Molecular Mechanisms of
Drug Resistance in Human African Trypanosomiasis:
Investigations on the Role of the Trypanosoma brucei
Adenosine Transporter 1
Inauguraldissertation
der Philosophisch-naturwissenschaftlichen Fakultät
der Universität Bern
vorgelegt von
Federico Geiser
von Langenthal
Leiter der Arbeit:
Prof. Dr. T. Seebeck
Institut für Zellbiologie
Universität Bern
Molecular Mechanisms of
Drug Resistance in Human African Trypanosomiasis:
Investigations on the Role of the Trypanosoma brucei
Adenosine Transporter 1
Inauguraldissertation
der Philosophisch-naturwissenschaftlichen Fakultät
der Universität Bern
vorgelegt von
Federico Geiser
von Langenthal
Leiter der Arbeit:
Prof. Dr. T. Seebeck
Institut für Zellbiologie
Universität Bern
Von der Philosophisch-naturwissenschaftlichen Fakultät angenommen.
Bern, 4. Februar 2005
Messerli
Der Dekan:
Prof. Dr. P.
I
A. DRUGS, TREATMENT AND IMPLICATIONS IN
PARASITIC KINETOPLASTIDA
1
1. KINETOPLASTIDA
1
1.1. AN INTRODUCTION…
1
1.2. BUT, WHO ARE THEY?
2
1.3. WELL KNOWN MODEL ORGANISMS IN SCIENCE HISTORY
2
2. HUMAN PARASITIC KINETOPLASTIDA
4
2.1. STARTER
4
2.2. TRYPANOSOMA CRUZI, THE CAUSATIVE AGENT OF CHAGAS DISEASE
6
2.2.1. Parasite’s ID
2.2.2. Current Status and Control
2.2.3. The Drugs!
2.2.4. Fears and Threats of Drug Resistance in the Field
2.2.5. New ways to go?
2.2.6. Are we In View of an Immunotherapy?
2.2.7. Upshot!
6
7
7
9
9
10
11
2.3. LEISHMANIA SPP., THE CAUSATIVE AGENTS OF LEISHMANIASIS
12
2.3.1. Parasite’s ID
2.3.2. Current Status and Control
2.3.3. The Drugs!
2.3.4. Fears and Threats of Drug Resistance in the Field
2.3.5. Alternative Drugs?
2.3.6. New ways to go?
2.3.7. Are we In View of an Immunotherapy?
2.3.8. Upshot!
12
13
14
16
18
21
21
22
2.4. TRYPANOSOMA BRUCEI SPP., THE CAUSATIVE AGENTS OF SLEEPING SICKNESS
23
2.4.1. Parasite’s ID
2.4.2. Current Status and Control
2.4.3. The Drugs!
2.4.4. Fears and Threats of Drug Resistance in the Field
2.4.5. Molecular Mechanisms of Melarsoprol Drug Resistance in T. brucei
2.4.6. Alternative Drugs?
2.4.7. New Ways to Go with the Old Drugs!
2.4.8. Upshot!
23
24
26
31
32
39
41
42
3. CONCLUDING REMARKS
43
4. POSITIONING OF MY STUDIES
47
5. REFERENCES
48
B. SUMMARIES AND PUBLICATIONS
57
1. SUMMARIES
57
II
1.1. GENETIC VARIANTS OF THE TBAT1 ADENOSINE TRANSPORTER FROM AFRICAN
TRYPANOSOMES IN RELAPSE INFECTIONS FOLLOWING MELARSOPROL THERAPY
57
1.2. MECHANISMS OF ARSENICAL AND DIAMIDINE UPTAKE AND RESISTANCE IN
TRYPANOSOMA BRUCEI
59
1.3. MOLECULAR PHARMACOLOGY OF ADENOSINE TRANSPORT IN TRYPANOSOMA
BRUCEI: P1/P2 REVISITED
61
2. PUBLICATIONS
63
3. ACKNOWLEDGMENTS
107
4. CURRICULUM VITAE
108
1
A. Drugs, Treatment and Implications In Parasitic
Kinetoplastida
1. Kinetoplastida
1.1. An Introduction…
The Kinetoplastida are a widespread order of flagellated protozoans (Davila et al. 2002).
Phylogenetically, they are related to the ancient lineage of the euglenoida forming the phylum
euglenozoa. They are set apart from other flagellated protozoa, mainly by the presence of a
unique structure, the kinetoplast (Hannaert et al. 2003; Leander 2004). This is a DNAcontaining organelle (Figure 1) in the single mitochondrion of the parasites, unique in its
function, mode of replication and structure. The kinetoplast consists of several thousand DNA
minicircles and a
few
dozen
maxicircles. It is
always found near
the basal body,
which is located at
basal
body
the base of the
flagellum (Morris et
al.
2001).
Depending on the
life cycle stage of
Fig. 1 Schematic drawing of a trypanosome belonging to the order of
kinetoplastida. Magnified is a segment of the kinetoplast. Small loops are
minicircles [adapted from (Vickerman 1985; Hannaert et al. 2003;
Klingbeil et al. 2004)]
the microorganism,
the kinetoplast is
found in different
positions relatively to the nucleus (Vickerman 1985). Despite its proximity to the flagellum, it is
not involved in the function of the flagellum with regard to cell movement. Maxicircle DNA
corresponds to the mitochondrial DNA of traditional eukaryotes and encodes rRNA and
2
mitochondrial proteins. Minicircles encode the guide RNA molecules that serve for editing the
maxicircle mRNA transcripts (Morris et al. 2001; Klingbeil et al. 2004).
1.2. But, Who Are They?
Besides free-living aquatic and terrestrial kinetoplastids (e.g. Bodonina spp.,
http://www.speciesaccounts.org/Kinetoplastids.htm), the order of the kinetoplastida includes a
number of parasites responsible for diseases in humans, animals and plants. Trypanosoma
cruzi (Chagas disease), Leishmania spp. (human leishmaniases) and Trypanosoma brucei
gambiense and T. b. rhodesiense (human African sleeping sickness) are the major human
pathogens (Davila et al. 2002). T. congolense, T. vivax and T. b. brucei cause economically
important diseases of domestic animals. Phytomonas spp. causing e.g. wilts of cultivated
crops most notably in Latin America and in the Caribbean.
Kinetoplastid parasites represent an enormous burden in less developed countries regarding
human health and agricultural development. Take as an example the African trypanosome, T.
b. brucei causing the cattle disease Nagana. Studies estimating the economical impact of
African animal trypanosomiasis on cattle showed a total annual loss of 1338 million US$. This
is an estimate in terms of lost milk and meat production, not counting other values such as
cattle as suppliers of manure, or the impact of the disease in sheep, goats, camels and
horses (Kristjanson et al. 1999).
Thus, while most of the kinetoplastids are harmless free-living microorganisms, some
members of the order are parasites of great medical and economical importance.
1.3. Well known Model Organisms in Science History
Kinetoplastids are well-studied organisms not only because some of them are important
pathogens, but also because of their fascinating biology, and because they are suitable for
molecular analyses. Some of them served already a hundred years ago, in the early phases
of pharmacological studies, as model organisms of choice.
3
This was the case for the African trypanosomes thanks to their visibility under the microscope
and the reproducible course of infection in rodents.
In 1894 David Bruce discovered the presence of a kinetoplastid parasite, T. brucei, in the
African cattle “tsetse fly disease” (Cross 2001). Later on, in 1903, trypanosomes were
reported in sleeping sickness patients by the Italian doctor Aldo Castellani (Bentivoglio et al.
1994). Subsequently, Paul Ehrlich (Nobel Prize Winner in 1908; Figure 2) and his
collaborators were the initiators of the new art and science of chemotherapy, and drugs
against this kinetoplastid parasite were among the first synthesized.
Fig. 2: Paul Ehrlich (18541915) in his office in Frankfurt
(D). http://www.amuseum.de/
medizin/htm/ehrlich.htm
The evolution of the synthetic anti-trypanosomal dyes started in 1904 with the first “magic
bullet” Trypan Red, and climaxed in the creation of the colorless compound suramin (1916,
Bayer 205; Germanin), a symmetrical, urea-linked benzoyl analog of Trypan Red. Despite the
considerable age of this compound, it is still in use today against human African
trypanosomiasis (see 2.4.3 The Drugs!). The same statement applies to the melaminophenyl
arsenical drug melarsoprol (1949). A drug derived from the first organic arsenical Atoxyl
(1905), it still is in use for human treatment today. During this studies Paul Ehrlich postulated
the basic idea of chemotherapy saying that an active compound should demonstrate a strong
“Parasitotrophie” but at the same time little “Organotrophie” (Ehrlich 1909a). Paradoxically,
the development of new sleeping sickness drugs was almost completely neglected in the
th
second half of the 20 century.
4
Aggravating the treatment situation of this disease is the fact of rapidly increasing drug
resistance problems in several areas of the African continent. Again, Paul Ehrlich and coworkers were the first to discover the phenomenon of drug resistance in trypanosomes. In
experiments using parafuchsin, they observed a gradual loss of sensitivity of their
trypanosome strain after sub curative treatment (Ehrlich 1907a; Ehrlich 1909b). After vital
staining, they were able to see that drug resistant trypanosomes did not stain with
parafuchsin as readily as sensitive ones. Based on these observations, Ehrlich postulated the
“chemoreceptor” hypothesis, saying that drugs act via specific receptors, and that resistance
towards a compound is caused by a reduction of affinity of the respective receptor (Ehrlich
1909b).
This brief historical excursion is meant to demonstrate the importance of some scientific
discoveries and biological principles performed in the kinetoplastida. Many principles,
observations and postulations retained their validity to the present time.
2. Human Parasitic Kinetoplastida
2.1. Starter
While we have seen that the study of kinetoplastida microorganisms has been going on for
more than a century, many questions remain elusive and many unsolved problems persist. In
the last century Paul Ehrlich saw the eradication of human African trypanosomiasis as a
major goal of science, this disease is among the most neglected maladies in the world today.
Several scientist put great effort in the early years of chemotherapy trying to combat this
deadly disease. But no truly effective drugs were developed since the first half of the 20
th
century. Furthermore, since large parts of Africa were devastated by trypanosomiasis around
the turn of last century, extensive control programs were created. These led to an almost
complete eradication of the disease in the sixties’ of last century. Since this time, the
deterioration of the political and economical situation in many parts of Africa caused sleeping
sickness control to fall into oblivion, resulting in a reemergence of the fatal disease
5
(http://www.who.int/emc-documents/surveillance/docs/whocdscsrisr2001.html/African_Trypa
nosomiasis/A_Trypanosomiasis.htm).
Human African trypanosomiasis is not the only neglected human kinetoplastid disease. The
same applies to human leishmaniases where the commonly used drugs, Pentostam
TM
and
Glucantime, have been the basis of therapy worldwide for over 70 years. At present, there are
only two new drugs that have been introduced ever since. Regrettably one of these
compounds is expensive (AmBisome®), and therefore not affordable for the afflicted regions,
and the other is only registered for use in India (miltefosine). For the leishmaniases, effective
control programs have been established, but mostly due to financial constrains they were not
sustainable, leading to rapid re-emergence of the disease. Thus, the burden of leishmaniases
persists to our times and probably beyond (http://www.who.int/tdr/diseases/leish).
Last, but not least, there is Chagas disease. The treatment of this third major human
kinetoplastid disease relies completely on two compounds, nifurtimox and benznidazole.
Even though these drugs are relatively young (80’s), they have several drawbacks regarding
drug security and efficacy. And even if there are plenty of potential new drug targets detected
in this parasite, development of a new drug for clinical use is improbable due to the usual
economical constraints associated with the afflicted regions. At least control measures for
Chagas disease seem to pay off. Thanks to a joint effort of the disease-afflicted Southern
Cone Countries, the incidence of new Chagas disease cases was significantly reduced.
Altogether the Chagas disease situation seems to cause cautious optimism, despite of its still
huge socio-economical impact on the population (http://www.who.int/tdr/diseases/chagas/).
This introduction is meant to outline the disconcerting situation for the human kinetoplastid
diseases at the present moment. In the following paragraphs, the three different kinetoplastid
parasites causing Chagas disease (see 2.2), leishmaniases (see 2.3) and sleeping sickness
(see 2.4) will be described. The focus will be on drug treatments, drug resistance problems,
and possible positive developments.
6
2.2. Trypanosoma cruzi, the Causative Agent of Chagas Disease
2.2.1. Parasite’s ID
T. cruzi is the causative agent of American trypanosomiasis (also called Chagas disease;
Figure 3). The parasite belongs to the stercorarian type trypanosomes. This describes the
main way of infection of the hosts, which are over 150 species from 24 families of domestic
and wild mammals including humans. The blood feeding bugs of the Triatominae sub-family
are vectors of the disease (Figure 3). They commonly live in human homes and dwellings,
usually in rural areas (Morel et al. 2003)
Fig. 3: On the left: Electron microscopic picture of T. cruzi at the moment of adhesion to a
cardiac muscle fiber (http://www.fiocruz.br/ccs/estetica/chagas.htm). On the right: The
vector for Chagas disease, Triatoma infestans (http://www.unine.ch/zool/para/guerin/).
While taking a blood meal they defecate, hence stercorarian, and infective T. cruzi forms are
released (infective trypomastigotes). The released parasites then enter the host via the bite
wound. This process is additionally favored by rubbing the itching bite site. While 80-90% of
the infections occur via this route, 5-20% of infections are caused by blood transfusions, and
0.5-8% of cases are due to congenital infections (http://www.who.int/tdr/diseases/chagas/
(Rodriques Coura et al. 2002; Miles et al. 2003; Morel et al. 2003).
In the acute phase (early stage of the disease) the flagellated parasites persist in the
blood and cause an active infection. Most patients are asymptomatic or show only mild
symptoms and are unaware of the illness. Nevertheless, death can occur in this early disease
7
stages due to complications related with heart muscle- and brain inflammations, particularly in
children and immunocompromised people. After an intermediate, asymptomatic disease
phase with very low parasitemia, the patients enter a chronic phase that can last for many
years. During this stage the parasites invade most organs (intracellular amastigotes) of the
body. In up to 32% of those chronic patients, fatal damage to heart and digestive track occurs
(http://www.who.int/ctd/chagas/index.html; http://www.who.int/tdr/diseases/chagas/; http://
www.dpd.cdc.gov/dpdx/HTML/TrypanosomiasisAmerican.htm; (Samudio
et
al.
1998;
Rodriques Coura et al. 2002; Miles et al. 2003).
2.2.2. Current Status and Control
Chagas disease is a classical zoonosis, endemic in 18 countries throughout Central and
South America with an incidence of 800’000 cases a year, 45’000 deaths and an overall
prevalence of 17 million cases (Morel et al. 2003). Lately, great progress has been made in
the control of the vector and of the transfusional transmission. Brazil, Argentina, Bolivia,
Chile, Paraguay and Uruguay launched an initiative back in 1991, which intended to eliminate
the vector and to disrupt the infections by blood transfusion. As a result, the incidence of new
T. cruzi infections in many of the Southern Cone Countries decreased by 70%, mainly in
Uruguay (1997), Chile (1999) and in 8 of the 12 endemic states of Brazil (2000), which were
able to completely interrupt transmission of Chagas disease by vector and blood transfusions
(Moncayo 2003; Morel et al. 2003). This success in disease control is not paralleled by an
equally promising situation in disease treatment.
2.2.3. The Drugs!
At present only two drugs are available in clinical use for specific treatment of Chagas
disease, nifurtimox and benznidazole.
Nifurtimox
®
Nifurtimox (Bayer 2502; Lampit ) is a 5-nitrofuran {4-[(5-Nitrofurfurylidene)amino]-3methylthiomorpholine1,1-dioxide} that was launched in 1984 for Chagas disease treatment.
Due to the partial absence in T. cruzi of mechanisms for detoxifying free radicals, the parasite
8
is highly sensitive to oxidative damage. Nifurtimox induces free radical stress since it is
metabolized by nitroreductase to nitroanion radicals which, in presence of oxygen, lead to
reactive intermediates as superoxide radical anions (Urbina 2001; Rodriques Coura et al.
2002; Raether et al. 2003). The compound has some severe side effects such as convulsion,
anorexia, mood or mental changes, skin rash, muscle weakness and trembling
(http://www.nlm.nih.gov/medlineplus/druginfo/uspdi/202735.html; (Urbina 1999; Rodriques
Coura et al. 2002).
Benznidazole
Benznidazole (Rochagan; Bz) is a 2-nitroimidazole {N-benzyl-2-nitroimidazole-1-acetamide}
commercialized in 1981 by Roche. Its mode of action is not completely elucidated and could
include, similar to nifurtimox, interactions of nitroreduction intermediates with parasite
components or binding to lipids, proteins or DNA (Urbina 2001; Rodriques Coura et al. 2002;
Raether et al. 2003). Unfortunately the compound is fraught with serious side effects.
Convulsion, peripheral polyneuropathy, mucosal bleeding or bruising, allergic dermopathy,
vomiting and anorexia are some of the adverse reactions provoked by this compound
(http://www.nlm.nih.gov/medlineplus/druginfo/uspdi/202708.html, (Urbina 1999; Rodriques
Coura et al. 2002).
Despite the high frequency of side effects, these two compounds possess significant capacity
to cure acute phase patients of Chagas disease. Due to the high degree of biological and
genetic diversity of T. cruzi strains, response to therapy may vary significantly depending on
the strain that predominates in a particular geographic area (Murta et al. 1998; Murta et al.
1999). A further drawback of the compounds is that they are not effective against the chronic
stage of the disease. This stage is currently considered to be incurable since there are no
clinically available antiparasitic drugs that eliminate the parasite in this stage (Urbina 2001).
Chronic stage treatment involves only palliative cure and management of clinical
manifestations
(e.g.
http://www.dpd.cdc.gov/).
pacemakers
for
parasite-caused
cardiac
arrhythmia;
9
2.2.4. Fears and Threats of Drug Resistance in the Field
Up to now there are no signs for a spread of drug resistant T. cruzi in the field. However,
because of the biological and genetic diversity of different T. cruzi populations (zymodemes),
naturally occurring drug resistant parasites have been isolated (Filardi et al. 1987; Murta et al.
1998; Murta et al. 1999). Recently, the hypothesis of a drug resistance mechanism involving
P-glycoproteins (P-gps; members of the ABC superfamily involved in multidrug resistance
phenotypes in various organisms) in T. cruzi has been abandoned. There was no
overexpression of P-gps, the two pgp-genes (TcPGP1 and TcPGP2) were not amplified and
there were no changes in the karyotype in naturally drug resistant T. cruzi isolates.
Nevertheless, point mutations in TcPGP1 and TcPGP2 could change overall activity and
substrate specificity inducing a resistance based on qualitative rather than quantitative
differences (Murta et al. 2001).
2.2.5. New ways to go?
The extensive list of shortcomings of the available drugs regarding their safety and noresponsiveness for chronic stage treatment, drastically illustrates urgent need for new,
modern, efficacious and better-tolerated Chagas disease treatments.
In laboratories all over the world many approaches for specific treatment of T. cruzi infections
have been explored. The number of approaches scientists apply to attack the parasite are
infinite. One of them is to target potentially essential enzymes of the parasite as it was done
with thioridazine (a phenothiazine). This compound is a potent suicide inhibitor of T. cruzi’s
trypanothione reductase (Paglini-Oliva et al. 1998; Lo Presti et al. 2004). Trypanothione
reductase is the enzyme that maintains trypanothione in its thiol state (main reduced thiol in
T. cruzi). Trypanothione itself is involved in maintenance of the reductive environment against
oxidative stress within the cytosol.
Another potential treatment approach consists in exploiting possible toxic molecules derived
from natural sources. Some catechins (flavan-3-ols derivatives) from green tea (Camellia
sinensis) showed strong activity in T. cruzi mice models with IC50 in the pM range. Since they
act on arginine kinase, a key enzyme in the energy metabolism of the parasite, these
10
compounds could be used to treat the patients directly, or as a chemoprophylactic treatment
of banked blood (Paveto et al. 2004).
Several compounds originally developed as anti cancer drugs have shown activities in T.
cruzi. Good examples are phospholipid analogs like alkylglycerophosphocholines (AGPCs;
edelfosine) or alkylphosphocholines (APCs; miltefosine, lately registered for oral treatment of
visceral leishmaniasis; http://www.who.int/tdr/about/products/registration.htm). The
compounds demonstrated strong activity in vitro against intracellular T. cruzi amastigotes in
murine macrophages, heart muscle and Vero cells, as well as against extracellular
epimastigotes. However, there is little in vivo activity data. In T. cruzi the compounds were
shown to target phosphatidylcholine biosynthesis and to inhibit phospholipase C (Croft et al.
2003).
Progress in possible treatments for the chronic stage of the disease has also been
accomplished. Captopril (C9H15NO3S; Capoten; Bristol-Myers Squibb Company) is commonly
used to treat high blood pressure and heart failure. It is an angiotensin-converting enzyme
inhibitor, and it is now commonly prescribed to Chagas disease chronic-phase patients with
heart complications. A recent study showed that the compound is indeed capable of reducing
myocarditis and fibrosis in these patients, but it is not able to alter the host’s susceptibility to
T. cruzi infections (Leon et al. 2003).
2.2.6. Are we In View of an Immunotherapy?
The ongoing, controversial debate about the mechanisms involved in the pathology of the
disease slowed down the development of immunotherapy and vaccines. The main point of
contention is whether host tissue damage in Chagas disease patients is due to presence and
replication of intracellular amastigote forms, or whether the tissue damage is caused by an
autoimmune response induced by parasites antigens that mimic host proteins. The basic
question of the dispute is whether the immune response should be stimulated to eliminate the
parasites, or whether it should be inhibited to avoid the autoimmunity. Despite this
controversy, studies on parasite antigens as possible vaccines have been going on. Recent
studies in mice using DNA vaccines have shown that therapeutic vaccination may be an
11
interesting strategy for the immunotherapy of T. cruzi infection (Dumonteil et al. 2004).
Therefore, a positive course of events in this research direction could soon lead to a positive
outcome.
2.2.7. Upshot!
This rudimentary overview of new approaches to Chagas disease treatment in the last two
paragraphs should elucidate that promising developments are underway, and at a rapid pace.
In the hope that the transfer of laboratory discoveries to drug development will work more
smoothly than in the past, thanks to new public-private partnerships (e.g. Drugs for Neglected
Diseases initiative, DNDi; http://www.dndi.org), there is a cause for cautious optimism in new
alternatives for treatment and control of Chagas disease.
