, 821–832.
Prestridge DS. 1991. SIGNAL SCAN: a computer program that
scans DNA sequences for eukaryotic transcriptional elements.
Computer Applications in the Biosciences 7, 203–206.
Raines CA, Lloyd JC, Chao SM, John UP, Murphy GJ. 1991. A
novel proline-rich protein from wheat. Plant Molecular Biology
16, 663–670.
Rose AB. 2004. The effect of intron location on intron-mediated
enhancement of gene expression in Arabidopsis. The Plant
Journal 40, 744–751.
Schultz J, Milpetz F, Bork P, Ponting CP. 1998. SMART, a simple
modular architecture research tool: identification of signaling
domains. Proceedings of the National Academy of Sciences,
USA 95, 5857–5864.
Spatial expression patterns in rice
Seoighe C, Gehring C, Hurst LD. 2005. Gametophytic selection in
Arabidopsis thaliana supports the selective model of intron length
reduction. PLoS Genetics 1, e13.
Sheng J, D’Ovidio R, Mehdy MC. 1991. Negative and positive
regulation of a novel proline-rich protein mRNA by fungal elicitor
and wounding. The Plant Journal 1, 345–354.
Showalter AM. 1993. Structure and function of plant cell wall
proteins. The Plant Cell 5, 9–23.
Sneath PH, Sokal RR. 1973. Numerical taxonomy. San Francisco:
Freeman.
Toki S. 1997. Rapid and efficient Agrobacterium-mediated transformation in rice. Plant Molecular Biology Reporter 15, 16–21.
Turcotte K, Srinivasan S, Bureau T. 2001. Survey of transposable
elements from rice genomic sequences. The Plant Journal 25,
169–179.
2897
Vignols F, José-Estanyol M, Caparrós-Ruiz D. 1999. Involvement
of a maize proline-rich protein in secondary cell wall formation as
deduced from its specific mRNA localization. Plant Molecular
Biology 39, 945–952.
Walker EL, Robbins TP, Bureau TE, Kermicle J, Dellaporta SL.
1995. Transposon-mediated chromosomal rearrangements and
gene duplications in the formation of the maize R-r complex.
EMBO Journal 14, 2350–2363.
Wu XH, Mao AJ, Wang R, Wang T, Song Y, Tong Z. 2003.
Cloning and characterization of OsPRP1 involved in anther
development in rice. Chinese Science Bulletin 48, 2458–2465.
Yu J, Wang J, Lin W, et al. 2005. The genomes of Oryza sativa:
a history of duplications. PLoS Biology 3, e38.
Zhang J. 2003. Evolution by gene duplication: an update. Trends in
Ecology & Evolution 18, 292–298.