12
2.3. Leishmania spp., the Causative Agents of Leishmaniasis
2.3.1. Parasite’s ID
Leishmaniasis is caused by the protozoan parasites of the genus Leishmania. The
parasite’s life cycle requires two different morphological and metabolic stages, the
promastigote form in the blood-feeding female sandfly vector (Phlebotomus spp. and
Lutzomia spp.) and the amastigote form in the mammalian hosts.
Fig. 4: On the left: The sandfly vector for leishmaniasis, Lutzomia spp
(http://www.who.int/tdr/media/image.html). On the right: Giemsa stained L. donovani
amastigotes causing Kala azar. (http://www.who.int/tdr/media/image.html).
Host infection occurs while the sandfly vector takes its blood meal, regurgitating infective
promastigotes from the gut and pharynx. Once inside the mammalian host, amastigote form
parasites proliferate inside macrophages. They survive and multiply inside phagolysosomes
(http://www.who.int/tdr/diseases/leish/default.htm; http://www.who.int/topics/leishmaniasis/en/;
http://www.msf. org/; (de Almeida et al. 2003; Desjeux 2004; Desjeux 2004a).
The epidemiology of the disease is extremely variegated with at least 17 Leishmania
pathogenic species and 30 sandfly vector species. The disease called leishmaniasis is
actually a complex of human diseases caused by different Leishmania spp. Three
predominant clinical manifestations are distinguished: visceral- (VL), cutaneous- (CL), and
mucocutaneous leishmaniasis (MCL). Some of these disease manifestations can clearly be
correlated to particular Leishmania specie. VL (also known as Kala azar) is caused by L.
donovani. This leishmaniasis is characterized by irregular fever boosts, weight loss, spleen
and liver swellings and sometime serious anemia. It has a fatal outcome if it is left untreated.
13
The severely mutilating MCL is provoked in the new world by L. braziliensis. It can cause
lesions leading to partial or total destruction of the mucous membranes of the nose, mouth
and throat cavities and surrounding tissues. Finally, for the frequently self-healing CL (also
known as Baghdad ulcer, Dehli boil or Bouton d’Orient), species as L. major, L. mexicana, L.
braziliensis and L. panamensis are responsible. CL provokes skin ulcers especially on face,
arms and legs. Sometimes up to 200 lesions can be observed simultaneously, causing on
one hand severe disability and on the other leaving the patient permanently marked by the
disease, often the cause of serious social prejudice (http://www.who.int/tdr/diseases/
leish/default.htm; http://www.who.int/topics/leishmaniasis/en/; http://www.who.int/csr/
resources/publications/CSR_ISR_2000_1leish/en/index.html; (Croft et al. 2003a; Desjeux
2004; Desjeux 2004a).
2.3.2. Current Status and Control
Leishmaniases affect 88 countries around the world, the majority of them being developing
countries. Altogether there is prevalence of 12 million infected people with 60’000 deaths
annually and a population of 350 million at risk. The incidence of VL is estimated at 500’000
cases annually and for the CL at around 1.5 million. 90% of VL cases occur in poor rural and
suburban areas of Bangladesh, India, Nepal, Sudan and Brazil, whereas ninety percent of CL
cases occur in Afghanistan, Algeria, Brazil, Iran, Peru, Saudi Arabia and Syria
(http://www.who.int/tdr/diseases/leish/diseaseinfo.htm; http://www.who.int/csr/resources/
publications/CSR_ISR_2000_1leish/en/index.html; (Desjeux 2004).
These complicated sets of leishmanial diseases are, for the moment, impossible to be kept in
line. Control is attempted at several levels. Since the disease mostly occurs in poor countries
where 80% of the population earns less than US$ 2 a day, the possibilities for fighting the
diseases are severely limited by financial constraints. Insect vector control is widely done by
spraying houses with insecticides (usually the pyrethroid lambdacyhalothrin). Sandflies are
not yet resistant to these insecticides, and the odds of infections in household levels can be
significantly reduced by spraying (Davies et al. 2003). Nevertheless, the sustainability of such
campaigns is essential since abolishment leads to rapid re-emergence of the disease to precontrol levels. Insecticide treated bed nets showed to be a simple and effective method to
14
reduce CL in some regions. The global effectiveness cannot be estimated due to the lack of
large-scale epidemiological data and due to the fact that bed nets efficacy may vary
depending on the behavior of the local sandfly populations (Davies et al. 2003). Control of
zoonotic infections of VL is mainly done by culling positively diagnosed dogs. The absence of
effective and rapid diagnostic tools for detecting infected dogs severely limits the efficacy for
this approach (WHO, Manual of visceral leishmaniasis control; Geneva, 1996; (Davies et al.
2003; Desjeux 2004a).
In addition, the control of VL is complicated by the fact that in some regions the disease is not
a classical zoonosis, rendering reservoir control impossible. In some Indian areas the disease
is transmitted only from man to man (anthroponotic), which can favor the spread of a resistant
strains in a population (Sundar 2001a).
In the case of CL, reservoir hosts are predominantly small rodents, the burrows of which also
serve as breeding places for sandflies. In these cases, control strategies include the use of
poisoned baits and environmental management (http://www.who.int/tdr/index.html;
http://www.who.int/csr/resources/publications/CSR_ISR_2000_1leish/en/index.html). Despite
all control efforts and scientific progress, the burden of leishmaniasis persists due to
technical, managerial, financial and political constrains.
2.3.3. The Drugs!
At the treatment front, the main drugs recommended for VL and CL are still the two
pentavalent antimonials Pentostam™ and Glucantime, in use for over 50 years.
Pentostam™
Pentostam™ (sodium stibogluconate; GlaxoSmithKline) was launched in 1937. Its structure
still remains unknown, incredible as this may sound. Research on sodium stibogluconate
revealed that it is a complex mixture of components with different molecular masses (Roberts
et al. 1998). Although its precise mode of action remains elusive, it is generally believed that
V
III
the inert pentavalent antimony (Sb ) has to be reduced to the toxic trivalent form (Sb ), which
finally causes parasite death (Denton et al. 2004). This hypothesis has recently been
experimentally tested and resulted in the identification and characterization of a parasite
15
specific thiol-dependent reductase (TDR1) that is able to catalyze this reaction. TDR1
V
III
converts Sb to Sb using glutathione as the reductant (Denton et al. 2004). The proposed
antileishmanial activities of Sb
III
range from action on host macrophages to inhibition of
glycolytic enzymes with essential thiol groups to a possible interaction with trypanothione
reductase (Greif et al. 2001; Croft et al. 2003a). However, little is known experimentally.
Glucantime
Glucantime (meglumine antimoniate; Aventis) is also a pentavalent antimonial compound
used for over 50 years for leishmaniasis treatment. Despite the fact that its structure is known
V
III
(Roberts et al. 1998), and that the reduction of Sb to Sb by TDR1 has been elucidated
(Denton et al. 2004), little is known about its mechanism of action. Presumably also here
antileishmanial action might be due to activity on host macrophages, where the amastigote
forms live and proliferate in the phagolysosomes (Roberts et al. 1998; Greif et al. 2001; Croft
et al. 2003a).
The first-line chemotherapy by these two drugs is haunted by several difficulties. The
compounds, not being the newest developed, have several side effects ranging from simple
headaches to the loss of consciousness, renal or cardiac diseases (http://www.drugs.com/
xq/cfm/pageID_0/htm_202733/type_cons/bn_Glucantime/micr_medex/qx/index.htm; http://ww
w.tiscali.co.uk/lifestyle/healthfitness/health_advice/netdoctor/archive/100004128.html;
(Katlama et al. 1985). Furthermore, there is an intrinsic difference in sensitivity of the different
Leishmania species to the antimonials due to biochemical and molecular differences. For
example, L. donovani and L. braziliensis were shown to be 3-5 times more sensitive to
Pentostam™ than L. major, L. tropica or L. mexicana (Croft 2001). The cure of VL an CL with
pentavalent antimonials may require up to 28 days of parenteral (intravenously or
intramuscularly) administration and is often too expensive for afflicted people (120-150 US$),
which severely limits the drug’s usefulness (http://www.who.int/tdr/index.html). A relatively
new cause of unsatisfying treatment efficacy is conferred by HIV/VL co-infections.
Immunosuppression due to HIV co-infection leads to aggravation of both infections, and to
16
frequent failures of first line chemotherapy of the leishmaniasis (Berhe et al. 1999; Wolday et
al. 1999). Last but not least, severe drug resistance problems are arising.
2.3.4. Fears and Threats of Drug Resistance in the Field
The most severe drug resistance problem reported to date occur in Bihar, India (Sundar
2001a). In this region there is clear evidence of acquired resistance of L. donovani to
pentavalent antimonials. The main reason is their widespread misuse. Pentavalent
antimonials are freely available in India, and many patients (73%!) first consult unqualified
quacks, which might not use the drugs appropriately. In addition, there is a long history of
sub-curative treatment regimes, and of variation of drug quality by Indian drug manufacturers.
Additionally, in India transmission of VL is anthroponotic, favoring the spread of refractory
parasites in the population since the sensitive strains get efficiently eliminated by drug
treatment. This multitude of problems led in North Bihar to pentavalent antimonial drug failure
rates of up to 65% (Sundar 2001a).
The exact cause of resistance in field isolates remains elusive, numerous possible
molecular mechanisms of antimonial drug resistance have been studied, mainly in labinduced resistant strains. Two prominent antimonial resistance-causing examples will be
discussed.
In many different organisms, drug resistance is often associated with a loss of function (e.g.
down regulation, depletion) of drug uptake systems. Uptake systems for antimonials in
Leishmania spp. remained unknown, and any correlation of resistance phenotypes with
uptake depletion remains uncertain. Even though TDR1 has been associated with reduction
V
III
of Sb to the toxic Sb inside L. major (Denton et al. 2004), and that resistant L. donovani
field isolate was reported to lack antimoniate reduction activity (Shaked-Mishan et al. 2001),
the relevant reduction could still occur outside of the parasite, in the macrophage. This would
again imply the presence of some transport systems, which would allow the toxic trivalent
antimonials to penetrate the parasite and be effective. Gourbal et. al. identified and
characterized for the first time two aquaglyceroporins from L. major (LmAQP1) and L .
tarentolae (LtAQP1). These two aquaglyceroporins were clearly responsible for the uptake of
17
toxic trivalent antimonials (Gourbal et al. 2004). Disruption of one of the two LmAQP1 alleles
rendered the cells 10 times more resistant to trivalent antimonials than the parental strain,
and expression of LmAQP1 in a resistant field isolate sensitized the isolate to wild type levels.
Gourbal’s study clearly showed for the first time in Leishmania spp. a possible involvement of
deficient drug import mechanisms in correlation with drug resistance.
At the antipode of resistance caused by decreased cellular drug import stands an increased
drug export.
The most outstanding examples for increased drug export are members of the ATP-Binding
Cassette (ABC; Figure 5) transporter superfamily.
Fig. 5: Schematical three-dimensional
drawing of a classical ABC-type transporter.
The transporter has four domains. The two
hydrophobic transmembrane domains
consisting of six transmembrane peptide
segments each, and the two catalytic ATP
domains (or cassettes). (adapted from,
Molecular Biology of the Cell, Fourth
Edition)
Biomembrane
Cytosol
ATP-Binding cassettes
The best studied ABC transporters come from Escherichia coli where they are the largest
protein family with a total of 79 ABC transporters making up for 5% of the bacterial genome
(Linton et al. 1998), and from drug resistant tumor cells with their classes of P-glycoproteins
(P-gps; human MDR1) (Gros et al. 1986; Klokouzas et al. 2003; Jones et al. 2004) and
Multidrug Resistance associated Proteins (MRP) (Krishnamachary et al. 1993; Klokouzas et
al. 2003). These transporters are able to detoxify the cells from a wide variety of anticancer
drugs, antibiotics and immunosuppressive drugs. ABC transporters seem to have a broader
impact, not only in human tumor chemotherapy, but also in drug resistance in parasitic
protozoa.
A search for annotated proteins in the L. major genome project identified a total of 8216
putative open reading frames (ftp://ftp.sanger.ac.uk/pub/databases/L.major_sequences/
LEISHPEP/GeneDB_protein_database_0907049; latest sequencing status accessible: 9. July
18
2004). 33 of those proteins were annotated as ABC transporters or ABC transporter-like
proteins. Indeed, also in Leishmania spp. ABC proteins have been incriminated, at least in
vitro, to cause drug resistance. Focusing here only on antimonial resistance in Leishmania
spp., an ABC transporter from L. tarentolae (LtPGPA) showed to be involved in causing loss
of sensitivity towards this class of drugs (Haimeur et al. 2000; Legare et al. 2001a). LtPGPA
was first cloned from methotrexate-resistant L. tarentolae where it was found to be amplified
extrachromosomally on H-circles (Ouellette et al. 1990). This leishmanial ABC transporter is
not, as the name could suggest, belonging to the P-gps class of transporters, but is a member
of the MRP family, which operationally is dependent on a continuous supply of thiols.
Functional studies indicated that LtPGPA transports conjugates of trypanothione (a
glutathione-spermidine conjugate; the main reduced thiol in Leishmania spp.) with antimonials
from the cytosol into intracellular vesicles. These are subsequently exocytosed trough the
flagellar pocket (Haimeur et al. 2000; Legare et al. 2001a). Further Haimeur et. al. showed
that resistance to antimonials through LtPGPA is associated, not only by amplification of the
gene itself, but also by an increased level of trypanothione. In resistant cells, the increase in
trypanothione is mediated by an amplification of the gene coding for gamma-glutamylcysteine
synthetase (Haimeur et al. 2000). Taken together these results suggest that antimonial
resistance in Leishmania spp. requires: a) elevated levels of thiols (trypanothione); b)
increased transport activity (amplification of LtPGPA) and presumably others; c) a
conjugase/tranferase for facilitated conjugation of antimonials to trypanothione (Haimeur et al.
2000).
In the light of these interesting results, it will be of imminent clinical relevance to establish
whether clinical antimonial drug resistance correlates with one or more of the mechanisms
outlined above.
2.3.5. Alternative Drugs?
In addition to the first-line chemotherapeuticals Pentostam™ and Glucantime there are
some alternatives, used mainly as second-line drugs in areas with antimonial resistance.
19
Pentamidine
Pentamidine (Pentacarinate®; Aventis) belongs to the diamidine class of drugs and due to its
age it can be described as a classical antileishmanial agent. It has been used successfully
since 1937 for the treatment of the early stages of Human African Trypanosomiasis, and
since 1952 for the treatment of leishmanial infections (Croft et al. 2003a). Unfortunately its
primary mode of action has not precisely been established yet. In leishmaniasis treatment,
pentamidine is used as back-up chemotherapy, mainly due to its severe toxicity (Croft et al.
2003a). Hallucinations, cardiac dysrhythmias, nephrotoxicity, headaches and many more are
among the common side effects. The compound also induces excessive insulin release and
may lead to diabetes (Pepin et al. 1994). In addition, its curative efficacy has declined
consistently over the years, curing nowadays only about 70% of antimonial refractory patients
(Jha et al. 1991; Sundar 2001a).
Amphotericin B
The polyene antifungal agent amphotericin B (Fungizone®, Bristol-Myers-Squibb) is well
known as an active antileishmanial compound (Guerin et al. 2002; Rosenthal et al. 2003). Its
activity against fungi but also against Leishmania spp. is due to the higher affinity for the
prevailing microbial sterol (ergosterol) than for the host cell cholesterol. Binding of
amphotericin B to ergosterol results in disrupting the integrity of the biomembranes of the
parasite (Croft 2001). Its clinical use is limited due to the fact that infusions last several hours,
and due to severe toxic side effects such as thrombophlebitis, hypokalaemia,
thrombocytopenia, myocarditis and death (Sundar 2001a). However, Thakur et. al. reported
cure rates of more than 95% for L. donovani infected patients (Thakur et al. 1993).
Efforts in improving galenical formulation of amphotericin B resulted in creating lipidassociated formulations. AmBisome® (collaboration product of NeXstar Inc., and TDR;
http://www.who.int/tdr/about/products/registration.htm), a formulation using spherical,
unilamellar liposomes, has proved to be effective against leishmaniases and is now the best
tested lipid-associated form of amphotericin B (Berman et al. 1998). In comparison to the
parental drug, AmBisome® has a longer plasma half-life and negligible adverse reactions
(Berman et al. 1998; Croft et al. 2003a). Depending on treatment regimes, its efficacy is often
20
up to 100% (Berman et al. 1998). Treatment studies in India, with new single doses or five
daily infusions of liposomal amphotericin B resulted in cure rates of up to 92% (Sundar et al.
2001). Though there is a massive problem, treatment cost. A successful AmBisome®
treatment costs 1613 US$, which makes the compound inaccessible for most patients in
leishmaniasis endemic countries (Desjeux 2004a).
Miltefosine
The newest drug registered for leishmaniasis treatment is miltefosine (Impavido®; Aeterna
Zentaris Inc.). Miltefosine is an alkylphosphocholine, a phospholipid analog. The compound
was initially developed as anticancer drug and also approved for the topical treatment of skin
metastases in 1992. While in development phase (1980s), antiprotozoal activity was
discovered. Convincing results in experimental Leishmania spp. models and the availability of
pharmacological and toxicological data from anti-cancer clinical trials, led in the 90s to clinical
leishmaniasis treatment trials (Croft et al. 2003). This development was strongly supported by
a partnership between WHO/TDR and Aeterna Zentaris Inc., leading 2002 to the registration
of miltefosine for VL treatment in India (http://www.who.int/tdr/about/products/registration.htm;
(Davies et al. 2003; Croft et al. 2003a; Desjeux 2004). It is the first oral drug for treatment of
leishmaniases. Actually it is the first new antileishmanial compound introduced since 50
years. Its primary action is still elusive. It was shown that miltefosine can perturb ether-lipid
remodeling, inhibit phosphatidylcholine biosynthesis and phospholipase C, thus interacting
with signal transduction (Croft et al. 2003). Even treatment cost is reasonable (about 175US$;
(Desjeux 2004a) and clinical trials to evaluate efficacy against VL in other endemic areas than
India and against CL are on their way (Croft et al. 2003a). Treatment efficacy is very high,
depending on dosage cure rates up to 98% (Jha et al. 1999). The only severe downside of
the compound is its teratogenicity (Croft et al. 2003a). In other words, if a woman takes
miltefosine during pregnancy, there is a high risk of interference with embryo and fetus
development leading to congenital malformations at birth. Oral miltefosine is expected to be
available for the treatment of all clinical manifestations of leishmaniasis and it should then be
used as first-line chemotherapy.
21
2.3.6. New ways to go?
The positive development for new antileishmanial drugs does not seem to take an end.
Beside the abundance of experimental molecules against Leishmania, which are not listed
here because they would go beyond the scope of this introduction, there are at least five new
drugs undergoing clinical trials.
Paromomycin, an aminoglycoside antibiotic, is undergoing phase 3 clinical thanks to
collaborations of WHO/TDR and institute of OneWorld Health (http://www.oneworldhealth.org/
diseases/leishmaniasis_program.php).
Further, the azole class of compounds, developed as antifungal drugs, offer
chemotherapeutical potentials. The azoles ketoconazole, itraconazole and fluconazole have
undergone phase 1 studies with ambivalent results (Croft 2001; Croft et al. 2003a).
Sitamaquine (WR6026; 8-aminoquinoline) is another orally administrable compound with
potential of Leishmaniasis treatment. Its clinical development has been very slow, and only
recently (March 2002) phase 3 clinical studies have been started thanks to collaboration of
the institute which originally developed the compound (Walter Reed Army Institute) and the
pharmaceutical company GlaxoSmithKline (Yeates 2002).
2.3.7. Are we In View of an Immunotherapy?
At the vaccine front there are also some promising developments. Cure of CL usually
results in resistance to re-infections. The so-called “leishmanisation” (a voluntary infection to
produce natural resistance usually by an inoculation on the buttocks) was once widespread in
Middle East and Eastern Europe. However due to unacceptable lesions in some patients the
strategy was discontinued. Nowadays WHO/TDR are pushing for a resurrection of this
approach, and Iranian scientists have genetically engineered L. major stabilates which give
rise to reproducible and acceptable lesions (Coler et al. 2002; Davies et al. 2003).
Further, a recombinant polyprotein vaccine composed of three different T-cell antigens (thiolspecific antioxidant [TSA], L. major stress inducible protein 1 [LmSTI1] and Leishmania
elongation initiation factor [LeIF]) administered with an adjuvant suited for human use (the
naturally occurring disaccharide adjuvant of Salmonella minnesota monophosphoryl lipid A
with squalene [MPL-SE]) elicited a robust and long-term protection against leishmaniasis in
22
an animal model of the disease. Experiments with a nonhuman primate model are ongoing,
and phase 1 human safety and immunogenic trials should be initiated (Coler et al. 2002).
Also, vaccination strategies with crude autoclaved L. major are being continued. Coadministration of immunostimulatory CpG oligodeoxynucleotides resulted in CD4/CD8 T-cell
stimulation and long term immunity (Rhee et al. 2002).
While these promising results in vaccine developments were achieved for CL, the situation for
VL remains vague. It is unclear whether the same vaccine will work for all leishmaniases.
Certainly, if CL vaccines prove to be successful, human trials for VL will quickly follow (Davies
et al. 2003).
2.3.8. Upshot!
The developments briefly outlined above show the large effort that has been invested in
understanding changes associated with drug resistance, development of new
chemotherapeutical approaches, and in the development of possible immunotherapeutic
applications. More work is needed in all fields, and the spread of drug resistance, particularly
against the newer compounds, should be monitored carefully. Treatment regimes of drug
combinations should be evaluated and considered. Thanks to miltefosine (oral drug) there is
the possibility of ambulant and quick treatment of large populations, which could mean the
end of VL in regions where the disease is anthroponotic.
23
2.4. Trypanosoma brucei spp., the Causative Agents of Sleeping Sickness
2.4.1. Parasite’s ID
The protozoan parasites T. brucei spp. comprise the causative agents of sleeping sickness in
humans (also called Human African Trypanosomiasis; HAT; Figure 6). The parasites belong
to the salivarian type trypanosomes, being transmitted trough the saliva of the blood sucking
tsetse fly vector to the mammalian hosts (game-, domestic animals and humans). There are
over 20 species of tsetse flies (Glossina spp.; Figure 6) known, however not all are equally
important for transmission of the zoonosis (Molyneux et al. 1996; Smith et al. 1998).
Fig. 6: On the left: T. brucei the causative agent of Sleeping sickness in the blood. An electron
microscopic picture showing the kinetoplastid parasite together with an erythrocyte
(http://www.ulb.ac.be/sciences/biodic/ImProto0003.html). On the right: The tsetse fly vector of the
disease; Glossina spp. (http://www.who.int/tdr/media/image.html).
The human infection begins with a local inflammatory reaction, the chancre, at the fly’s biting
site. During the early stages of the disease (haemolymphatic stage), the parasites enter the
lymph and blood. In this stage of the disease the patients suffers from general malaise,
headache and irregular fever (Molyneux et al. 2000). Since such symptoms that are broadly
seen in most infections or maladies, an early diagnosis of sleeping sickness is often difficult.
The disease proceeds then to a meningoencephalitic stage (late stage) where the parasites
cross the blood brain barrier and invade the central nervous system (Stich et al. 2002). The
late stage of the disease is characterized by the disruption of the diurnal rhythm with
nocturnal insomnia and diurnal sleepiness. Patients suffering from this chronic
encephalopathy further demonstrate psychotic behavior, reduced mental functions, motor
disorders and, increasing difficulties to cope with their surroundings. The disease eventually
progresses to permanent hypersomnia (hence the name sleeping sickness), coma and finally
24
death. The disease is invariably fatal if it is left untreated (Molyneux et al. 1996; Molyneux et
al. 2000; Stich et al. 2002).
The human disease exists in two different
geographical variants caused by different
T.
brucei s p p . (Figure 7). The two
sleeping
sickness
variants
differ
dramatically in their time course. The
infection caused by T. b. gambiense,
West African sleeping sickness, is chronic
with a slow course and a long nonspecific symptomatology. Several years
may pass before the parasites invade the
central
nervous
system
and
the
meningoencephalitic stage of the disease
begins. The East African version of the
Fig 7: Distribution of T.b. gambiense and T.b.
rhodesiense causing West African respectively
East African sleeping sickness in sub-Saharan
Africa, http://www.who.int/csr/resources/publications/
surveillance/CSR_ISR_2000_1web/en/
disease is caused by T. b. rhodesiense,
and its course is much more dramatic. Where the late stages in the West African sleeping
sickness occur only after several years of infection, T. b. rhodesiense infected patients are
heavily sick early on and death occurs normally in a few weeks (Molyneux et al. 1996; Smith
et al. 1998; Molyneux et al. 2000).
2.4.2. Current Status and Control
The importance of HAT for public health is often under-estimated. The disease is endemic
in 36 Sub-Saharan countries. Figures of the World Health Organization (WHO) show that
there are 60 million people exposed to the pathogen with ~40’000 new cases each year. The
real number may be ten times that since only around 4 million of the people at risk are under
medical surveillance (http://www.who.int/emc/diseases/tryp/). In some loci a high prevalence
of 20-50% has been shown and in these villages morbidity and mortality is even higher than
for HIV/AIDS patients (Kioy et al. 2004).
25
Control, respectively prevention can be done on several levels in endemic and epidemic
areas. However the prerequisite for success is a functional and efficient health system since
the approach relies mainly on systematic surveillance of population at risk linked with vector
control and immediate treatment of infected people (Molyneux et al. 2000). Vector control is a
very efficient and simple mean of controlling the disease burden. Applied research on tsetse
traps and flags, impregnated with chemoattractant substances and insecticides, has proven
to be very efficient. In field studies in Bouenza (Republic of Congo), using traps resulted in a
considerable decrease in the tsetse population and a decrease in the prevalence rate after
the elimination of the flies (Gouteux et al. 1990). Similarly positive results were seen in the
Busoga district of Uganda where trapping reduced fly populations by 95% and more (Lancien
1991). The cost of this prevention approach was estimated at 0.9 US$ per person per year.
These two examples clearly show the trend that involves local populations in the control of
tsetse flies giving them responsibilities in setup and maintenance of anti-vector traps and
flags.
There are some approaches that attempt to eradicate Glossina spp. using the sterile insect
technique (SIT) (Molyneux 2001). This goal is far from reality since several large-scale SIT
trials have failed in Nigeria, Burkina Faso, Tanzania and Ghana due to lack of sustainability
and through re-invasions of insect free regions. Success was only achieved in the eradication
of Glossina austeni on the island of Unguja, Zanzibar (Vreysen et al. 2000). The eradication
cost was of US$ 7 941 000! The idea that SIT could lead to the eradication of Glossina spp. is
unrealistic in regions where the public sector commitment to health is often less than US$ 10
per capita per year (Molyneux 2001), and where HAT is only one disease among others such
as HIV, TB, malaria and pneumonia. Thus SIT seems to be an inappropriate, irrelevant and
above all an unaffordable way of HAT control in Africa (Vreysen et al. 2000; Molyneux 2001).
Human prevention approaches have included prophylactic chemotherapeutical treatments of
populations at risk (Molyneux et al. 1996). Due to induction of drug resistances, mostly due to
sub-curative drug treatment regimes, these approaches have largely been abandoned (Pepin
et al. 1994). Further control strategies abandoned for various reasons are the large-scale
elimination of game animal reservoirs, bush clearing, massive insecticide application by large
26
scale aerial spraying of tsetse flies habitats, and moving communities away from high-risk
areas (Molyneux et al. 2000); personal communication E. Matovu).
Regrettably, even if there was an ultimate technology for vector control and the most
efficient chemotherapeutic agent for treatment, it would still be difficult to implement it in the
field in many HAT endemic areas. Political unrest, neglected health care institutions and
economic constraints hinder control teams to enter these regions as well as the fact that longterm commitments to control programs cannot be assured. HAT control will not ameliorate
until these socio-economical difficulties are overcome.
2.4.3. The Drugs!
Since there is no perspective for a vaccine, treatment of HAT relies completely on
chemotherapy with very old drugs. As we have already seen in a previous section, some of
the drugs date back to Paul Ehrlich’s (1854-1915) time, and because of their toxicity none of
them would be admitted as human therapeutic compound today. The present drug treatment
situation can simply be described as terrible. Table 1 gives an overview over all commonly
used drugs for HAT treatment.
27
Drug and
Manufacturer
Suramin
(Germanin®)
Bayer
Pentamidine
(Penta®
carinate )
Aventis
Melarsoprol
(Arsobal®)
Aventis
Eflornithine
(Ornidyl®)
Aventis
BBB
crossing
No
No
Yes
Yes
In use
since
1922
1937
1949
Mode of action
Not yet established.
Toxic effect is
presumably due to
many subcellular
interactions. e.g.
binding to and
inhibition of
dehydrofolate
reductase, thymidin
kinase, glycolytic
enzymes.
Not yet established.
Interacts with kDNA
causing
diskinetoplastidy
(may not be relevant
for trypanocidal
action). Selective
inhibition of T. b.
brucei Ca2+-ATPase.
Action not
completely
understood. May be
a nonspecific
inhibitor of various
enzymes. Forms
adducts with
trypanothione.
1980
Suicide inhibitor of
ornithine
decarboxylase
(ODC).
Active
against
Resistance/Refractory
and Use
T. b.
gambiense
Naturally less sensitive.
Suramin is not used
against T. b. gambiense
infections because of its
use in river-blindness
treatment in W.-Africa.
T. b.
rhodesiense
Does not cause
resistance in the field.
Drug of choice for T. b.
rhodesiense infections.
T. b.
gambiense
Drug of choice for T. b.
gambiense infections.
Drug resistance in the
field has (up to now)
never been a problem.
T. b.
rhodesiense
Due to a natural lower
susceptibility it is not
used to treat T. b.
rhodesiense infections.
T. b.
gambiense
T. b.
rhodesiense
Drug of choice to treat
late stage infections of
both geographical
variants of HAT.
Increasing drug
resistance problems with
treatment failure rates of
30% in some regions.
T. b.
gambiense
Due to its high cost the
drug is mainly used as
back-up treatment in
case of melarsoprol
relapse.
T. b.
rhodesiense
Refractory, due to a
higher turn-over rate of
ODC.
Side effects
Severe
proteinuria;
anaphylactic
shock after first
injection; stomal
ulcerations;
dermatitis; heavy
diarrhoea, etc.
Abortions;
excessive insulin
release which
leads to diabetes;
hallucinations;
cardiac
dysrhythmias;
nephrotoxicity, etc.
Acute reactive
encephalopathy;
myocardial
damage;
renal/hepatic
dysfunctions;
convulsions and
coma; dermatitis,
etc.
Thrombocytopenia; diarrhoea;
anemia;
gastrointestinal
effects; abdominal
pains; vomiting;
dizziness, etc.
Table 1: Summary of the commonly used drugs for the treatment of sleeping sickness. BBB: blood brain
barrier. Ref.: (Pepin et al. 1994; Molyneux et al. 1996; Molyneux et al. 2000; Legros et al. 2002;
Docampo et al. 2003; Maser et al. 2003; Nok 2003; Kennedy 2004).
28
When HAT is diagnosed in the haemolymphatic stage, the chances of cure are not bad. In
this stage, where the parasites did not yet penetrate into the central nervous system, two
compounds are commonly used. Both date back to the beginning of the last century when the
notion of chemotherapy was introduced.
Suramin
®
The treatment of early stage East African sleeping sickness relies on suramin (Germanin ,
BAYER 205; Figure 8; Table 1), a drug in use since 1922 (Molyneux et al. 1996). For a
number of reasons (e.g. treatment duration, cost and relapses) the drug is only used to treat
T. b. rhodesiense infections in East Africa (Pepin et al. 1994). Most importantly, in West
Africa, suramin is also used against river blindness (Abiose 1998). In order to prevent the
development of suramin resistances in both pathogens, suramin is not used against the West
African geographical variant of sleeping sickness.
NaO3S
O
H
C
N
NH
O
C
C
N
O
H
®
CH3
NaO3S
SO3 Na
2
Fig. 8: Suramin (Germanin ,
BAYER 205). A derivative of
TrypanRed, the first in 1904
developed “magic bullet” by
P. Ehrlich. Suramin was
developed in 1916 and in use
against T. b. rhodesiense
infections since 1922.
Pentamidine
The treatment of early stage West African sleeping sickness is based on pentamidine
(Pentacarinate®; Figure 9; Table 1). Like suramin, this drug cannot be called a modern
chemotherapeutical compound since it has been used continuously since 1937 (Molyneux et
al. 1996). The compound is not used to treat early stages of East African sleeping sickness
since T. b. rhodesiense is characteristically less sensitive to the drug (Damper et al. 1976).
29
Due to their toxicity and numerous side effects, neither suramin nor pentamidine would be
admitted today as therapeutic compounds (Pepin et al. 1994).
O
O
H 2N
NH2
NH
NH
Fig.
9:
Pentamidine
(Pentacarinate®). Due to the
slow trypanocidal action of this
aromatic diamidine it is used
against first stage T. b.
gambiense infections. T. b.
rhodesiense invades the CNS
much quicker and is thus less
affected by the drug.
Despite their side effects, and despite the fact that these two drugs cannot be used for
treatment of late stage of the disease, both are quite effective in the treatment of the early
stage sleeping sickness (Pepin et al. 1994).
Melarsoprol
For the meningoencephalitic stages of T. b. gambiense and T. b. rhodesiense infections there
is only one drug commonly used for treatment, melarsoprol (Arsobal®; Mel B; Figure 10;
Table 1).
OH
NH2
S
As
N
H 2N
N
N
S
Fig. 10: Melarsoprol (Arsobal®;
Mel B) is hampered by a number
of problems not only due to its
toxicity but also to by the solvent in
which it is administered.
N
H
Professor Friedheim developed the toxic trivalent arsenic compound and it is in use since
1949 for trypanosomiasis treatment (Molyneux et al. 1996). Albeit trypanothione metabolism
looks to be the main target for arsenical drugs, they may be nonspecific inhibitors of different
enzymes (Fairlamb et al. 1989; Pepin et al. 1994; Maser et al. 2003). The precise mode of
30
action is still under investigation. Due to its poor solubility in water, Mel B is dissolved in
propylene glycol. The solvent is the reason why melarsoprol injections are very painful with
acute skin reactions after administration. And worse, Mel B is so toxic that side effects are
often fatal. The most common one is an acute reactive encephalopathy occurring in 2-20% of
the treated patients (Pepin et al. 1994). More than 50% of patients with severe side effects
die due to the drug treatment. Despite these facts melarsoprol is still the only available drug
that is able to cross the blood brain barrier and act during the late stages of both, the East
and the West African form of the disease, when the CNS is invaded by the parasites (Pepin et
al. 1994).
Eflornithine
Difluoromethylornithine (DFMO, Eflornithine, Ornidyl®; Figure 11; Table 1) is up to now the
only available alternative to treat late stage infections of T. b. gambiense. Unfortunately T. b.
rhodesiense is naturally refractory to this compound (Pepin et al. 1994).
CHF 2
H 2N
CH2
CH2
CH2
C
NH2
COOH
Fig. 11: Difluoromethylornithine
(DFMO, Eflornithine, Ornidyl®).
The molecule synthesized
originally as anti-cancer drug is up
to now the only valid alternative to
melarsoprol in late stage HAT
treatment.
The treatment with this drug is expensive (costs with hospitalization around 540 US$), and is
extremely impractical. A course of treatment consists of four daily infusions over a period of
two weeks, requiring a total of 300gramms (!) of compound, and two liters of sterile infusion
solution per day (personal communication E. Matovu; (Molyneux et al. 1996). Eflornithine is
mainly used to treat patients who relapse after melarsoprol treatment (costs with
hospitalization around 200 US$). The treatment costs represent a financial nightmare in
developing countries with total public health budgets of around 10 US$ per capita. Treatment
cost problems were temporarily resolved in May 2001 by Aventis, which decided to donate
DFMO, melarsoprol and pentamidine for the treatment of sleeping sickness for five years
(http://www.who.int/inf-pr-2001/en/pr2001-23.html). Difluoromethylornithine was first
synthesized as an anti-cancer drug, though it was never registered for that use (Docampo et
31
al. 2003). DFMO is a suicide inhibitor of ornithine decarboxylase (ODC). ODC is a key
enzyme in the biosynthesis of polyamines and nucleotides, and it catalyzes the
decarboxylation of ornithine to putrescine (Fairlamb 2003). Even as the ODCs of T. brucei
and of mammals share over 60% identity, specificity for the parasite’s enzyme is probably
given by two facts: the much higher enzyme activity and the much faster turnover of the
enzyme in mammalian cells (Phillips et al. 1987; Seebeck et al. 1999). This was also
experimentally shown to be the reason for the innate drug tolerance of T. b. rhodesiense (Iten
et al. 1997). DFMO has been used to treat late stage West African trypanosomiasis since
1980 (Pepin et al. 1994). This compound is the first new trypanocidal drug since the
introduction of melarsoprol more than 30 years earlier!
2.4.4. Fears and Threats of Drug Resistance in the Field
Because of the above-mentioned negligence of sleeping sickness control programs, the
disease is re-emerging in Sub-Saharan Africa (Kioy et al. 2004) and due to the constant and
sometimes inappropriate use of these old drugs resistance problems are raising. Especially
dangerous is an alarming increase in melarsoprol-refractory sleeping sickness cases,
probably due to melarsoprol resistant trypanosomes (Matovu et al. 2001a). Alarmingly high
treatment failure rates of melarsoprol were reported from Uganda (30%) (Legros et al. 1999),
Northern Angola (25%) (Stanghellini et al. 2001) and the Southern Sudan (MSF/DND
Working Group, Treatment of Human African Trypanosomiasis: Current Situation and R&D
Needs; Dominique Legros, Gaelle Olivier). The problem is particularly pressing since
melarsoprol is the only generally applicable drug for late stage sleeping sickness. Due to
cultivation, logistic and experimental problems (Burri et al. 2001), the ultimate prove that drug
failure is due to resistant trypanosomes in the patients, remains uncertain. Work in progress
by Naomi Maina and Reto Brun (Swiss Tropical Institute) is focusing on cultivation of
trypanosomal field isolates (personal communication). The molecular mechanisms of
trypanosomal drug resistance have mainly been studied in laboratory strains selected at
suboptimal drug concentrations. The next chapter will give a brief overview of resistance
mechanisms.
32
2.4.5. Molecular Mechanisms of Melarsoprol Drug Resistance in T. brucei
Many trypanocides rely on the parasite’s transporter proteins to cross the phospholipid
bilayer. This is due to the mostly hydrophilic nature of the drugs. Thus reduction of net drug
absorption emerged as one common characteristic of drug resistant trypanosomes. This can
be caused by either reduced drug import or by increased drug export. These two possible
resistance mechanisms will be discussed in the next two paragraphs with attention on
melarsoprol drug resistance.
Initial studies correlated the import of diamidines and arsenicals with a specific
adenine/adenosine transport activity named P2 (Carter et al. 1993; Carter et al. 1995).
Simultaneously a second trypanosomal adenosine transport activity (P1) was discovered
(Table 2).
P1
Encoding genes
P2
TbNT2 to TbNT7,
TbNT10
TbAT1
(Sanchez et al. 1999)
(Sanchez et al. 2002) (Mäser
et al. 1999) (Sanchez et al.
2004)
adenosine, inosine,
guanosine, 2’dexyadenosine, 2’
deoxyinosine
adenine, adenosine,
2’-dexyadenosine
(Carter et al. 1993) (de Koning
et al. 1999)
melarsoprol,
pentamidine,
diminazene
(Carter et al. 1993) (Carter et
al. 1995) (de Koning et al.
2004)
tubercidin,
cordycepin
(de Koning et al. 1999) (Mäser
et al. 2001) (Geiser et al. 2004
submitted)
Substrates
a) physiological
b) drugs
c) purine analogs
formycin A/B, 8azidoadenosine,
Table 2. An overview of the trypanosomal purine transport systems P1 and P2 in bloodstream form
trypanosomes. Adapted from (Geiser et al. 2004 submitted)
The P1 activity was not responsible for any import of antitrypanosomal drugs, though it
displayed a broader specificity with regard of physiological substrates (Carter et al. 1993; de
Koning et al. 1999). Sanchez et al. discovered that P1 transport activity was conferred by an
entire gene family (TbNT2 to 7; (Sanchez et al. 2002), which is constantly growing in family
members (TbNT10; (Sanchez et al. 2004). The multiplicity of adenosine transporters may be
related to the fact that trypanosomes, like all other protozoan parasite analyzed to date, are
33
not able to synthesize purines de novo and rely completely on uptake from their hosts (Carter
et al. 2001).
P2 transport was shown to be encoded by a single gene (Trypanosoma brucei Adenosine
Transporter1; TbAT1; (Maser et al. 1999). Further evidence of P2 involvement in
melaminophenyl arsenicals uptake came from the expression of a TbAT1 from a laboratory
induced arsenical resistant T. brucei clone (Pospichal et al. 1994; Maser et al. 1999). The
transporter was not able anymore to generate Mel B sensitivity in a yeast expression system.
Sequence analysis of this TbAT1 showed ten point mutations, six of them resulting in amino
acid changes.
The connection between mutated TbAT1 and drug resistant trypanosomes was consolidated
by genetic studies. T. b. gambiense field isolates showed to have an identical set of point
mutations and melarsoprol-relapse correlated to some degree with the occurrence of these
mutations (Matovu et al. 2001; Matovu et al. 2001a). Sequence analysis (Geiser and
Seebeck, unpublished) of the transporters derived from the lab-induced arsenical resistant T.
brucei strain (Pospichal et al. 1994) had a similar, unsuspected outcome. Shortly, arsenical
resistance was induced by passaging a T. b. brucei strain in mice after sub curative drug
treatment (Pospichal et al. 1994). We sequenced trypanosomes from six different mouse
passages and we were not able to see a sequential accumulation of mutations in the TbAT1
open reading frame. Surprising was that the weakly arsenical resistant trypanosomes, 17
days after first mouse inoculation (see Figure 12; MCR11; estimated 51 trypanosomal
generations), already harbored the whole mutational load found in the final-passage (see
Figure 12; MCR41; day 131), which exhibited 15 fold increase in resistance over the parental
strain. The mutations showed to be nearly identical to the mutations found in T. b. gambiense
field isolates relapsing melarsoprol treatment.
For these findings two hypotheses can be postulated, excluding the possibility that during
Pospichal’s arsenic resistance induction experiments a T. brucei strain mix-up occurred. First,
mutations could occur under drug pressure sequentially and rapidly in defined hot spots
positions, functionally inactivating the transporter. However, the improbability of an
independent origin of the same set of mutations in independent strains and the fact that there
are a couple of silent point mutations severely challenges this hypothesis. The findings much
34
more indicate that either the wild type transporter is present at a certain moment or its
mutated form. This observation leads to the second hypothesis.
In the trypanosomal genome a “resistant template” of TbAT1 could be present, already
harboring the complete set of mutations. The “resistant template” of the gene could be
expressed, after one or more recombination events, when resistance against a toxic
compound is required. Such recombination events could easily explain the observation that
either the TbAT1 with the complete set of mutation is present or absent at a certain moment
in independent strains. The T. b. brucei genome project was headlined as finished. Unluckily
the complete sequence is still not fully accessible yet, and a search for possible mutated
templates was negative. However, since a search for the original TbAT1 nucleotide sequence
was similarly negative, questions about the completeness of this database remain. Once the
complete sequence will finally be publicly available, one of these two hypotheses can be
discarded, helping to solve this intriguing question.
Fig. 12: The position and sequence of mutations in the open reading frame of TbAT1 is highly conserved
in all trypanosomes from induced arsenical resistant mouse passages. MCRS is the sensitive parental T.
b. brucei strain. MCR11 is the already slightly arsenical resistant mouse passage, 17 days after first
inoculation. MCR18-38 are subsequent passages ending with the 15-times more resistant final passage
MCR41 (day 131 after first inoculation). In blue: silent point mutations; position of the changed base
depicted on the bottom of the TbAT1 ORF scheme. In red: amino acid (aa) changes; position of the
changed base depicted on the bottom and position of the changed aa on the top of the TbAT1 ORF
scheme. The two silent point mutations in MCRS vanish while the trypanosomes get resistant to the
arsenical compounds and the complete mutational load appears in the ORF.
35
What these sequence analyses additionally pointed out is that a mutated TbAT1 is not the
only reason for high-level arsenical resistance, but it probably plays an important role on the
way to it.
Lately, null mutants of the tbat1 gene were generated in a T. b. brucei strain (Matovu et al.
2003). The study ultimately elucidated the involvement of the transporter in uptake and
resistance to diamidine and melaminophenyl arsenical classes of drugs. As expected, the
tbat1
-/-
trypanosomes showed a reduced sensitivity to these compounds although the
resistance factors were only around 2.5 for melarsoprol and pentamidine. Surprisingly the
-/-
strongest tbat1 resistance phenotype was described towards the veterinary drug diminazene
aceturate (Berenil), with a 15-fold loss in sensitivity (Matovu et al. 2003). Pentamidine and
melarsoprol uptake in the tbat1 null mutant was not inhibited by adenosine. This shows the
existence of alternate, adenosine insensitive uptake mechanisms for these two drugs. A
second common transporter besides TbAT1 is supposed to exist since pentamidine inhibited
-/-
melarsen induced lysis of the tbat1 clone. Even though the tbat1 knockout strain showed a
weak resistance phenotype, it further permitted to identify additional possible drug transport
activities and to strengthen the hypothesis that loss of TbAT1 function is an obligatory way to
high-level arsenicals and diamidines resistance (Matovu et al. 2003).
The absence of high-level melarsoprol resistance in these in vitro studies, focused on the role
of TBAT1 in resistance induction, does not exclude an in vivo significance of the transporter.
There are several reports analyzing melarsoprol relapsing field isolates, from different
geographical regions, showing that high-level resistance, as it can be found in animal
pathogenic trypanosomes (e.g. up to a factor 1000 for isometamidium), is absent in human
trypanosomes (Brun et al. 2001). The highest resistant factor against melarsoprol for a T. b.
rhodesiense isolate was 10-fold. Reduced susceptibility to melarsoprol is probably enough to
cause treatment failure due to the fact that peak melarsoprol plasma levels of around 0.05
µg/ml will not be maintained for a long time in body fluids (Burri et al. 1993). Therefore, in the
absence of constant drug pressure, especially in the CSF, parasites with already a slightly
increased resistance to the toxic compound will not be eliminated. This depicts the possible
biological importance of TbAT1 in inducing melarsoprol treatment relapses in the field.
36
As mentioned, drug resistance due to reduced net drug uptake could also be associated
with an increased cellular drug export, and this will be the argument of the next paragraph.
The main candidates for drug export in trypanosomes are members of the ATP-binding
cassette (ABC) transporter superfamily. The protein family is particularly well conserved and
widespread, found ubiquitously in eukaryotes and prokaryotes. These large membrane
proteins, characteristically with two ATP-binding cassettes per transporter, fulfill a multitude of
different cellular functions. Thanks to their ATPase activity they are able to actively transport
substrates ranging from ions to proteins against concentration gradients (Jones et al. 2004).
Unfortunately for chemotherapy, they are also responsible for multiple drug resistance as
several ABC transporters function as detoxification pumps. P-glycoproteins (P-gps) and some
members of the subgroup of multidrug resistance associated proteins (MRP) are among the
best known ABC transporters, associated with clinical drug resistance in humans (Maser et
al. 1998; Borst et al. 2002; Klokouzas et al. 2003). Homologues were identified in a multitude
of pathogenic protozoa. P-gps were shown to mediate resistance to various antiprotozoal
drugs in Plasmodium falciparum, Leishmania spp and in Entamoeba histolytica (Klokouzas et
al. 2003).
The first MRP type transporter described in protozoa was LtPGPA cloned from a
methotrexate-resistant L. tarentolae (Ouellette et al. 1990). It was found that the gene was
also amplified in cells resistant to terbinafine, primaquine and arsenite (Klokouzas et al.
2003). The function of MRP-type ABC transporters depends on continuous supply of thiols,
since thiol conjugates are the substrates of these transporters. In Leishmania spp.
trypanothione, a glutathione-spermidine conjugate, is the main thiol (Legare et al. 2001a). In
experiments exploring arsenite resistance in L. tarentolae, the affiliation of LtPGPA to the
MRP type transporters was demonstrated. Legare et. al. observed that the parasites
overexpressing LtPGPA became resistant to the toxic compound only when simultaneously
overexpressing gamma-glutamylcysteine synthetase (the key enzyme involved in
trypanothione metabolism; (Legare et al. 2001).
In T. brucei, three ABC transporters were identified based on strong homologies to LtPGPA:
TbABC1, TbABC2 and TbABC3. (Maser et al. 1998) These transporters also belong to the
37
MRP group of ABC transporters. TbABC1 (subsequently renamed TbMRPA) showed to be
involved, at least in vitro, in reducing the parasite’s melarsoprol sensitivity. Overexpression of
the ABC transporter in bloodstream T. brucei caused 10-fold resistance to the arsenical
trypanocide melarsoprol (Shahi et al. 2002). However, in Shahi’s experiments, trypanothione
production in T. brucei did not seem to be a bottleneck in TbMRPA mediated melarsoprol
resistance. Simultaneous overexpression of T b M R P A with gamma-glutamylcysteine
synthetase and ornithine decarboxylase (both involved in trypanothione metabolism) did not
significantly increase resistance to melarsoprol (Shahi et al. 2002).
The fact that T. brucei does not seem to respond to higher trypanothione levels with higher
drug resistance is probably due to an intrinsic difference in concentrations of reduced thiols
between Leishmania spp. and Trypanosoma spp. T. brucei exhibits 10-fold higher cytosolic
trypanothione levels compared to the levels in Leishmania. Trypanothione levels may not be
limiting drug export in T. brucei, so that MRP-overproduction may be sufficient to cause drug
resistance (Shahi et al. 2002).
The most challenging question is now to test whether TbMRPA overexpression correlates
with sleeping sickness patients relapsing from melarsoprol treatment. These studies are
difficult to do since in the field sample isolation, transfer to laboratory and subsequent
cultivation are a logistical challenge and are also hampered by great difficulties to cultivate
trypanosomes from patient isolates in vitro (Burri et al. 2001).
Concluding the discussion of drug resistance in trypanosomes, it should also be
mentioned that alternative mechanisms have been reported. Although they appear of minor
importance for in vivo resistance than the above-described mechanisms, it cannot be
excluded that they contribute to multifactor drug resistance phenotypes. Two alternative
mechanisms shall be shortly presented here to demonstrate the diverse molecular spectrum,
where resistance could occur.
Fairlamb et. al. showed in an arsenical resistant T. b. brucei strain a decrease of lipoic acid
content (Fairlamb et al. 1992a). It is a well-known fact that trivalent arsenicals (e.g.
38
melarsoprol) form stable adducts with sulfhydryl groups in trypanosomes (Fairlamb et al.
1989). One stable adduct in trypanosomes is called MelT, a complex between the intracellular
dithiol trypanothione and melarsoprol. Another dithiol found in most organisms is
dihydrolipoamide. Fairlamb and co-workers showed that dihydrolipoamide is present in
trypanosomes in an unusual plasma membrane localization, and that it represents only a
minor fraction of the low molecular weight thiols in T. brucei (Fairlamb et al. 1992a). In the
presence of melarsoprol, dihydrolipoamide rapidly forms very stable lipoamide::arsenical
adducts. Fairlamb et. al. further demonstrated that an arsenical resistant T. brucei clone
(Fairlamb et al. 1992) had a 50% reduced content in lipoic acids (Fairlamb et al. 1992a).
Knowing that immediately prior to arsenical induced lysis, 98% of the lipoic acid could be
complexed with the toxic molecule shows a possible involvement of dihydrolipoamide in either
uptake or being the final target of arsenical drugs (Fairlamb et al. 1992a).
In chapter 2.3, discussing Leishmania spp., we have seen that episomal gene amplification
(LtPGPA on H-circles) can be a plausible cause of drug resistance in kinetoplastida. Gene
amplification has also been observed in Trypanosoma spp. although only once, and after
selection for resistance against a molecule, mycophenolic acid (MPA) that is irrelevant for
chemotherapeutical purposes (Wilson et al. 1994). The main cellular target for MPA is inosine
monophosphate dehydrogenase (IMPDH). Due to the fact that MPA sensitivity was equal for
wild type IMPDH and for the IMPDH from the laboratory selected MPA resistant T. b.
gambiense clone, the factors causing resistance had to be found elsewhere. Wilson et. al.
observed a 6-fold increase in IMPDH activity in the resistant strain. Indeed they discovered
that expression of IMPDH was 10 times higher than in the wild type cells. They were further
able to demonstrate that this increase in expression was caused by 10-fold amplification in
copy number of the IMPDH gene. Wilson et. al. saw that the gene was not amplified
episomally, like in the case of Leishmania spp., but that the whole 6Mb chromosome carrying
the IMPDH locus was amplified (Wilson et al. 1994). The chromosomal amplification resulted
in an expansion of the nuclear genome by 70%! But even in this case it cannot be predicted
whether chromosomal amplification serves as a valid model for drug resistance among
trypanosomal field isolates, particularly as this observation has remained, to my knowledge,
the only one of this kind.
39
In summary, it is difficult to interpret whether all drug resistance mechanisms discovered in
laboratory strains are of importance in drug treatment relapses in the field. However a
combination of different mechanisms (e.g. decreased drug import combined with an
increment of target enzymes) could synergistically increase drug resistance, leading to highlevel drug resistance in trypanosomes.
2.4.6. Alternative Drugs?
The pipeline for trypanocidal drugs is empty due to obvious problems of financing the
huge development costs, which would make any new drug not profitable in poor markets as
the Third World Countries. Recently, several public-private partnerships have been set in
motion for financing drug developments, and fruitful outcomes will be a welcome gift (e.g.
Drugs for Neglected Disease initiative; http://www.dndi.org). Nevertheless, some compounds
currently not licensed for human therapeutic use have already been tried on compassionate
grounds in small clinical trials.
Nifurtimox
The 5-nitrofuran derivative Nifurtimox (Lampit™) has already been discussed in chapter 2.2.3
as it is one of the two main drugs used to treat T. cruzi infections. It causes oxidative stress
thought to damage cellular compartments such as DNA, membrane lipids, and proteins
(Urbina 2001; Rodriques Coura et al. 2002; Fairlamb 2003; Raether et al. 2003). In several
small-scale clinical trials the drug has been shown to be active against both stages of T. b.
gambiense infections, with cure rates between 72 and 87%. An optimal treatment schedule
has not been established. Unfortunately, its efficacy against T. b. rhodesiense infections is yet
not known (Bouteille et al. 2003).
®
Berenil
®
The diamidine compound Berenil (diminazene aceturate) is a drug widely used as veterinary
trypanocide. However, during drug shortage periods, patients with first stage infections of
both T. b. gambiense and T. b. rhodesiense sleeping sickness have been treated with this
compound. The side effects are similar to pentamidine, except that injections are less painful,
40
the treatment is shorter and it costs less (Pepin et al. 1994; Bouteille et al. 2003). But why is it
®
not used generally for HAT treatment? The answer lies in the fact that Berenil rapidly
induces cross resistance to melarsoprol in laboratory investigations, which would have a
fateful impact on melarsoprol chemotherapy (De Koning 2001). Nevertheless, recent efforts
®
have been made to improve the hydrophilic Berenil to cross the blood brain barrier and thus
to act also against the late stages of the disease. This was achieved by synthesizing lipid®
drug-conjugate nanoparticles loaded with Berenil (Olbrich et al. 2004).
Megazol
The nitroimidazole derivative megazol [2-amino-5-(1-methyl-5-nitro-2-imidazolyl)-1,3,4thiadiazole] has shown efficacy against T. b. brucei infections in mouse models (Bouteille et
al. 1995), in a sheep model for trypanosomiasis (Boda et al. 2004), and in a primate study
with T. b. gambiense infections (Enanga et al. 2000). Combination treatments with megazol
and suramin were able to treat late stage infections, when the central nervous system is
involved, in a HAT mouse model (Enanga et al. 1998) and in T. brucei infected rats (Darsaud
et al. 2004). Recent studies have revealed that megazol is genotoxic, thus probably
interrupting the pursuit of its development for human use (Poli et al. 2002).
DB289
As we have seen in section 2.4.3 the diamidine drug pentamidine has served as a first stage
trypanosome treatment since 1937. This class of drugs has been forcefully revived by the
synthesis of pentamidine congeners with more advantageous effects (Donkor et al. 2003).
Thanks to a program devoted to the systematic developments of better diamidines, largely
financed
by
the
Gates
Foundation
(http://www.gatesfoundation.org/
GlobalHealth/InfectiousDiseases/Announcements/Announce-336.htm), great progress has
been achieved. A first pentamidine substitute drug, DB289 [2,5-bis(4-amidinophenyl)furanbis-O-methylamidoxime], has passed phase IIA clinical trials (www.sti.ch/pdfs/rreport11.pdf;
http://www.forschungsdb.unibas.ch/ProjectDetailLong.cfm?project_id=2018) and is ready for
a large-scale phase IIB trial. DB289 is a prodrug of the active diamidine DB75 (an
amidinophenyl furan) that can be administered orally (Zhou et al. 2002). Once administered,
41
DB289 it is transported across the gut walls and is then enzymatically converted in the liver
by cytochrome P450 and cytochrome b5 to the trypanocidal DB75 (Sturk et al. 2004). Sturk
et. al. were also able to show that the active compound seemed to cross the blood brain
barrier. Beside this significant observation, DB289 has a considerable clinical advantage over
pentamidine in the treatment of the first stage of the disease because it can be administered
orally (Sturk et al. 2004).
Despite these few positive approaches for alternative drug treatments, no new drugs are
likely to appear within the next few years. The only new and orally administrable drug, DB289,
is ready for phase IIB trials (www.sti.ch/pdfs/rreport11.pdf; http://www.forschungsdb.unibas
.ch/ProjectDetailLong.cfm?project_id=2018). If normal drug development speeds are to be
maintained it will still last at least 5 more years to reach approval (Keiser et al. 2001) and
even that may be optimistic.
2.4.7. New Ways to Go with the Old Drugs!
At present there is no sign for development of a vaccine and in the foreseeable future it
will remain the same. Hence, chemotherapy will remain the only way to treat HAT. As we
have seen, chemotherapy will continue to rely on very old drugs, until the alternatives
described above will finally be registered for human treatment. Nevertheless, there are some
new treatment strategies using these old drugs.
This new treatment avenue makes use of combination therapy and of new treatment regimes
in order to increase efficacy, decrease toxicity and delay a possible onset of drug resistances.
Burri and co workers (Burri et al. 2000) developed a new 10-day treatment schedule for
melarsoprol, which exhibited a similar success rate as the standard 26-days regime. This new
schedule saves time and drug quantity, and represents a useful alternative especially in
epidemic situations and in locations with limited resources (Burri et al. 2000).
Other approaches tend to use combinations of known compounds. For late stage T. b.
gambiense infections, a combination of eflornithine and melarsoprol has been tried in
Equatorial Guinea in 1996 with uncertain outcomes (Simarro et al. 1996; Legros et al. 2002).
In the Democratic Republic of Congo a combination treatment using nifurtimox and
42
melarsoprol achieved positive treatment results, with 68 patients treated and in no case
failure in the 24 month follow-up period (Legros et al. 2002). Further, clinical trials for
combinatorial therapies were carried out in Omugo (Uganda) under the patronage of WHO
(WHO/CDS/CSR/EPH/2002.20; Human African Trypanosomiasis; Treatment and Drug
Resistance Network for Sleeping Sickness; Report of the Sixth Steering Committee Meeting;
28-29 May; 2002 Geneva, Switzerland). Primary results of the combination approaches
Nifurtimox/Melarsoprol, Nifurtimox/Eflornithine and Melarsoprol/Eflornithine were exposed.
The best treatment outcome seemed to be achieved by the combination
Nifurtimox/Eflornithine with 17 out of 17 patients treated, just one treatment interruption and
no relapses after a 6 moth follow up period. WHO emphasized that this successful
combination should further be investigated and that at the same time a simplification of
eflornithine application should become a goal (personal communication Enock Matovu).
2.4.8. Upshot!
This quick overview of trypanocidal drugs, their limits, resistance and the future
development of HAT treatment clearly depicts the disastrous situation this parasitic disease is
confronted with. HAT is devastating many Sub Saharan African countries more viciously than
ever, the only thing which remained unchanged is the lack of funding for control programs,
and the treatment with very toxic and old drugs. Discovery of novel drug targets should be
feasible in the long term since the sequencing of the T. brucei genome is completed, although
not completely accessible (http://www.tigr.org/tdb/mdb/tbdb/; http://www.sanger.ac.uk/
Projects/T_brucei/). Still, it will be an immense challenge to exploit this abundance of
information for the discovery of novel drug targets (Fairlamb 2003). One also should keep in
mind that a new drug for sleeping sickness treatment should not only have an increased
safety and efficacy over the current drugs, but it should also be stable under field conditions,
easily administrable, and above all cheap. No single drug can be expected to solve all the
problems posed even by a single parasite. And, even the most wonderful drug or vaccine
would probably remain in the researcher’s drawer if the future does not bring dramatic
improvements in funding of drug development and in the social and economical conditions of
the afflicted countries.
43
3. Concluding Remarks
In large parts of the world the threat of infectious diseases caused by microbes (bacteria,
th
fungi, protozoa or viruses) has been successfully combated since the beginnings of the 20
century thanks to the development of the new science of chemotherapy (Ehrlich 1909a).
Antimicrobial agents, such as antibiotics and related drugs, were praised as “wonder drugs”.
Combined with revolutions in the fields of improved housing, sanitation, nutrition and the
incidence of widespread immunization programs, they lead to an incredible decrease in
deaths from diseases that were formerly regarded as untreatable (Editorial Klugmann 2000;
Byarugaba 2004). However, already the father of chemotherapy, Paul Ehrlich, realized in
1907 that drug resistance might prove an obstacle to successful chemotherapy when he
observed a loss of drug sensitivity in trypanosomes that were treated at subcurative doses of
a trypanocidal drug (Ehrlich 1907a). He recommended combination chemotherapy to avoid of
resistance, stating that the pathogens should be hit with a high dose for the shortest time
possible and using two or more drugs with different mode of actions (Ehrlich 1907).
Antimicrobial resistance is an inevitable consequence of the infectious agents adapting to the
use of antibiotics and drugs (Byarugaba 2004). It is a natural selection process, and the
spontaneous occurrence of a drug resistant genotype is proportional to the total number of
infective agents in a given focus times their genetic plasticity. Indeed, resistance has been
reported not only in almost every microbe exposed to drugs, but also in human tumor cells.
Nonetheless, antimicrobial agents have contributed to major gains in human but also in
animal health and welfare. People started to believe that infectious diseases were a scourge
of the past (Editorial Klugmann 2000; Wise 2004). This believe was not only shortsighted (as
we now clearly see), it also only applied to the industrialized world at any time. In most
countries of the world, the situation always was, and remains today, as bad as it was in the
industrialized nations two hundred years ago (Shears 2000).
45% of deaths in Third World countries are caused by infectious diseases, and 90% of these
deaths are due to six diseases: pneumonia, diarrhoeal diseases, HIV/AIDS, tuberculosis (TB),
44
malaria and measles (Williams 2000). Antimicrobial resistance today challenges treatment of
most of these infections. The resistance against first line anti-malarial drugs is an example.
This protozoan parasitic infection is caused mainly by one species of plasmodium,
Plasmodium falciparum. It is the cause of death for an estimated 0.7-2.7 million people.
Resistance to chloroquine, once first line treatment, is as widespread as P. falciparum itself,
and the drug is no longer effective in 81 of the 92 endemic countries (Williams 2000;
Wongsrichanalai et al. 2002; White 2004; Yeung et al. 2004). But the concerns do not end
here P. falciparum strains have developed resistance to most commonly used antimalaria
drugs, including sulfadoxine-pyrimethamine (SP) and mefloquine (Wongsrichanalai et al.
2002; White 2004). Resistance against SP is of particular concern since it is the only
affordable, effective and well tolerated alternative to chloroquine. It is, however, interesting to
note that resistance against any antimalarial drug usually develops within 10-15 years of
introduction of the drug (Wongsrichanalai et al. 2002).
This example can be extended to the other infections mentioned before. In some
geographical regions, up to 40% of Streptococcus pneumoniae strains causing lung
inflammation are resistant to penicillin (Jacobs 2004). This is frightening since pneumonia
remains the number one killer worldwide with 3.5 million fatalities in 1998
(http://www.who.int/infectious-disease-report/2000/index.html, Chapter 4).
Tuberculosis accounted for an estimated death of 2 million people in 2002 (WHO, Fact Sheet
N° 104, March 2004), and until 50 years ago there were no medicines for treatment of this
deadly disease. The shocking fact is that today, only 50 years after introduction of medicines
against TB, in some Russian countries over 50% of new infections are resistant to at least
one anti-TB drug, and the prevalence of multidrug-resistant strains in up to 15%
(http://www.who.int/gtb/publications/drugresistance/2004/#download; http://www.who.int/gtb/
publications/dritw/index.htm).
To make matters worse, and to conclude this small series of examples, resistance is
emerging to anti-HIV drugs (Kieffer et al. 2004). Due to the immense genetic variability of the
virus, the probability for resistance towards any one drug is likely to be present already when
a hypothetical patient starts a monotherapy (Havlir et al. 1995; Kieffer et al. 2004). Indeed,
resistance towards all currently available drugs has been reported. Drug resistance is also a
45
major impediment to successful highly active antiretroviral therapy (HAART). HAART is a
combination therapy including usually two nucleoside-type reverse transcriptase inhibitors
(NRTI), one protease inhibitor (PI) and/or a non-nucleoside reverse transcriptase inhibitor
(NNRTI). Sustained HAART treatment showed to result in the selection of HIV variants with
resistances to NRTIs, NNRTIs or PIs, leading to disease advance and finally AIDS (Potter et
al. 2004).
As we have seen in this quick and certainly incomplete glance over antimicrobial drug
resistances, but also in the sections discussing human kinetoplastid pathogens: the problem
is a global one. Nevertheless, developing countries are again the most affected. In developed
nations, actions are taken to address the problem of drug resistance. In Third World
countries, the development of drug resistance against well established, secure and above all
cheap treatments points to a disastrous future.
Similar drug resistance mechanisms have been observed in all kind of cells and
organisms that are confronted with drug treatments. Drug resistance is for example also
observed in parasitic nematodes where resistance has developed to all drugs of the few
anthelmintic classes currently available (Kaminsky 2003).
Failures of drug treatments in pathogenic fungi have recently drawn attention to the problem
of drug resistance in these organisms and molecular drug resistance mechanisms are being
elucidated (Vanden Bossche et al. 1998).
The phenomenon of drug resistance has also been reported in human cell, e.g. human tumor
cells. In the context of this overview the phenomenon of multi drug resistance (MDR) in
cancer cells should just be mentioned, since a complete overview of drug resistance in
human tumor cells would be beyond the scope of this review. MDR in human tumor cells is
the simultaneous development of resistances to a broad palette of structurally and
mechanistically unrelated anticancer drugs (Doyle et al. 2003). The proteins of the ABC
transporters superfamily are responsible for such resistance phenotypes (see sections 2.3.4
and 2.4.5 where ABC transporters have been largely discussed in connection of drug
resistance in Leishmania spp. and in T. brucei spp.). The human MDR1 protein is perhaps the
best-studied P-gp type ABC transporter by being the first discovered. This archetypal ABC
46
transporter actively transports antitumor drugs outside of the cell (among other molecules;
(Juliano et al. 1976). But MDR1 is not the only human ABC transporter involved in multidrug
resistance. A total of 49 human ABC transporters, with multiple cellular functions are known.
The transporters are classified into seven subfamilies with designations ABCA to ABCG. Most
of the subfamilies allocate one or more ABC transporter, which are involved in multidrug
resistance phenotype (http://www.nutrigene.4t.com/humanabc.htm; (Jones et al. 2004).
This overview predominantly addressed the three major human kinetoplastid diseases.
But we have also seen that the acquisition of drug resistance is a natural biological
phenomenon in many organisms and cells types as soon as they are exposed to selective
pressures.
Drug misuses, poverty, inadequate resources and inappropriate self-medications are factors
that increment and accelerate acquisition of drug resistance (Williams 2000). Unfortunately,
these drug resistance-inducing factors all apply to the actual situation in Third World
Countries. The phenomenon of drug resistance is of particular concern in these regions since
they rely mostly on old and affordable chemotherapeutic agents. Most Third World Countries
are not in the economical position to afford new and expensive alternative treatments.
Containment of drug resistance in these countries will rely to great extent on formation of
global partnerships between industries, private and public organizations (e.g. www.dndi.org).
Their goals have to include formulations for new affordable approaches, the set up of
accurate surveillance mechanisms to prevent exuberant misuse of the existing agents, the
improvement of public health systems, the development of combination treatments that
circumvent drug resistance, the reduction of disease transmissions, and the elucidation of the
molecular mechanisms of drug resistance. The latter is of particular importance since a test
for prevalence of resistance genes allows the careful use of drugs before resistance has
become a clinical problem.
The development of drug resistance cannot be halted. However, rational approaches and
judicious drug use will go a long way to keep it under control, in industrialized countries as
well as in those of the developing world.
47
4. Positioning of my Studies
My Ph.D. thesis was aimed to explore the molecular mechanisms involved in the
development of melarsoprol-resistance in trypanosomes. Former work had demonstrated that
an adenosine transporter (TbAT1) takes up melarsoprol in the cells. The loss-of-function of
TbAT1 appeared to underlie resistance to the melaminophenyl arsenical class of drugs. I was
specifically interested in a detailed investigation of the involvement of TbAT1 causing
melarsoprol resistance/refractoriness in trypanosomes, and in finding possible alternative
mechanisms of drug import.
The studies included several investigational approaches. A genetic survey of trypanosomes
from a focus in Uganda, where up to 30% of treated patients did not respond to melarsoprol
therapy, revealed the propensity of relapse patients to harbor parasites with mutated TbAT1
genes. Surprisingly the isolates harbored an almost identical set of mutations. The same set
of mutations was also found in lab-induced, weakly arsenical resistant trypanosomes (see
2.4.5. Geiser and Seebeck, unpublished).
-/-
The construction of a tbat1 knockout clone permitted to study the biological importance of
the transporter in trypanosomes towards trypanocidal compounds. Besides confirming the
involvement of TbAT1 in uptake of trypanocides, the knockout clone further elucidated the
fact that the transporter is not the only responsible for uptake of all classes of trypanocidal
drugs. Furthermore, additional drug transport activities were identified.
-/-
Last but not least, the physiological characterization of the tbat1 knockout clone, in respect
towards two toxic adenosine analogs cordycepin and tubercidin, revealed that the currently
well accepted adenosine transport system of T. brucei has to be revisited. It also showed that
under certain conditions the loss of TbAT1 could confer selective advantages for the
trypanosomes.
The next section will extensively deal with the here shortly depicted studies.
48
5. References
Abiose, A. (1998). "Onchocercal eye disease and the impact of Mectizan
treatment." Ann Trop Med Parasitol 92 Suppl 1: S11-22.
Bentivoglio, M., G. Grassi-Zucconi and K. Kristensson (1994). "From
trypanosomes to the nervous system, from molecules to behavior: a survey,
on the occasion of the 90th anniversary of Castellani's discovery of the
parasites in sleeping sickness." Ital J Neurol Sci 15(2): 75-87.
Berhe, N., D. Wolday, A. Hailu, Y. Abraham, A. Ali, T. Gebre-Michael, P.
Desjeux, A. Sonnerborg, H. Akuffo and S. Britton (1999). "HIV viral load
and response to antileishmanial chemotherapy in co-infected patients." Aids
13(14): 1921-1925.
Berman, J. D., R. Badaro, C. P. Thakur, K. M. Wasunna, K. Behbehani, R.
Davidson, F. Kuzoe, L. Pang, K. Weerasuriya and A. D. Bryceson (1998).
"Efficacy and safety of liposomal amphotericin B (AmBisome) for visceral
leishmaniasis in endemic developing countries." Bull World Health Organ
76(1): 25-32.
Boda, C., B. Enanga, H. Dumet, G. Chauviere, F. Labrousse, C. Couquet, S.
Saivin, G. Houin, J. Perie, M. Dumas and B. Bouteille (2004). "Plasma
kinetics and efficacy of oral megazol treatment in Trypanosoma brucei
brucei-infected sheep." Vet Parasitol 121(3-4): 213-223.
Borst, P. and R. O. Elferink (2002). "Mammalian ABC transporters in health and
disease." Annu Rev Biochem 71: 537-592.
Bouteille, B., A. Marie-Daragon, G. Chauviere, C. de Albuquerque, B. Enanga, M.
L. Darde, J. M. Vallat, J. Perie and M. Dumas (1995). "Effect of megazol
on Trypanosoma brucei brucei acute and subacute infections in Swiss mice."
Acta Trop 60(2): 73-80.
Bouteille, B., O. Oukem, S. Bisser and M. Dumas (2003). "Treatment perspectives
for human African trypanosomiasis." Fundam Clin Pharmacol 17(2): 171181.
Brun, R., R. Schumacher, C. Schmid, C. Kunz and C. Burri (2001). "The
phenomenon of treatment failures in Human African Trypanosomiasis."
Trop Med Int Health 6(11): 906-914.
Burri, C., T. Baltz, C. Giroud, F. Doua, H. A. Welker and R. Brun (1993).
"Pharmacokinetic properties of the trypanocidal drug melarsoprol."
Chemotherapy 39(4): 225-234.
Burri, C. and J. Keiser (2001). "Pharmacokinetic investigations in patients from
northern Angola refractory to melarsoprol treatment." Trop Med Int Health
6(5): 412-420.
Burri, C., S. Nkunku, A. Merolle, T. Smith, J. Blum and R. Brun (2000). "Efficacy
of new, concise schedule for melarsoprol in treatment of sleeping sickness
caused by Trypanosoma brucei gambiense: a randomised trial." Lancet
355(9213): 1419-1425.
Byarugaba, D. K. (2004). "A view on antimicrobial resistance in developing
countries and responsible risk factors." Int J Antimicrob Agents 24(2): 105110.
Carter, N. S., B. J. Berger and A. H. Fairlamb (1995). "Uptake of diamidine drugs
by the P2 nucleoside transporter in melarsen-sensitive and -resistant
Trypanosoma brucei brucei." J Biol Chem 270(47): 28153-28157.
49
Carter, N. S., B. J. Berger and A. H. Fairlamb (1995). Uptake of diamidine drugs
by the P2 nucleoside transporter in melarsen-sensitive and -resistant
Trypanosoma brucei brucei. J. Biol. Chem. 270: 28153-28157.
Carter, N. S. and A. H. Fairlamb (1993). "Arsenical-resistant trypanosomes lack an
unusual adenosine transporter." Nature 361(6408): 173-176.
Carter, N. S. and A. H. Fairlamb (1993). Arsenical-resistant trypanosomes lack an
unusual adenosine transporter. Nature. 361: 173-175.
Carter, N. S., S. M. Landfear and B. Ullman (2001). "Nucleoside transporters of
parasitic protozoa." Trends Parasitol 17(3): 142-145.
Coler, R. N., Y. A. Skeiky, K. Bernards, K. Greeson, D. Carter, C. D. Cornellison,
F. Modabber, A. Campos-Neto and S. G. Reed (2002). "Immunization with
a polyprotein vaccine consisting of the T-Cell antigens thiol-specific
antioxidant, Leishmania major stress-inducible protein 1, and Leishmania
elongation initiation factor protects against leishmaniasis." Infect Immun
70(8): 4215-4225.
Croft, S. L. (2001). "Monitoring drug resistance in leishmaniasis." Trop Med Int
Health 6(11): 899-905.
Croft, S. L. and G. H. Coombs (2003a). "Leishmaniasis--current chemotherapy and
recent advances in the search for novel drugs." Trends Parasitol 19(11):
502-508.
Croft, S. L., K. Seifert and M. Duchene (2003). "Antiprotozoal activities of
phospholipid analogues." Mol Biochem Parasitol 126(2): 165-172.
Cross, G. A. (2001). "African trypanosomes in the 21st century: what is their future
in science and in health?" Int J Parasitol 31(5-6): 427-433.
Damper, D. and C. L. Patton (1976). "Pentamidine transport and sensitivity in
brucei-group trypanosomes." J Protozool 23(2): 349-356.
Darsaud, A., C. Chevrier, L. Bourdon, M. Dumas, A. Buguet and B. Bouteille
(2004). "Megazol combined with suramin improves a new diagnosis index
of the early meningo-encephalitic phase of experimental African
trypanosomiasis." Trop Med Int Health 9(1): 83-91.
Davies, C. R., P. Kaye, S. L. Croft and S. Sundar (2003). "Leishmaniasis: new
approaches to disease control." Bmj 326(7385): 377-382.
Davila, A. M. and K. M. Tyler (2002). "Combating Kinetoplastid diseases."
Kinetoplastid Biol Dis 1(1): 6.
de Almeida, M. C., V. Vilhena, A. Barral and M. Barral-Netto (2003).
"Leishmanial infection: analysis of its first steps. A review." Mem Inst
Oswaldo Cruz 98(7): 861-870.
De Koning, H. P. (2001). "Uptake of pentamidine in Trypanosoma brucei brucei is
mediated by three distinct transporters: implications for cross-resistance
with arsenicals." Mol Pharmacol 59(3): 586-592.
de Koning, H. P., L. F. Anderson, M. Stewart, R. J. S. Burchmore, L. J. M.
Wallace and M. P. Barrett (2004). The trypanocide diminazene aceturate is
accumulated predominantly through the TbAT1 purine transporter:
Additional insights on diamidine resistance in African trypanosomes.
Antimicrob Agents Chemother. 48: 1515-1519.
de Koning, H. P. and S. M. Jarvis (1999). "Adenosine Transporters in
Bloodstream Forms of Trypanosoma brucei brucei: Substrate Recognition
Motifs and Affinity for Trypanocidal Drugs." Mol Pharmacol 56(6): 11621170.
50
de Koning, H. P. and S. M. Jarvis (1999). Adenosine Transporters in Bloodstream
Forms of Trypanosoma brucei brucei: Substrate Recognition Motifs and
Affinity for Trypanocidal Drugs. Mol Pharmacol. 56: 1162-1170.
Denton, H., J. C. McGregor and G. H. Coombs (2004). "Reduction of antileishmanial pentavalent antimonial drugs by a parasite-specific thioldependent reductase, TDR1." Biochem J 381(Pt 2): 405-412.
Desjeux, P. (2004). "Leishmaniasis." Nat Rev Microbiol 2(9): 692-693.
Desjeux, P. (2004a). "Leishmaniasis: current situation and new perspectives."
Comp Immunol Microbiol Infect Dis 27(5): 305-318.
Docampo, R. and S. N. Moreno (2003). "Current chemotherapy of human African
trypanosomiasis." Parasitol Res 90 Supp 1: S10-13.
Donkor, I. O., T. L. Huang, B. Tao, D. Rattendi, S. Lane, M. Vargas, B. Goldberg
and C. Bacchi (2003). "Trypanocidal activity of conformationally restricted
pentamidine congeners." J Med Chem 46(6): 1041-1048.
Doyle, L. A. and D. D. Ross (2003). "Multidrug resistance mediated by the breast
cancer resistance protein BCRP (ABCG2)." Oncogene 22(47): 7340-7358.
Dumonteil, E., J. Escobedo-Ortegon, N. Reyes-Rodriguez, A. Arjona-Torres and
M. J. Ramirez-Sierra (2004). "Immunotherapy of Trypanosoma cruzi
infection with DNA vaccines in mice." Infect Immun 72(1): 46-53.
Editorial Klugmann, K. (2000). "Antimicrobial resistance: a global threat."
Essential Drugs Monitor(Double issue 28/29): 1.
Ehrlich, P. (1907). "Chemotherapeutische Trypanosomen-Studien." Berliner
Klinische Wochenschrift 12: 341-344.
Ehrlich, P. (1907a). "Chemotherapeutische Trypanosomen-Studien." Berliner
Klinische Wochenschrift 11: 310-314.
Ehrlich, P. (1909a). "Chemotherapie von Infektionskrankheiten." Zeitschrift für
Arztliche Fortbildung(23): 721-733.
Ehrlich, P. (1909b). "Ueber die neusten Ereignisse auf dem Gebiete der
Trypanosomenforschung." Beihefte zum Archiv für Schiffs- und
Tropenhygiene unter besonderer Berücksichtigung der Pathologie und
Therapie 13(Beiheft 6): 91-116.
Enanga, B., M. Keita, G. Chauviere, M. Dumas and B. Bouteille (1998). "Megazol
combined with suramin: a chemotherapy regimen which reversed the CNS
pathology in a model of human African trypanosomiasis in mice." Trop Med
Int Health 3(9): 736-741.
Enanga, B., J. M. Ndong, H. Boudra, L. Debrauwer, G. Dubreuil, B. Bouteille, G.
Chauviere, C. Labat, M. Dumas, J. Perie and G. Houin (2000).
"Pharmacokinetics, metabolism and excretion of megazol in a Trypanosoma
brucei gambiense primate model of human African trypanosomiasis.
Preliminary study." Arzneimittelforschung 50(2): 158-162.
Fairlamb, A. H. (2003). "Chemotherapy of human African trypanosomiasis: current
and future prospects." Trends Parasitol 19(11): 488-494.
Fairlamb, A. H., N. S. Carter, M. Cunningham and K. Smith (1992).
"Characterisation of melarsen-resistant Trypanosoma brucei brucei with
respect to cross-resistance to other drugs and trypanothione metabolism."
Mol Biochem Parasitol 53(1-2): 213-222.
Fairlamb, A. H., G. B. Henderson and A. Cerami (1989). "Trypanothione is the
primary target for arsenical drugs against African trypanosomes." Proc Natl
Acad Sci U S A 86(8): 2607-2611.
51
Fairlamb, A. H., K. Smith and K. J. Hunter (1992a). "The interaction of arsenical
drugs with dihydrolipoamide and dihydrolipoamide dehydrogenase from
arsenical resistant and sensitive strains of Trypanosoma brucei brucei." Mol
Biochem Parasitol 53(1-2): 223-231.
Filardi, L. S. and Z. Brener (1987). "Susceptibility and natural resistance of
Trypanosoma cruzi strains to drugs used clinically in Chagas disease." Trans
R Soc Trop Med Hyg 81(5): 755-759.
Geiser, F., A. Lüscher, T. Seebeck and P. Mäser (2004 submitted). "Molecular
pharmacology of adenosine transport in Trypanosoma brucei: P1/P2
revisited." Molecular Pharmacology.
Gourbal, B., N. Sonuc, H. Bhattacharjee, D. Legare, S. Sundar, M. Ouellette, B.
P. Rosen and R. Mukhopadhyay (2004). "Drug uptake and modulation of
drug resistance in Leishmania by an aquaglyceroporin." J Biol Chem
279(30): 31010-31017.
Gouteux, J. P. and D. Sinda (1990). "Community participation in the control of
tsetse flies. Large scale trials using the pyramid trap in the Congo." Trop
Med Parasitol 41(1): 49-55.
Greif, G., A. Harder and A. Haberkorn (2001). "Chemotherapeutic approaches to
protozoa: Coccidiae--current level of knowledge and outlook." Parasitol Res
87(11): 973-975.
Gros, P., Y. B. Ben Neriah, J. M. Croop and D. E. Housman (1986). "Isolation
and expression of a complementary DNA that confers multidrug
resistance." Nature 323(6090): 728-731.
Guerin, P. J., P. Olliaro, S. Sundar, M. Boelaert, S. L. Croft, P. Desjeux, M. K.
Wasunna and A. D. Bryceson (2002). "Visceral leishmaniasis: current status
of control, diagnosis, and treatment, and a proposed research and
development agenda." Lancet Infect Dis 2(8): 494-501.
Haimeur, A., C. Brochu, P. Genest, B. Papadopoulou and M. Ouellette (2000).
"Amplification of the ABC transporter gene PGPA and increased
trypanothione levels in potassium antimonyl tartrate (SbIII) resistant
Leishmania tarentolae." Mol Biochem Parasitol 108(1): 131-135.
Hannaert, V., E. Saavedra, F. Duffieux, J. P. Szikora, D. J. Rigden, P. A. Michels
and F. R. Opperdoes (2003). "Plant-like traits associated with metabolism
of Trypanosoma parasites." Proc Natl Acad Sci U S A 100(3): 1067-1071.
Havlir, D., M. M. McLaughlin and D. D. Richman (1995). "A pilot study to
evaluate the development of resistance to nevirapine in asymptomatic
human immunodeficiency virus-infected patients with CD4 cell counts of >
500/mm3: AIDS Clinical Trials Group Protocol 208." J Infect Dis 172(5):
1379-1383.
Iten, M., H. Mett, A. Evans, J. C. Enyaru, R. Brun and R. Kaminsky (1997).
"Alterations in ornithine decarboxylase characteristics account for tolerance
of Trypanosoma brucei rhodesiense to D,L-alpha-difluoromethylornithine."
Antimicrob Agents Chemother 41(9): 1922-1925.
Jacobs, M. R. (2004). "Streptococcus pneumoniae: epidemiology and patterns of
resistance." Am J Med 117 Suppl 3A: 3S-15S.
Jha, S. N., N. K. Singh and T. K. Jha (1991). "Changing response to diamidine
compounds in cases of kala-azar unresponsive to antimonial." J Assoc
Physicians India 39(4): 314-316.
52
Jha, T. K., S. Sundar, C. P. Thakur, P. Bachmann, J. Karbwang, C. Fischer, A.
Voss and J. Berman (1999). "Miltefosine, an oral agent, for the treatment of
Indian visceral leishmaniasis." N Engl J Med 341(24): 1795-1800.
Jones, P. M. and A. M. George (2004). "The ABC transporter structure and
mechanism: perspectives on recent research." Cell Mol Life Sci 61(6): 682699.
Juliano, R. L. and V. Ling (1976). "A surface glycoprotein modulating drug
permeability in Chinese hamster ovary cell mutants." Biochim Biophys Acta
455(1): 152-162.
Kaminsky, R. (2003). "Drug resistance in nematodes: a paper tiger or a real
problem?" Curr Opin Infect Dis 16(6): 559-564.
Katlama, C., B. Regnier, N. Ben Salah, E. Pichard and F. Vachon (1985).
"[Toxicity of Glucantime. A case]." Ann Med Interne (Paris) 136(4): 321322.
Keiser, J., A. Stich and C. Burri (2001). "New drugs for the treatment of human
African trypanosomiasis: research and development." Trends Parasitol
17(1): 42-49.
Kennedy, P. G. (2004). "Human African trypanosomiasis of the CNS: current
issues and challenges." J Clin Invest 113(4): 496-504.
Kieffer, T. and R. Siliciano (2004). "Averting the evolution of drug resistance."
Hopkins HIV Rep 16(4): 9-10.
Kioy, D., J. Jannin and N. Mattock (2004). "Disease Watch: Human African
trypanosomiasis." Nat Rev Microbiol 2: 186-187.
Klingbeil, M. M. and P. T. Englund (2004). "Closing the gaps in kinetoplast DNA
network replication." Proc Natl Acad Sci U S A 101(13): 4333-4334.
Klokouzas, A., S. Shahi, S. B. Hladky, M. A. Barrand and H. W. van Veen (2003).
"ABC transporters and drug resistance in parasitic protozoa." Int J
Antimicrob Agents 22(3): 301-317.
Krishnamachary, N. and M. S. Center (1993). "The MRP gene associated with a
non-P-glycoprotein multidrug resistance encodes a 190-kDa membrane
bound glycoprotein." Cancer Res 53(16): 3658-3661.
Kristjanson, P. M., B. M. Swallow, G. J. Rowlands, R. L. Kruska and P. N. de
Leeuw (1999). "Measuring the costs of African animal trypanosomosis, the
Potential benefits of control and returns to research." Agricultural Systems
59(1): 79-98.
Lancien, J. (1991). "[Campaign against sleeping sickness in South-West Uganda
by trapping tsetse flies]." Ann Soc Belg Med Trop 71 Suppl 1: 35-47.
Leander, B. S. (2004). "Did trypanosomatid parasites have photosynthetic
ancestors?" Trends Microbiol 12(6): 251-258.
Legare, D., S. Cayer, A. K. Singh, D. Richard, B. Papadopoulou and M. Ouellette
(2001a). "ABC proteins of Leishmania." J Bioenerg Biomembr 33(6): 469474.
Legare, D., D. Richard, R. Mukhopadhyay, Y. D. Stierhof, B. P. Rosen, A.
Haimeur, B. Papadopoulou and M. Ouellette (2001). "The Leishmania
ATP-binding cassette protein PGPA is an intracellular metal-thiol
transporter ATPase." J Biol Chem 276(28): 26301-26307.
Legros, D., S. Evans, F. Maiso, J. C. Enyaru and D. Mbulamberi (1999). "Risk
factors for treatment failure after melarsoprol for Trypanosoma brucei
gambiense trypanosomiasis in Uganda." Trans R Soc Trop Med Hyg 93(4):
439-442.
53
Legros, D., G. Ollivier, M. Gastellu-Etchegorry, C. Paquet, C. Burri, J. Jannin
and P. Buscher (2002). "Treatment of human African trypanosomiasis-present situation and needs for research and development." Lancet Infect
Dis 2(7): 437-440.
Leon, J. S., K. Wang and D. M. Engman (2003). "Captopril ameliorates
myocarditis in acute experimental Chagas disease." Circulation 107(17):
2264-2269.
Linton, K. J. and C. F. Higgins (1998). "The Escherichia coli ATP-binding cassette
(ABC) proteins." Mol Microbiol 28(1): 5-13.
Lo Presti, M. S., H. W. Rivarola, J. M. Bustamante, A. R. Fernandez, J. E.
Enders, R. Fretes, S. Gea and P. A. Paglini-Oliva (2004). "Thioridazine
treatment prevents cardiopathy in Trypanosoma cruzi infected mice." Int J
Antimicrob Agents 23(6): 634-636.
Maser, P. and R. Kaminsky (1998). "Identification of three ABC transporter genes
in Trypanosoma brucei spp." Parasitol Res 84(2): 106-111.
Maser, P., A. Luscher and R. Kaminsky (2003). "Drug transport and drug
resistance in African trypanosomes." Drug Resist Updat 6(5): 281-290.
Maser, P., C. Sutterlin, A. Kralli and R. Kaminsky (1999). "A nucleoside
transporter from Trypanosoma brucei involved in drug resistance." Science
285(5425): 242-244.
Mäser, P., C. Sütterlin, A. Kralli and R. Kaminsky (1999). A nucleoside
transporter from Trypanosoma brucei involved in drug resistance. Science.
285: 242-244.
Mäser, P., D. Vogel, C. Schmid, B. Räz and R. Kaminsky (2001). Identification
and characterization of trypanocides by functional expression of an
adenosine transporter from Trypanosoma brucei in yeast. J Mol Med. 97:
121-127.
Matovu, E., J. C. Enyaru, D. Legros, C. Schmid, T. Seebeck and R. Kaminsky
(2001). "Melarsoprol refractory T. b. gambiense from Omugo, northwestern Uganda." Trop Med Int Health 6(5): 407-411.
Matovu, E., F. Geiser, V. Schneider, P. Mäser, J. C. K. Enyaru, R. Kaminsky, S.
Gallati and T. Seebeck (2001a). "Genetic variants of the TbAT1 adenosine
transporter from African trypanosomes in relapse infections following
melarsoprol therapy." Mol Biochem Parasitol 117(1): 73-81.
Matovu, E., M. L. Stewart, F. Geiser, R. Brun, P. Maser, L. J. Wallace, R. J.
Burchmore, J. C. Enyaru, M. P. Barrett, R. Kaminsky, T. Seebeck and H.
P. de Koning (2003). "Mechanisms of arsenical and diamidine uptake and
resistance in Trypanosoma brucei." Eukaryot Cell 2(5): 1003-1008.
Miles, M. A., M. D. Feliciangeli and A. R. de Arias (2003). "American
trypanosomiasis (Chagas' disease) and the role of molecular epidemiology in
guiding control strategies." Bmj 326(7404): 1444-1448.
Molyneux, D. H. (2001). "Sterile insect release and trypanosomiasis control: a plea
for realism." Trends Parasitol 17(9): 413-414.
Molyneux, D. H., V. Pentreath and F. Doua (1996). African Trypanosomiasis in
Man. Manson's Tropical Diseases. Gordon C. Cook, Saunders. Chapter 63:
1172-1196.
Molyneux, D. H. and D. H. Smith (2000). African Trypanosomiasis. Infection
Diseases; Major Tropical Syndromes by Body System: The Central
Nervous System. D. a. J. Cohen. London, Mosby. 6: 18.10-18.14.
54
Moncayo, A. (2003). "Chagas disease: current epidemiological trends after the
interruption of vectorial and transfusional transmission in the Southern
Cone countries." Mem Inst Oswaldo Cruz 98(5): 577-591.
Morel, C. M. and J. Lazdins (2003). "Chagas disease." Nat Rev Microbiol 1(1):
14-15.
Morris, J. C., M. E. Drew, M. M. Klingbeil, S. A. Motyka, T. T. Saxowsky, Z.
Wang and P. T. Englund (2001). "Replication of kinetoplast DNA: an
update for the new millennium." Int J Parasitol 31(5-6): 453-458.
Murta, S. M., W. G. dos Santos, C. Anacleto, P. Nirde, E. S. Moreira and A. J.
Romanha (2001). "Drug resistance in Trypanosoma cruzi is not associated
with amplification or overexpression of P-glycoprotein (PGP) genes." Mol
Biochem Parasitol 117(2): 223-228.
Murta, S. M., R. T. Gazzinelli, Z. Brener and A. J. Romanha (1998). "Molecular
characterization of susceptible and naturally resistant strains of
Trypanosoma cruzi to benznidazole and nifurtimox." Mol Biochem Parasitol
93(2): 203-214.
Murta, S. M. and A. J. Romanha (1999). "Characterization of Trypanosoma cruzi."
Mem Inst Oswaldo Cruz 94 Suppl 1: 177-180.
Nok, A. J. (2003). "Arsenicals (melarsoprol), pentamidine and suramin in the
treatment of human African trypanosomiasis." Parasitol Res 90(1): 71-79.
Olbrich, C., A. Gessner, W. Schroder, O. Kayser and R. H. Muller (2004). "Lipiddrug conjugate nanoparticles of the hydrophilic drug diminazenecytotoxicity testing and mouse serum adsorption." J Control Release 96(3):
425-435.
Ouellette, M., F. Fase-Fowler and P. Borst (1990). "The amplified H circle of
methotrexate-resistant leishmania tarentolae contains a novel Pglycoprotein gene." Embo J 9(4): 1027-1033.
Paglini-Oliva, P., A. R. Fernandez, R. Fretes and A. Peslman (1998). "Structural,
ultrastructural studies and evolution of Trypanosoma cruzi-infected mice
treated with thioridazine." Exp Mol Pathol 65(2): 78-86.
Paveto, C., M. C. Guida, M. I. Esteva, V. Martino, J. Coussio, M. M. Flawia and
H. N. Torres (2004). "Anti-Trypanosoma cruzi activity of green tea
(Camellia sinensis) catechins." Antimicrob Agents Chemother 48(1): 69-74.
Pepin, J. and F. Milord (1994). "The treatment of human African
trypanosomiasis." Adv Parasitol 33: 1-47.
Phillips, M. A., P. Coffino and C. C. Wang (1987). "Cloning and sequencing of the
ornithine decarboxylase gene from Trypanosoma brucei. Implications for
enzyme turnover and selective difluoromethylornithine inhibition." J Biol
Chem 262(18): 8721-8727.
Pospichal, H., R. Brun, R. Kaminsky and L. Jenni (1994). "Induction of resistance
to melarsenoxide cysteamine (Mel Cy) in Trypanosoma brucei brucei." Acta
Trop 58(3-4): 187-197.
Potter, S. J., C. B. Chew, M. Steain, D. E. Dwyer and N. K. Saksena (2004).
"Obstacles to successful antiretroviral treatment of HIV-1 infection:
problems & perspectives." Indian J Med Res 119(6): 217-237.
Raether, W. and H. Hanel (2003). "Nitroheterocyclic drugs with broad spectrum
activity." Parasitol Res 90 Supp 1: S19-39.
Rhee, E. G., S. Mendez, J. A. Shah, C. Y. Wu, J. R. Kirman, T. N. Turon, D. F.
Davey, H. Davis, D. M. Klinman, R. N. Coler, D. L. Sacks and R. A. Seder
(2002). "Vaccination with heat-killed leishmania antigen or recombinant
55
leishmanial protein and CpG oligodeoxynucleotides induces long-term
memory CD4+ and CD8+ T cell responses and protection against
leishmania major infection." J Exp Med 195(12): 1565-1573.
Roberts, W. L., W. J. McMurray and P. M. Rainey (1998). "Characterization of
the antimonial antileishmanial agent meglumine antimonate (glucantime)."
Antimicrob Agents Chemother 42(5): 1076-1082.
Rodriques Coura, J. and S. L. de Castro (2002). "A critical review on Chagas
disease chemotherapy." Mem Inst Oswaldo Cruz 97(1): 3-24.
Rosenthal, E. and P. Marty (2003). "Recent understanding in the treatment of
visceral leishmaniasis." J Postgrad Med 49(1): 61-68.
Samudio, M., S. Montenegro-James, M. Cabral, J. Martinez, A. Rojas de Arias
and M. A. James (1998). "Cytokine responses in Trypanosoma cruziinfected children in Paraguay." Am J Trop Med Hyg 58(1): 119-121.
Sanchez, M., R. Tryon, J. Green, I. Boor and S. Landfear (2002). Six related
nucleoside/nucleobase transporters from Trypanosoma brucei exhibit
distinct biochemical functions. J Biol Chem. 277: 21499-21504.
Sanchez, M. A., S. Drutman, M. van Ampting, K. Matthews and S. M. Landfear
(2004). "A novel purine nucleoside transporter whose expression is upregulated in the short stumpy form of the Trypanosoma brucei life cycle."
Mol Biochem Parasitol 136(2): 265-272.
Sanchez, M. A., R. Tryon, J. Green, I. Boor and S. M. Landfear (2002). "Six
related nucleoside/nucleobase transporters from Trypanosoma brucei
exhibit distinct biochemical functions." J Biol Chem 277(24): 21499-21504.
Sanchez, M. A., B. Ullman, S. M. Landfear and N. S. Carter (1999). Cloning and
functional expression of a gene encoding a P1 type nucleoside transporter
from Trypanosoma brucei. J Biol Chem. 274: 30244-30249.
Seebeck, T., C. Naula, T. Shalaby and K. Gong (1999). "Human Sleeping
Sickness-Current Approaches to Chemotherapy." Nova Acta Leopoldina
78(307): 227-241.
Shahi, S. K., R. L. Krauth-Siegel and C. E. Clayton (2002). "Overexpression of the
putative thiol conjugate transporter TbMRPA causes melarsoprol resistance
in Trypanosoma brucei." Mol Microbiol 43(5): 1129-1138.
Shaked-Mishan, P., N. Ulrich, M. Ephros and D. Zilberstein (2001). "Novel
Intracellular SbV reducing activity correlates with antimony susceptibility
in Leishmania donovani." J Biol Chem 276(6): 3971-3976.
Shears, P. (2000). "Emerging and reemerging infections in africa: the need for
improved laboratory services and disease surveillance." Microbes Infect
2(5): 489-495.
Simarro, P. P. and P. N. Asumu (1996). "Gambian trypanosomiasis and synergism
between melarsoprol and eflornithine: first case report." Trans R Soc Trop
Med Hyg 90(3): 315.
Smith, D. H., J. Pepin and A. H. Stich (1998). "Human African trypanosomiasis:
an emerging public health crisis." Br Med Bull 54(2): 341-355.
Stanghellini, A. and T. Josenando (2001). "The situation of sleeping sickness in
Angola: a calamity." Trop Med Int Health 6(5): 330-334.
Stich, A., P. M. Abel and S. Krishna (2002). "Human African trypanosomiasis."
Bmj 325(7357): 203-206.
Sturk, L. M., J. L. Brock, C. R. Bagnell, J. E. Hall and R. R. Tidwell (2004).
"Distribution and quantitation of the anti-trypanosomal diamidine 2,5-bis(4-
56
amidinophenyl)furan (DB75) and its N-methoxy prodrug DB289 in murine
brain tissue." Acta Trop 91(2): 131-143.
Sundar, S. (2001a). "Drug resistance in Indian visceral leishmaniasis." Trop Med
Int Health 6(11): 849-854.
Sundar, S., G. Agrawal, M. Rai, M. K. Makharia and H. W. Murray (2001).
"Treatment of Indian visceral leishmaniasis with single or daily infusions of
low dose liposomal amphotericin B: randomised trial." Bmj 323(7310): 419422.
Thakur, C. P., G. P. Sinha, V. Sharma, A. K. Pandey, M. Kumar and B. B. Verma (1993).
"Evaluation of amphotericin B as a first line drug in comparison to sodium
stibogluconate in the treatment of fresh cases of kala-azar." Indian J Med Res 97:
170-175.
Urbina, J. A. (1999). "Chemotherapy of Chagas' disease: the how and the why." J
Mol Med 77(3): 332-338.
Urbina, J. A. (2001). "Specific treatment of Chagas disease: current status and new
developments." Curr Opin Infect Dis 14(6): 733-741.
Vanden Bossche, H., F. Dromer, I. Improvisi, M. Lozano-Chiu, J. H. Rex and D.
Sanglard (1998). "Antifungal drug resistance in pathogenic fungi." Med
Mycol 36 Suppl 1: 119-128.
Vickerman, K. (1985). "Developmental cycles and biology of pathogenic
trypanosomes." Br Med Bull 41(2): 105-114.
Vreysen, M. J., K. M. Saleh, M. Y. Ali, A. M. Abdulla, Z. R. Zhu, K. G. Juma, V. A.
Dyck, A. R. Msangi, P. A. Mkonyi and H. U. Feldmann (2000). "Glossina austeni
(Diptera: Glossinidae) eradicated on the island of Unguja, Zanzibar, using the
sterile insect technique." J Econ Entomol 93(1): 123-135.
White, N. J. (2004). "Antimalarial drug resistance." J Clin Invest 113(8): 10841092.
Williams, R. (2000). "Antimicrobial resistance: the facts." Essential Drugs
Monitor(Double issue 28/29): 7-8.
Wilson, K., R. L. Berens, C. D. Sifri and B. Ullman (1994). "Amplification of the
inosinate dehydrogenase gene in Trypanosoma brucei gambiense due to an
increase in chromosome copy number." J Biol Chem 269(46): 28979-28987.
Wise, R. (2004). "The relentless rise of resistance?" J Antimicrob Chemother
54(2): 306-310.
Wolday, D., N. Berhe, H. Akuffo and S. Britton (1999). "Leishmania-HIV
interaction: immunopathogenic mechanisms." Parasitol Today 15(5): 182187.
Wongsrichanalai, C., A. L. Pickard, W. H. Wernsdorfer and S. R. Meshnick
(2002). "Epidemiology of drug-resistant malaria." Lancet Infect Dis 2(4):
209-218.
Yeates, C. (2002). "Sitamaquine (GlaxoSmithKline/Walter Reed Army Institute)."
Curr Opin Investig Drugs 3(10): 1446-1452.
Yeung, S., W. Pongtavornpinyo, I. M. Hastings, A. J. Mills and N. J. White
(2004). "Antimalarial drug resistance, artemisinin-based combination
therapy, and the contribution of modeling to elucidating policy choices." Am
J Trop Med Hyg 71(2 Suppl): 179-186.
Zhou, L., K. Lee, D. R. Thakker, D. W. Boykin, R. R. Tiwell and J. E. Hall
(2002). "Enhanced permeability of the antimicrobial agent 2,5-bis(4amidinophenyl)furan across Caco-2 cell monolayers via its
methylamidoidme prodrug." Pharm Res 19(11): 1689-1695.
57
B. Summaries and Publications
1. Summaries
1.1. Genetic variants of the TbAT1 adenosine transporter from African
trypanosomes in relapse infections following melarsoprol therapy
Mol Biochem Parasitol, 2001, 117(1): 73-81.
Matovu E, Geiser F, Schneider V, Maser P, Enyaru JC, Kaminsky R, Gallati S, Seebeck T.
This aim of this study was to test the hypothesis that melarsoprol treatment failure is linked
with a malfunction of the P2 transport activity. P2 activity is encoded in T. b. brucei by the
gene for the adenosine transporter 1 (TbAT1), and it is responsible for the uptake of the
physiological substrates as adenine and adenosine. In addition, P2 activity was shown to be
also involved in the uptake of arsenical drugs and diamidines. Laboratory-derived arsenical
resistant T. brucei strains exhibited impaired P2 transport activity and contained mutations in
the open reading frames of the TbAT1 gene.
Cerebrospinal fluid (CSF) from 65 newly infected and/or relapse cases with T. b. gambiense
infections were collected in 1998 in Omugo (Northwestern Uganda). In this sleeping sickness
focus up to 30% of treated patients did not respond to melarsoprol therapy.
Sequence analysis of the TbAT1 genes from these isolates revealed a propensity of relapse
patients to harbor parasites with mutated TbAT1 ORFs. Surprisingly, all TbAT1 mutants
harbored almost identical sets of mutations that are also present in the laboratory derived
resistant strain. Interestingly, identical sets of point mutations were also found in melarsoprol
refractory isolates from other endemic areas hundreds of kilometers apart from Omugo, and
even in a drug resistant T. b. rhodesiense strain. Only one isolate among all the strains
analyzed had lost the entire TbAT1. This finding was unexpected and may indicate that lossof-function of TbAT1 may not be the selective principal factor for the rapid expansion of
melarsoprol-refractory strains in the field.
58
The study indicates a link between the loss of P2 transport activity in correlation with
melarsoprol refractory trypanosome infections. Nevertheless, about 30% of relapse patients
analyzed had parasites with wild type TbAT1s. This observation suggested that the mutation
ally inactivated TbAT1 gene might not be the sole responsible for melarsoprol treatment
failures.
59
1.2. Mechanisms of arsenical and diamidine uptake and resistance in
Trypanosoma brucei
Eukaryot Cell, 2003, 2(5): 1003-1008.
Matovu E, Stewart ML, Geiser F, Brun R, Maser P, Wallace LJ, Burchmore RJ, Enyaru JC,
Barrett MP, Kaminsky R, Seebeck T, de Koning HP.
This study was done to test whether the gene encoding for P2 transport activity, T. brucei
adenosine transporter1 (TbAT1), plays a role in melarsoprol drug resistance in trypanosomes.
TbAT1 was shown to transport adenine and adenosine. Interestingly, the transporter was also
able to transport different classes of trypanocides, such as the melarsen-based drugs and
diamidines. Furthermore, melarsoprol treatment failure in the field has been associated with a
mutated TbAT1 gene. Based on these observations, the deletion of the TbAT1 gene was
expected to confer a change in the resistance phenotype of the tbat1 null trypanosome.
As anticipated, our tbat1
-/-
trypanosomes exhibit no P2 adenosine transporter activity. In
addition, the knockout clone had decreased sensitivity towards melarsen-based arsenicals,
as well as against diamidines. However, the level of resistance was not high, with factors only
around 2 to 3 for the human trypanocides melarsoprol and pentamidine. Surprisingly the
tbat1
-/-
®
clone was 20-fold more resistant to the veterinary drug Berenil (diminazene
aceturate; an other diamidine-class compound).
Despite the absence of a high-level resistance towards melarsoprol, the reduction of drug
sensitivity might still be of clinical significance. This is indicated by the results obtained in
mouse experiments, where mice infected with the parental line trypanosomes were all cured
with the maximum possible melarsoprol treatment protocol, whereas mice infected with the
-/-
tbat1 strain all relapsed the same melarsoprol treatment. Further experiments had shown
that T. brucei contains two additional pentamidine transporters, a high- and a low-affinity
pentamidine transporter1 (HAPT1 and LAPT1, respectively). These are still active in the tbat1
null mutant clone. HAPT1 was then identified as a further uptake mechanism for melarsenbased drugs.
In summary this study confirmed the involvement of TbAT1 in uptake of clinically important
trypanocides in T. b. brucei. However, the transporter does not appear to be solely
60
-/-
responsible for uptake of melarsen-based drugs and diamidines. The tbat1 knockout clone
permitted to further identify and characterize possible additional drug transport activities. Thus
high-level drug resistance to arsenical compounds appears to involve the loss of more than
one transporter.
61
1.3. Molecular pharmacology of adenosine transport in Trypanosoma brucei:
P1/P2 revisited
Geiser F, Lüscher A, Seebeck T, Mäser P.
(Submitted to Molecular Pharmacology)
The original intention of the study was started to further characterize the T. brucei
-/-
adenosine transporter1 (TbAT1) knockout strain (tbat1 ), and it resulted in a critical
reassessment of the currently accepted P1/P2 adenosine transport model.
Trypanosomes rely on uptake of purines from their host through a variety of transporters, due
to their incapability of purine de novo synthesis. Two transport activities, P1 and P2, have
been shown to represent two distinct high-affinity adenosine transport systems of T. brucei.
TbAT1, the gene encoding for P2 transport activity, is further responsible for melarsoprol and
pentamidine uptake into the cells. Several studies associated melarsoprol treatment failures
with the inactivation of TbAT1 due to point mutations. Surprisingly the deletion of the TbAT1
gene only slightly reduced susceptibility of the cell towards melarsoprol and pentamidine.
The present study demonstrates the characterization of the parental blood stream form T. b.
-/-
brucei and of its tbat1 knockout clone with respect to their sensitivity towards the two toxic
adenosine analogs cordycepin (3’-deoxyadenosine) and tubercidin (7’-deazaadenosine).
Results recording a 77-fold increase in tubercidin resistance and a 14-fold increase in
cordycepin resistance in the absence of TbAT1 were in agreement with the P1/P2 transport
model, as well as the fact that further addition of excess inosine boosted the resistance
phenotype. Other results however were in complete disagreement with the transport model,
like the fact that addition of excess adenine reverted the resistance phenotype to parental
+/+
TbAT1
levels.
Interestingly, tbat1
-/-
clones overexpressed genes of the TbNT family of transporters, which
are responsible for the P1 transport activity. While this observation has been made only with
genetic knockout strain constructed in the laboratory, a follow-up with naturally melarsoprolresistant variants will be of interest. If confirmed, the phenomenon would open up novel
strategies for chemotherapy based on toxic adenosine derivatives.
62
-/-
Unexpectedly, the tbat1 knockout clone not only did not show growth defects in comparison
with the parental strain, but it even showed a faster growth phenotype when cultivated in
standard bloodstream medium, with hypoxanthine as purine source.
Taken together, our results showed that on the one hand a) the P1/P2 transport model may
contain additional complexities, and b) that loss of P2 function may confer, under certain
conditions, selective advantages for bloodstream form trypanosomes.
63
2. Publications
Molecular & Biochemical Parasitology 117 (2001) 73 – 81
www.parasitology-online.com.
Genetic variants of the TbAT1 adenosine transporter from African
trypanosomes in relapse infections following melarsoprol therapy
Enock Matovu a, Federico Geiser a, Vreni Schneider b, Pascal Mäser c,
John C.K. Enyaru d, Ronald Kaminsky e,1, Sabina Gallati b, Thomas Seebeck a,*
b
a
Institute of Cell Biology, Uni6ersity of Bern, Baltzerstrasse 4, CH-3012 Bern, Switzerland
Molecular Human Genetics, Department of Clinical Research, Inselspital, Uni6ersity of Bern, CH-3010 Bern, Switzerland
c
Biology Department, UCSD, 9500 Gilman Dr., La Jolla, CA 92093 -0116, USA
d
Li6estock Health Research Institute, PO Box 96, Tororo, Uganda
e
Swiss Tropical Institute, Uni6ersity of Basel, CH-3051 Basel, Switzerland
Received 6 April 2001; received in revised form 19 June 2001; accepted 27 June 2001
Abstract
We have analyzed the TbAT1 gene, which codes for the P2 adenosine transporter, from Trypanosoma brucei field isolates to
investigate a possible link between the presence of mutations in this gene and melarsoprol treatment failure. Of 65 T. b. gambiense
isolates analyzed from a focus in north-western Uganda with high treatment failure rates following melarsoprol therapy, 38 had
a mutated TbAT1. Unexpectedly, all individual isolates contained the same set of nine mutations in their TbAT1 genes. Of these,
five point mutations resulted in amino acid substitutions, one resulted in the deletion of an entire codon, and three were silent
point mutations. Eight of these mutations had previously been reported in a laboratory-derived Cymelarsan-resistant T. b. brucei
clone. Identical sets of mutations were also found in a drug-resistant T.b.rhodesiense isolate from south-eastern Uganda and in a
T.b.gambiense isolate from a relapsing patient from northern Angola. A deletion of the TbAT1 gene was found in a single T. b.
gambiense isolate from a relapsing patient from northern Angola. The data presented demonstrate the surprising finding that
trypanosomes from individual relapse patients of one area, as well as from geographically distant localities, contain an identical
set of point mutations in the transporter gene TbAT1. They further demonstrate that many isolates from relapse patients
contained the wild-type TbAT1 genes, suggesting that melarsoprol refractoriness is not solely due to a mutational inactivation of
TbAT1. © 2001 Elsevier Science B.V. All rights reserved.
Keywords: Human sleeping sickness; Melarsoprol; Drug resistance; SSCP; Adenosine transporter; African trypanosomes
1. Introduction
Sleeping sickness (human African trypanosomiasis,
HAT) remains a major scourge of endemic areas of
Sub-Saharan Africa. Chemotherapy, which is the
Abbre6iations: SSCP, single-strand conformational polymorphism;
RFLP, restriction enzyme fragment length polymorphism; DFMO,
alpha-difluoromethylornithin; HAT, human African trypanosomiasis;
CSF, cerebrospinal fluid.
* Corresponding author. Tel.: +41-31631-4649; fax: + 41-316314684.
E-mail address: [email protected] (T. Seebeck).
1
Present address: Novartis Animal Health, CH-1566 St. Aubin,
Switzerland.
mainstay in the control of this disease, relies on very
few drugs [1]. Unfortunately, these drugs are characterized either by high toxicity or low efficacy against late
stage disease [2–4], when the parasites have penetrated
the central nervous system. Unfortunately, there are no
immediate prospects for development of new trypanocides, mostly because of economic reasons.
Difluoromethylornithine (DFMO), the most recently
introduced compound, is only effective against T. b.
gambiense [5] and is not affordable for the resourcepoor endemic countries. This leaves melarsoprol as the
sole drug for the treatment of late-stage HAT. In
addition to reactive encephalopathies that claim up to
5% of treated patients, there are increasing reports of
relapses in some T. b. gambiese endemic areas of Africa,
0166-6851/01/$ - see front matter © 2001 Elsevier Science B.V. All rights reserved.
PII: S 0 1 6 6 - 6 8 5 1 ( 0 1 ) 0 0 3 3 2 - 2
E. Mato6u et al. / Molecular & Biochemical Parasitology 117 (2001) 73–81
74
Table 1
Distribution of SfaNI RFLPs in newly infected and relapse cases
Cases
Wild-type
Mutant
Mixed
Newly infected
Relapsed
Total
14 (64)
13 (30)
27 (41)
5 (23)
7 (16)
12 (19)
3 (14)
23 (54)
26 (40)
22 (100)
43 (100)
65 (100)
Wild-type: RFLP pattern represented by STIB777S; mutant RFLP
pattern represented by STIB777R; mixed: both patterns present
simultaneously. Values in parentheses: percentage of total. Total: all
CSF samples (65) in which trypanosomes were present.
namely Sudan, Uganda, Congo and Angola. In
Uganda, up to 30% of treated patients are reportedly
non-responsive to Melarsoprol therapy [6– 8]. Poor
treatment regimes and/or drug resistance could be responsible for these relapses.
Resistance to melarsoprol and diamidines under culture conditions is associated with a deficiency in the P2
transporter of T. brucei, which transports adenosine
and related compounds, as well as melarsoprol, across
the plasma membrane [9– 12]. Recent studies have revealed several mutations in the gene that codes for the
P2 transporter, TbAT1, in a laboratory-derived
melarsoprol-resistant stock of T. brucei. When expressed in yeast, this mutated P2 transporter could no
longer import melarsoprol, as well as other compounds
[13]. In these trypanosomes, resistance resulted from a
reduced net drug uptake. By exploiting two simultaneously occurring mutations that generate a restriction
fragment length polymorphism (RFLP) for SfaNI,
Mäser et al. [13] devised a means of distinguishing
between the arsenical-sensitive T. brucei clone and its
resistant laboratory derivative.
In view of the challenges to HAT management by
melarsoprol treatment failures, the aim of this study
was to test the hypothesis of a possible link between
mutations in the TbAT1 transporter gene and the occurrence of relapses after melarsoprol treatment. In
addition, the study served to determine if the genetic
alterations of TbAT1 observed in the laboratory-induced resistant stock are also present in field isolates.
To achieve this goal, fragments of the TbAT1 gene were
amplified from trypanosomes from the cerebrospinal
fluid (CSF) both from newly infected and from relapsing patients. A rapid screening for the potential presence of mutants was done by single-stranded DNA
conformation polymorphism (SSCP) analysis [14], followed by DNA sequencing of suspected mutant genes.
SSCP is based on the fact that the presence of even a
single mutation in a single-stranded fragment of DNA
alters its conformation and leads to differential mobility
of the fragment on a polyacrylamide gel. Liechti-Gallati
et al. [15] have improved this approach to combine
both SSCP and heteroduplex analyses [16] on the same
gel, thereby increasing its sensitivity. In addition to
SSCP and DNA sequencing, the fragments were subjected to SfaNI digestion for restriction fragment length
polymorphism analysis (RFLP).
The unexpected outcome of this analysis was the
observation that the majoritiy of the individual patients
harbored trypanosomes with identical sets of mutations
in the TbAT1 gene. In addition, this set of mutations
was very similar to that found in the laboratory-derived
arsenical-resistant strain 777R [13].
2. Materials and methods
2.1. Trypanosome strains and culture
T.b.brucei stock STIB 777S (originally named STIB
777-AE) and STIB 777R, a clone derived from
STIB777S by in-vivo selection for resistance to
Cymelarsan (melarsenoxide cysteamine) [17], were previously used to investigate the adenosine transporter
involvement in drug resistance [13]. STIB 871 is a
drug-resistant T. b. rhodesiense from south-eastern
Uganda that was isolated by mouse inoculation and
maintained in vitro as bloodstream form cultures [18].
K001 and K003 are T. b. gambiense stocks isolated
from melarsoprol relapse patients in northern Angola.
They were isolated by transformation to procyclic
forms using the in-vitro isolation kit of Aerts et al. [19].
Procyclic trypanosomes were cultured in SDM-79 supplemented with 5% fetal bovine serum at 27 °C [20].
2.2. Collection and storage of cerebrospinal fluid
CSF from patients newly infected with T.b. gambiense and from relapse cases was collected in Omugo,
north-western Uganda during 1998. CSF was collected
via lumbar puncture. For cryopreservation, aliquots
were mixed with 0.5 volume of PSG (56 mM Na2HPO4,
3 mM NaH2PO4, 43 mM NaCl, 1% glucose, pH 8.0)
containing 30% glycerol. Samples were frozen in liquid
nitrogen and later stored at -20o. Isolates from newly
infected patients were designated with serial numbers
starting with F, while relapsing cases were designated
with R. During the course of the experiment, several of
the patients originally classified as newly infected underwent a relapse. In these cases, their original numbering was maintained (e.g. see Table 2).
2.3. DNA preparation
Trypanosomes from in-vitro cultures were washed
with PSG and resuspended in lysis buffer (40 mM
Tris–HCl, 150 mM NaCl, 1 mM EDTA, 0.1% SDS,
100 mg ml − 1 proteinase K, pH 8.0). Cells were lysed
overnight at 50 °C, followed by successive extractions
E. Mato6u et al. / Molecular & Biochemical Parasitology 117 (2001) 73–81
Table 2
Mutational status of TbATl determined by RFLP, SSCP and DNA
sequencing
Patient
Status
RFLP
SSCP
Sequence
STIB 871
F17
F21
F24
F29
F41
F42
F47
F53
F55
F59
R26
R27
R34
R46
R56
R57
R64
R67
*
rel
n.i.
n.i.
rel
rel
rel
n.i.
n.i.
rel
n.i.
rel
rel
rel
rel
rel
rel
rel
rel
mut
wt
mut
mut
wt
wt
wt
mut
mut
wt
mut
mut
mut
mut
mut
wt
mut
mut
mut
mut
wt
mut
mut
wt
wt
wt
mut
mut
wt
mut
mut
mut
mut
mut
wt
mut
mut
mut
mut
wt
mut
mut
wt
wt
wt
mut
mut
wt
mut
mut
mut
mut
mut
wt
mut
mut
mut
Rel, relapse cases; n.i., newly infected cases; mut, mutasnt genotype;
and wt, wild-type genotype (defined by reference stock STIB 777S), as
determined by the respective technique.
* STIB 871 is a T.b. rhodesiense stock recovered from early-stage
patient in southeastern Uganda. It is resistant to dimiazene aceturate
and exhibits reduced melarsoprol sesceptibility in vitro.
with phenol, phenol:chloroform and chloroform, and
DNA was finally precipitated with 2.5 volumes of absolute ethanol. The pellet was washed with 70% ethanol,
briefly air-dried and finally dissolved in TE (10 mM
Tris–HCl, pH 7.8, 0.1 mM EDTA).
DNA from CSF punctates was prepared using a
commercial kit (Puregene DNA isolation kit D-7000A,
Gentra Systems, Minneapolis, MN) following the manufacturer’s instructions with minor modifications.
Briefly, 50 ml of CSF were mixed with 550 ml of cell lysis
solution and proteinase K (100 mg ml − 1), followed by
incubation at 55 °C for 1 h. RNAse (29mg ml − 1) was
then added, and the mixture was incubated at 37 °C
for another 45 min. Protein was then removed by the
addition of 200 ml of protein precipitation solution,
followed by incubation on ice for 5 min. The suspension was centrifuged for 5 min at maximum speed and
the supernatant collected into a sterile Eppendorf tube.
From the supernatant, DNA was precipitated with 600
ml of isopropanol, and the pellet was washed with 70%
ethanol. The dry pellet was finally dissolved in 20 ml of
the DNA hydration solution included in the kit and
was allowed to rehydrate at 65 °C for 1 h.
2.4. Amplification of the adenosine transporter gene
TbAT1 was amplified from genomic DNA by hot
start PCR amplification using two primers located in
75
the 5%- and 3%-untranslated regions of TbAT1, respectively: ant-s (5%-GCCCGGATCCGGCTGGTTTTTAGACAAAAGTGAT-3%,
added
BamHI
site
underlined) and ant-as (5%- GCCCCTCGAGCCGCATGGAGTAAGTCTGA -3%, added XhoI site underlined). In the analysis of CSF samples, this initial PCR
step was followed by a second round of nested PCR
using the respective primer pairs outlined below. For
control PCRs, the actin gene was amplified using
primers act-s (5%-CCGAGTCACACAACGT-3%) and
act-as (5%-CCACCTGCATAACATTG-3%). For mutant
analysis, the open reading frame of TbAT1 was amplified using the primer pair ATF-1 (3%-GAAAGCTTAATCAGAAGGATGCTCGGGTTTGACTCA-3%;
added HindIII site underlined) and ATR-1 (5%-GAGGATCCTGAACAGTATTCGTATGACGATTAGTGCTAC-3%; added BamHI site underlined) (see Fig. 1
for primer localizations). Amplification was done using
Taq polymerase and PCR buffer from Qiagen in a
Perkin-Elmer thermocycler under the following conditions: initial denaturation at 94 °C for 5 min; 30 cycles
of 94 °C for 1 min, 55 °C for 2 min and 72 °C for 2
min. A final extension step was performed at 72 °C for
10 min, followed by rapid cooling to 4 °C.
2.5. SSCP analysis
Nested PCR using a 5 ml aliquot of the PCR product
obtained with primers ATF-1 and ATR-1 was performed to amplify fragments of TbAT1 for SSCP analysis. Suitable fragments for SSCP analysis were
obtained with the following two primer pairs: ATF-2
(5%-CAGATGGTGACGAAGGAAACGG-3%)
and
ATR-3 (5%-GCGAAGTACACGGCAGGGTA-3%); and
ATF-2 (5%-CGCCGCACTCATCGCCCCGTTT-3%) and
Fig. 1. Map of TbAT1 open reading frame and primers used for
PCR. Open box symbolizes the open reading frame of TbAT1 (nucleotides 1 – 1389; GenBank accession number AF152369). PCR primers
are indicated with beginning and ending nucleotides given. Asterisks
indicate the wild-type SfaNI site (n 535) and the mutated SfaNI site
(n 858), respectively. The bar labelled SSCP indicates the PCR
fragment used for SSCP analysis; the bar labelled RFLP indicates the
PCR fragment used for SfaNI RFLP mapping.
76
E. Mato6u et al. / Molecular & Biochemical Parasitology 117 (2001) 73–81
ATR-4 (5%-GGGCGTAAGGGTTCTTCCTTA-3%). All
analyses presented in this work were done with the
PCR product obtained with the primer pair ATF-2 and
ATR-4. For SSCP analysis, 2 ml of the final PCR
product were added to 3 ml of SSCP buffer (95%
formamide, 100 mM NaOH, 0.25% Bromophenol Blue,
0.25% Xylene Cyanol F) and were electophoresed on
12% non-denaturing polyacrylamide gels using a Pharmacia LKP 2117 Multiphor II electrophoretic unit exactly as described previously [15].
2.6. DNA sequencing
For DNA sequence analysis, the entire open reading
frame of TbAT1 was amplified by nested PCR, using
primers ant-s and ant-as for the first round, and ATF-1
and ATR-2 for the second. Three independent amplification reactions were performed for each sample, the
PCR products were pooled, purified (QIAquick kit,
Qiagen, Basel, Switzerland) and outsourced for sequencing to Microsynth (Balgach Switzerland). Sequences were received as chromatographic files and
were manually interpreted by using the SeqEd software
version 1.0.3
2.7. RFLP analysis with SfaNI
A 677 bp fragment of the TbAT1 gene known to
contain an RFLP for SfaNI [13] between the melarsoprol-sensitive stock 777S and its resistant derivative
777R was amplified using primers ATF-2 and ATR-2
(5%-CCACCGCGGTGAGACGTGTA-3%). Amplification was as above, but the annealing temperature was
adjusted to 65 °C. The purified PCR products were
digested for 1 h at 37 °C with Sfa NI (New England
Biolabs), followed by gel electrophoresis on 2% agarose
gels. A 1 kb ladder (GeneRuler, Fermentas, Vilnius,
Lithuania) was used as molecular size marker.
3. Results
3.1. PCR-based detection of TbAT1 in isolated
trypanosomes and in CSF aliquots from newly infected
and relapsing patients
TbAT1 was amplified from the DNA of cultured
melarsoprol-refractory or multidrug-resistant trypanosome stocks, using the primer pair ant-s and ant-as
that flank the open reading frame of TbAT1. As a
positive control, DNAs from the same stocks were also
used as templates for amplification of their actin genes
[21]. The results shown in Fig. 2A demonstrate that a
fragment of the size expected for TbAT1 (1840 bp)
could be amplified from the DNA of the multidrug-resistant field isolate STIB 871 as well as from that of the
Fig. 2. Absence of TbAT1 in a T. brucei stock isolated from a relapse
patient in northern Angola. (A) Ethidium bromide-stained gel showing the PCR products obtained by amplification of TbAT1 gene
(lanes 1, 3 and 5) or the actin gene (lanes 2, 4 and 6). No TbAT1 PCR
product was obtained with DNA from stock K001 (lane 5). Lanes 1
and 2: drug-resistant stock STIB 871; lanes 3 and 4: melarsoprol-sensitive reference stock 777S; lanes 5 and 6: stock K001 from a relapse
patient in northern Angola. M: molecular sizemarker (DNA size
marker X; Roche Molecular Biochemicals). (B, C) Southern blot
hybridization of genomic DNA with probes for TbAT1 (B) and for
actin (C). 777S: melarsoprol-sensitive reference stock 777S, 777R:
melarsoprol-resistant derivative of 777S: 001: stock K001 from a
relapse patient in northern Angola. Restriction enzymes used: E:
EcoRI; P: P6uII.
melarsoprol-sensitive reference stock STIB 777S. In
contrast, no PCR fragment was obtained with DNA of
stock K001, which was recovered from a relapse patient
in northern Angola. From all three DNAs, the actin
gene could be readily amplified. The actin amplification
produced two bands of the predicted molecular sizes of
455 and 1973 bp in stock STIB 871, and three bands
with the predicted sizes of 455 bp, 1973 bp and 3491 bp
in stocks STIB 777S and K001. The sizes of the observed PCR products agree well with those predicted
E. Mato6u et al. / Molecular & Biochemical Parasitology 117 (2001) 73–81
from the sequence of T. brucei actin locus (GenBank
accession number M20310) and with earlier findings
[21] that different trypanosome stocks contain different
numbers of tandemly linked copies of the actin gene. In
order to investigate further whether the absence of
TbAT1 amplification in stock K001 was due to the
complete absence of the gene, or rather due to a minor
mutation in the binding site of one of the primers
utilized, a Southern blot analysis was performed (Fig.
2B). DNAs from the reference stock STIB 777S, from
its Melarsoprol-resistant derivative STIB 777R and
from stock K001 were digested with either EcoRI or
P6uII and hybridized with probes for either TbAT1 or
actin. While the actin probe hybridized to all three
DNAs, no hybridization by the TbAT1 probe was
detected in K001 DNA. This hybridization pattern
confirmed the PCR results and strongly indicated that
stock K001 has lost its entire TbAT1 gene.
3.2. Amplification of TbAT1 from CSF samples
Direct amplification of TbAT1 from DNA extracted
from CSF samples was not sufficiently sensitive due to
the small numbers of parasites found in the CSF. For
nested PCR, 5 ml of the PCR product obtained with
primers ant-s and ant-as were reamplified using the
primer pair ATF-1 and ATR-1, which allowed amplification of the entire open reading frame, or combinations of primers for the selective amplification of
individual gene fragments (see Fig. 1). While nested
PCR was successful with most patient samples, the
method did not produce detectable PCR fragments in
10 out of the 75 isolates analyzed in this study. When
these negative samples were then tested for the presence
of trypanosomes by using a highly sensitive, rDNAbased nested PCR procedure (Geiser and Matovu, unpublished observations), none of them contained
trypanosomes.
77
(Fig. 3). The banding characteristic of the wild type, i.e.
melarsoprol-sensitive stock STIB 777S was seen in 27
(41.5%) of the patients, while the pattern characteristic
of the mutated TbAT1 of stock STIB 777R mutants
was found in 12 patients (18.5%). The third pattern,
which was evident in 26 patients (40%), represented a
composite of the wild type and the mutated patterns,
containing all fragments from both prototype patterns
(Table 1; Fig. 3). When the drug-resistant stock STIB
871 and stock K003 from a relapse patient in northern
Angola were similarly analyzed, both exhibited the
mutant banding pattern (data not shown).
A quantitative analysis of the RFLP data is summarized in Table 1. By the time of writing this manuscript,
43 patients (of a total of 65 analyzed) have relapsed.
Both groups (newly infected and relapse) contain patients with either of the three RFLP patterns. Relapse
patients exhibited significantly more often infections
with trypanosomes with either the mutant or the mixed
SfaNI RFLP than did the newly infected patients
(likelihood ratio  2 = 6.70; d.f.= 1; P=0.0097, twotailed). Also, relapse patients were more often infected
with trypanosomes of the mixed SfaNI RFLP than
were newly infected patients (likelihood ratio  2 =
10.57; d.f.= 1; P=0.0017, two-tailed). While relapse
patients were clearly more often infected by trypanosomes displaying either the mutant or the mixed
SfaNI RFLP, no significant difference was observed
between the infection of either newly infected or relapse
3.3. Sfa NI RFLP analysis
Earlier work on the laboratory-derived Melarsoprolresistant stock STIB 777R had demonstrated that a
SfaNI restriction site present in the wild-type TbAT1
gene had disappeared, while a new site was generated
323 bp further downstream by an independent mutation. A similar RFLP pattern was subsequently observed in a T. b. gambiense isolate from a patient
refractory to melarsoprol treatment [13]. In order to
validate and expand these findings, TbAT1 DNA was
amplified from 65 CSF samples of newly infected or
relapse patients from Omugo, north-western Uganda.
Nested PCR was done with the primer pair ATF-2 and
ATR-2, and the resulting 678 bp fragment (see Fig. 1)
was analyzed by SfaNI digestion. Three different RFLP
banding patterns were obtained with these samples
Fig. 3. SfaNI RFLP of TbAT1 reveals three different banding patterns. A fragment of TbAT1 (nucleotides 430 – 1108) from each patient (totally 65) was subjected to digestion with SfaNI and analyzed
on a 2% agarose gel. Lanes 1 and 2: DNA from cultured melarsoprolsensitive (777S) and -resistant stocks (777R), respectively; lanes 3 –6:
representative samples for the analysis of PCR fragments amplified
from patient CSF (patients F015, R027, R015 and R026). Lanes 1
and 3 represent the RFLP of wild-type TbAT1 ; lanes 2 and 4
represent the RFLP of the mutated TbAT1 present in stock 777R;
lanes 5 and 6 represent a mixed RFLP containing all bands from
both prototype patterns.
78
E. Mato6u et al. / Molecular & Biochemical Parasitology 117 (2001) 73–81
Fig. 4. Detection of mutants in TbAT1 by SSCP. A PCR fragment
(see Fig. 1) of each patient isolate (total of 65) was analyzed by SSCP,
and a representative gel is shown. M: marker; lane 1: STIB777S: lane
2: STIB777R; lanes 3 – 10: CSF isolates from patients F13, F15, F72,
R27, R28, R46, R54 and R56. Lanes 1, 3 and 4 display the wild-type
pattern represented by STIB777S; lanes 2, 5, 6 and 7 display the
mutant pattern represented by STIB777R; lanes 8 –10 display mixed
patterns that contain all wild-type and all mutated bands. Open
arrows: pattern of sensitive wild-type 777S; filled arrows: pattern of
resistant 777R.
patients with trypanosomes displaying pure wild type
or pure mutant SfaNI RFLPs (likelihood ratio x2 =
0.35; d.f.= 1; P=0.56, two-tailed).
3.4. SSCP analysis of TbAT1 mutants from field
isolates
For SSCP analysis, a 235 bp fragment of TbAT1
(nucleotides 430–655, GenBank accession number
AF152369) was amplified from the 65 patient CSF
samples by nested PCR using the primer set ATF-2 and
ATR-4 (see Fig. 1). The same primer set was also used
for amplifying the same fragment from genomic DNA
of the cultured stocks STIB 777S and STIB 777R, and
of stock K003, a field isolate from a relapse patient
from northern Angola. SSCP analysis of the PCR
products revealed three different patterns (Fig. 4). One
pattern corresponded to the TbAT1 wild type, as
defined by the melarsoprol-sensitive reference stock
STIB 777S (Fig. 4, lane 1). A different pattern was
obtained with the fragment from the laboratory-derived
melarsoprol-resistant stock STIB 777R (Fig. 4, lane 2).
This latter pattern was also observed with stock K003,
and with several of the patient samples form northwestern Uganda. A third pattern, which was observed
in several of the patient samples, constituted a mixture
of the two previous patterns. A perfect correlation
between the results of RFLP and SSCP analyses was
observed for all of the 65 samples analyzed (Table 2).
3.5. DNA sequencing
Full-size TbAT1 was amplified and sequenced from
all CSF samples where RFLP and SSCP analyses had
demonstrated the presence of mutations in the gene. In
addition, full-size TbAT1 was also amplified and sequenced from the CSF of all relapse patients, even
when RFLP and SSCP had given wild-type patterns
(Table 2). DNA sequencing of the TbAT1 genes from
all isolates where RFLP/SSCP analyses had indicated a
mutant genotype revealed the presence of nine mutations when compared to the sequence of the reference
stock STIB777S (Fig. 5). Unexpectedly, all 12 sequences analyzed contained the same set of nine mutations (patients F21, F24, F53, F47, F59, R26, R27,
Fig. 5. Position and sequence of mutations are highly conserved between the laboratory-derived melarsoprol-resistant stock STIB 777R and field
isolates. Mutations L71V, A178T, G181E, D239G and N276S are conserved between the laboratory-derived melarsoprol-resistant stock STIB
777R and the various field isolates. The deletion of an entire codon (DF316) is absent in 777R but is present in all field isolates, while L380P is
detected only in 777R. The mucleotide transition G532A eliminates a SfaNI site present in the wild-type sequence, while the transition A857G
generates a new SfaNI site.
E. Mato6u et al. / Molecular & Biochemical Parasitology 117 (2001) 73–81
R34, R46, R57, R64 and R67). The same set of mutations was also detected in the TbAT1 gene of a drug-resistant isolate from south-eastern Uganda (STIB 871).
Eight of the nine of these mutations were also found in
the laboratory-derived Melarsoprol-resistant stock
STIB 777R (Fig. 5). Five of the nine mutations lead to
amino acid substitutions (Leu71Val, Ala178Thr,
Gly181Glu, Asp239Gly and Asn276Ser), while a sixth
mutant represents a deletion of the entire codon for
Phe316. The remaining three mutations are silent (C21T,
T144C and C471T). The laboratory-derived stock STIB
777R contained five of the six expressed mutations, was
lacking the deletion of the Phe316 codon, but contained
an additional expressed mutation Leu380Pro. It also
contained all three silent mutations, plus an additional
one (C501T). DNA sequence analysis of TbAT1 from
the CSF of relapse patients where RFLP/SSCP analyses
had given a wild-type pattern (F17, F29, F41, F42, F55
and R56) fully confirmed the absence of mutations and
demonstrated that they were identical to that of the
reference stock STIB777S.
4. Discussion
Studies on drug resistance in T. b. gambiense are
limited by the fact that this sub-species is difficult to
propagate either in vitro or in the rodent host Mastomys. The PCR technology now allows the analysis of
trypanosome genes in the CSF of patients without the
need for propagation of the parasites. The approach
offers the advantage that genetic analyses can be performed without subjecting the parasites to the selective
pressures inherent in propagation in rodents or in
culture.
In the current study, this concept was applied to the
analysis of the TbAT1 adenosine tranporter of T.b.
gambiense isolates from patients in north-western
Uganda. PCR fragments corresponding to various
parts of the TbAT1 gene were amplified from CSF
samples from newly infected or relapsing patients. The
PCR products were screened for the possible presence
of mutations by RFLP analysis with the restriction
endonuclease SfaNI, and by SSCP. Genes suspected of
containing mutants were then completely sequenced in
order to determine their full mutant load. The results
obtained were compared to the data from STIB 777S, a
prototype melarsoprol-sensitive strain, and STIB 777R,
its melarsoprol-resistant derivative.
Of 75 patient CSF samples analyzed, the TbAT1 gene
could be amplified from 65 (87%). The remaining 10
samples did not contain any trypanosomes, as demonstrated with a highly sensitive rDNA-based PCR assay.
These results demonstrated that in every single case, the
trypanosomes still contained the TbAT1 gene and
demonstrated that deletion of this gene is not a fre-
79
quent cause of melarsoprol resistance. Nevertheless, an
occasional gene loss remains a possibility, since Southern blot analysis of a cultured melarsoprol-refractory
stock (K001) demonstrated the complete absence of
TbAT1. For RFLP analysis, a PCR fragment from
each of the 65 positive samples was analyzed by digestion with SfaNI. Earlier studies [13] had shown that in
the laboratory-derived melarsoprol-resistant stock
STIB 777R, one SfaNI site within TbAT1 is lost, while
a new such site is generated 323 bp further downstream.
SfaNI RFLP analysis demonstrated that each of the 65
DNA fragments analyzed displayed one of three different patterns, (i) a pattern corresponding to the wildtype gene represented by STIB 777S, (ii) a pattern
corresponding to the mutant gene represented by STIB
777R, and (iii) a mixed pattern.
SSCP analysis of a fragment of TbAT1 again allowed
a distinction of three banding patterns, corresponding
to wild-type, mutant and mixed genotypes, respectively.
Every single of the 65 samples behaved identically in
both types of analyses. Transporter genes identified as
containing mutants by RFLP and SSCP analyses were
then completely sequenced. As a control, several
TbAT1 genes from relapse patients that appeared to be
wild-type in RFLP and SSCP analysis were also sequenced, and all of them were identical to that of the
reference TbAT1 sequence. Remarkably, the mutant
genes from the 13 patients with altered SSCP/RFLP
patterns all contained an identical set of nine mutants.
Five of these led to amino acid substitutions, one led to
the deletion of an entire codon, and three were silent
mutations. The identical set of mutants was also found
in a drug-resistant T.b. rhodesiense isolate from southeastern Uganda (STIB 871), and in a T.b. gambiense
isolate from a relapsing patient in northern Angola
(K003). Eight of these nine mutations (plus two additional mutations not found in any of the field isolates)
were also present in TbAT1 of the laboratory-derived
melarsoprol-resistant stock STIB 777R. These observations demonstrate the presence of an identical, complex
set of mutants within TbAT1 of T.b. gambiense amplified from CSF of individual patients from northwestern Uganda, in a T.b. rhodesiense isolate from
south-eastern Uganda, and in a T.b. gambiense isolate
from a relapse patient in Nothern Angola, i.e. in trypanosomes of different species, and from geographical
locations that are hundreds of kilometers apart. In
addition, a very similar set of mutations was also
present in STIB 777R, which was selected in the mouse
for Cymelarsan resistance [17]. In this context, it is
interesting to note that the same SfaNI RFLP pattern
was also detected in several isolates from patients from
T.b. rhodesiense endemic areas of East Africa (R. Brun,
personal communication).
Considering the complexity of the pattern of mutations, and the fact that three of these are silent muta-
80
E. Mato6u et al. / Molecular & Biochemical Parasitology 117 (2001) 73–81
tions, a scenario of drug-induced selection for mutant
TbAT1 genes in each individual patient is unlikely. In
addition, drug-induced selection for loss-of-function
mutants most likely would result in a high proportion
of gene deletions, non-sense mutations and premature
stop codons. However, no such single mutant was
found in this study, and all samples analyzed contained
a full -size TbAT1 open reading frame. Thus, drug-induced selection of mutant transporter genes within
individual patients is an unlikely scenario. A more
likely possibility is the presence of two alleles of TbAT1
that are widely distributed in the population and one of
them conferring increased resistance to melarsoprol.
This view is compatible with the findings by SSCP and
RFLP of three distinct patterns that represent wildtype, mutant and mixed populations of TbAT1 genes.
Current data do not allow the discrimination between
selection of mutant parasites from a mixed population
within the patient and the presence of parasites that are
heterozygous for wild-type and mutant TbAT1. Work
adressing these questions is currently in progress.
A correlation of the clinical status of the patients
(newly infected vs. relapse) with the TbAT1 genotype of
their trypanosomes demonstrated a strong propensity
of relapse patients to harbor parasites with mutant
TbAT1 genes. However, about 30% of the relapse patients analyzed showed a wild-type pattern in RFLP
and SSCP analyses. Follow-up DNA sequencing of a
representative sample of TbAT1 genes from these patients demonstrated that they indeed harbor trypanosomes with wild-type TbAT1. While the
occurrence of a reinfection, rather than relapse from the
treated infection, cannot be excluded with absolute
certainty for all these patients, it is highly unlikely due
to their clinical condition. The observation of a considerable proportion of wild-type TbAT1 among relapse
patients strongly indicates that TbAT1 may contribute
to, but is not the only gene responsible for conferring,
melarsoprol refractoriness. This view corresponds with
ample experimental evidence that trypanosomes isolated from relapse patients after melarsoprol treatment
failure are not necessarily highly resistant to melarsoprol in culture conditions ([7]; R. Brun, personal communications). The pharmacology of melarsoprol is only
beginning to be explored [22,23], and many patient-related variables such as concomitant infections, nutritional status, drug level in the CSF and others may well
contribute to the 3– 9% treatment failure rate that is
considered normal [2,3,23]. However, genetic mechanisms in the parasite may contribute to the marked
increase, over short time spans and in individual regions, of relapse rates to up to 30% [6– 8,24]. Ongoing
experiments to knock out the TbAT1 gene will help to
clarify its role in melarsoprol resistance, and to explore
the role of other genes potentially involved in the
development of this condition.
On a practical note, the demonstrated sensitivity of
SfaNI RFLP and SSCP analysis for the detection of
mutated TbAT1 might be developed into a method of
rapidly screening patients for the presence of trypanosomes with a mutated transporter. This will make
it possible to identify those individuals who will not
benefit from the risky melarsoprol treatment and who
should be considered for treatment with DFMO, where
applicable, or with combination chemotherapy.
Acknowledgements
We are very grateful to Charles Sebikali and Margaret Akol of the Livestock Research Institute at
Tororo, to Cecile Schmid of the Swiss Tropical Institute
in Basel and to the entire staff of MSF France at
Omugo for invaluable help in sample collection. We
would like to thank Christian Burri and Jennifer Keiser
(Swiss Tropical Institute, University of Basel) for their
trypanosome stocks from northern Angola, and
Franziska Ingold (Inselpital, University of Bern) for
help with SSCP.We are also greatly indebted to Claus
Wedekind (University of Edinburgh) for his statistical
analyses. Many thanks also to Reto Brun (Swiss Tropical Institute, University of Basel) for many stimulating
discussions and for providing unpublished results.
This work was supported by grant Nr 3100058927.99 of the Swiss National Science Foundation,
COST program B16, and by the UNDP/World Bank/
WHO Special Programme for Research and Training in
Tropical Diseases grant Nr. 970391. E.M. was the
recipient of WHO Training Grant ID 990028, and P.M.
is the holder of an Human Science Frontiers Program
fellowship.
References
[1] Keiser J, Stich A, Burri C. New drugs for the treatment of
human African trypanosomiasis: research and development.
Trends Parasitol 2001;17:42 – 9.
[2] Doua F, Boa YF. Current therapy of trypanosomiasis. Bull Soc
Pathol Exot 1994;87:337 – 40.
[3] Wang CC. Molecular mechanisms and therapeutic approaches to
the treatment of African trypanosomiasis. Annu Rev Pharmacol
Toxicol 1995;35:93 – 127.
[4] Seebeck T, Naula C, Shalaby T, Gong K. Human sleeping
sickness —current approaches to chemotherapy. Nova Acta
Leopold 1999;307:227 – 41.
[5] Iten M, Matovu E, Brun R, Kaminsky R. Innate lack of
susceptibility of Ugandan Trypanosoma brucei rhodesiense to
DL-a-difluoromethylornithine (DFMO). Trop Med Parasitol
1995;46:190 – 4.
[6] Legros D, Enyaru JCK, Evans S, Paquet C. An outbreak of
relapses among patients treated for Trypanosoma brucei gambiense trypanosomosis in Arua District, Uganda, November 1996
to April 1997. In: Proc. ISCTRC, Maputo, Mozambique. 29
September– 3 October 1997, 1997.
E. Mato6u et al. / Molecular & Biochemical Parasitology 117 (2001) 73–81
[7] Matovu E, Enyaru JCK, Legros D, Schmid C, Seebeck T,
Kaminsky R. Melarsoprol refractory T.b. gambiense from
Omugo, North Western Uganda. Trop Med Int Health
2001;6:407– 11.
[8] Matovu E, Seebeck T, Enyaru JCK, Kaminsky R. Drug resistance in Trypanosoma brucei Ssp, the causative agents of sleeping
sickness in man and nagana in cattle, Microb Infect, in press.
[9] Carter NS, Fairlamb AH. Arsenical-resistant trypanosomes lack
an unusual adenosine transporter. Nature 1993;361:173 – 6.
[10] Barrett MP, Zhang ZQ, Denise H, Giroud C, Baltz T. A
diamidine-resistant Trypanosoma equiperdum clone contains a P2
purine transporter with reduced substrate affinity. Mol Biochem
Parasitol 1995;73:223 – 9.
[11] De Konig HP. Uptake of pentamidine in Trypanosoma brucei
brucei is mediated by three distinct transporters: implications for
cross-resistance with arsenicals. Mol Pharmacol 2001;59:586 – 92.
[12] De Konig HP, Jarvis SM. Adenosine transporters in bloodstream forms of Trypanosoma brucei brucei: substrate recognition motifs and affinity for trypanocidal drugs. Mol Pharmacol
1999;56:1162 – 70.
[13] Mäser P, Sütterlin C, Kralli A, Kaminsky R. A nucleoside
transporter from Trypanosoma brucei involved in drug resistance.
Science 1999;285:242 –4.
[14] Orita M, Suzuki Y, Sekiya T, Hayashi K. Rapid and sensitive
detection of point mutations and DNA polymorphisms using the
polymerase chain reaction. Genomics 1989;5:874 – 9.
[15] Liechti-Gallati S, Schneider V, Neeser D, Kraemer R. Two
buffer PAGE system-based SSCP/HD analysis: a general protocol for rapid and sensitive mutation screening in cystic fibrosis
and any other human genetic disease. Eur J Hum Genet
81
1999;7:590 – 8.
[16] White MB, Carvalho M, Derse D, O’Brien SJ, Dean M. Detecting single base substitutions as heteroduplex polymorphisms.
Genomics 1992;12:301 – 6.
[17] Pospichal H, Brun R, Kaminsky R, Jenni L. Induction of
resistance to melarsen oxide cysteamine (Mel Cy) in Trypanosoma brucei brucei. Acta Trop 1994;58:187 – 97.
[18] Matovu E, Iten M, Enyaru JCK, Schmid C, Lubega GW, Brun
R, Kaminsky R. Susceptibility of Ugandan Trypanosoma brucei
rhodesiense isolated from man and animal reservoirs to diminazene, isometamidium and melarsoprol. Trop Med Int Health
1997;2:13 – 8.
[19] Aerts D, Truc P, Penchier L, Claes Y, LeRay D. A kit for in
vitro isolation of trypanosomes in the field: first trial with
sleeping sickness patients in the Congo Republic. Trans R Soc
Trop Med Hyg 1992;86:394 – 5.
[20] Brun R, Schoenenberger M. Cultivation and in vitro cloning of
procyclic culture forms of Trypanosoma brucei in a semi-defined
medium. Acta Trop 1979;36:289 –92.
[21] BenAmar MF, Pays A, Tebabi P, Dero B, Seebeck T, Steinert
M, Pays E. Structure and transcription of the actin gene of
Trypanosoma brucei. Mol Cell Biol 1988;8:2166 – 76.
[22] Keiser J, Erisscon O, Burri C. Investigations of the metabolites
of the trypanocidal drug melarsoprol. Clin Pharmacol Ther
2000;67:478 – 88.
[23] Oyango JD, Burri C, Brun R. An automated biological assay to
determine levels of the trypanocidal drug melarsoprol in biological fluids. Acta Trop 2000;74:95 – 100.
[24] Pepin J, Milord F. The treatment of human African trypanosomiasis. Adv Parasitol 1994;33:1 – 47.
EUKARYOTIC CELL, Oct. 2003, p. 1003–1008
1535-9778/03/$08.00⫹0 DOI: 10.1128/EC.2.5.1003–1008.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
Vol. 2, No. 5
Mechanisms of Arsenical and Diamidine Uptake and Resistance in
Trypanosoma brucei
Enock Matovu,1† Mhairi L. Stewart,2 Federico Geiser,1 Reto Brun,3 Pascal Mäser,1
Lynsey J. M. Wallace,2 Richard J. Burchmore,2 John C. K. Enyaru,4 Michael P. Barrett,2
Ronald Kaminsky,5 Thomas Seebeck,1 and Harry P. de Koning2*
Institute of Cell Biology, CH-3012 Bern,1 Swiss Tropical Institute, CH-4002 Basel,3 and Novartis Animal Health,
CH-1566 St. Aubin,5 Switzerland; Institute of Biomedical and Life Sciences, University of Glasgow,
Glasgow G12 8QQ, United Kingdom2; and Livestock Health Research Institute, Tororo, Uganda4
Received 24 April 2003/Accepted 17 July 2003
Sleeping sickness, caused by Trypanosoma brucei spp., has become resurgent in sub-Saharan Africa. Moreover, there is an alarming increase in treatment failures with melarsoprol, the principal agent used against
late-stage sleeping sickness. In T. brucei, the uptake of melarsoprol as well as diamidines is thought to be
mediated by the P2 aminopurine transporter, and loss of P2 function has been implicated in resistance to these
agents. The trypanosomal gene TbAT1 has been found to encode a P2-type transporter when expressed in yeast.
Here we investigate the role of TbAT1 in drug uptake and drug resistance in T. brucei by genetic knockout of
TbAT1. Tbat1-null trypanosomes were deficient in P2-type adenosine transport and lacked adenosine-sensitive
transport of pentamidine and melaminophenyl arsenicals. However, the null mutants were only slightly
resistant to melaminophenyl arsenicals and pentamidine, while resistance to other diamidines such as diminazene was more pronounced. Nevertheless, the reduction in drug sensitivity might be of clinical significance,
since mice infected with tbat1-null trypanosomes could not be cured with 2 mg of melarsoprol/kg of body weight
for four consecutive days, whereas mice infected with the parental line were all cured by using this protocol.
Two additional pentamidine transporters, HAPT1 and LAPT1, were still present in the null mutant, and
evidence is presented that HAPT1 may be responsible for the residual uptake of melaminophenyl arsenicals.
High-level arsenical resistance therefore appears to involve the loss of more than one transporter.
adenosine transport in Saccharomyces cerevisiae expressing
TbAT1 was not inhibited by pentamidine (19). The situation is
further complicated by the fact that nucleoside transporters
comprise a multigene family in T. brucei (28). Thus, a model
whereby the loss of a single transporter (TbAT1) could mediate cross-resistance to all diamidines and melamine-based arsenicals appears overly simplistic.
Meanwhile, the problem of drug resistance in T. brucei appears to be increasing in the field. Sleeping sickness has recently become resurgent in sub-Saharan Africa, and the emergence of drug resistance is hindering efforts to control the disease.
Melarsoprol treatment failures have reached alarming levels in
several foci (4). In addition, resistance to the diamidine diminazene aceturate has also been reported from multiple foci (17, 23).
Pentamidine resistance, in contrast, has so far not been reported
from the field. The understanding of resistance mechanisms in
bloodstream-form trypanosomes is crucial to circumventing existing resistance problems and avoiding the emergence of resistance
to the next generation of drugs.
To investigate whether TbAT1 alone contributes to P2 activity in Trypanosoma brucei brucei, we have constructed a
TbAT1 knockout clone by targeted gene replacement. We have
further used this null mutant to resolve the role of TbAT1 in
the uptake of, and resistance to, the diamidine and melaminophenyl arsenical classes of drugs.
Sleeping sickness is caused by Trypanosoma brucei, and the
disease is endemic throughout tropical Africa. Sleeping sickness is fatal if untreated, and vaccination is impossible due to
antigenic variation of the parasites. The main chemotherapeutics for treatment of sleeping sickness are still the melaminophenyl arsenical melarsoprol and the diamidine pentamidine,
drugs that were introduced more than 50 years ago. Crossresistance between melamine-based arsenicals and diamidines
has been repeatedly observed in trypanosomes with laboratoryinduced drug resistance (14–16, 24, 26). Cellular uptake of
both classes of trypanocide has been shown to occur via the P2
adenosine/adenine transport activity in T. brucei bloodstream
forms, and loss of P2 has been implicated in drug resistance (5,
6). Subsequently, a trypanosome gene (TbAT1) that exhibited
P2-like transport activity when expressed in yeast was cloned
(19). The function of TbAT1 in trypanosomes, however, remained to be investigated.
No clear correlation was found between mutations in TbAT1
and relapses after melarsoprol treatment in sleeping sickness
patients in Uganda (22), and T. brucei isolated from melarsoprol-refractory patients did not show high levels of in vitro
arsenical resistance (4, 21). [3H]pentamidine transport in T.
brucei was only partially blocked by adenosine (5, 7, 11), and
* Corresponding author. Mailing address: Institute of Biomedical
and Life Sciences, Division of Infection and Immunity, Joseph Black
Building, University of Glasgow, Glasgow G12 8QQ, United Kingdom.
Phone and fax: 44-141-3303753. E-mail: [email protected].
† Present address: Livestock Health Research Institute, Tororo,
Uganda.
MATERIALS AND METHODS
Propagation of trypanosomes. Bloodstream-form T. brucei brucei strain 427
(s427; also known as MiTat 1.2/221 or BS 221) parasites were used to construct
the TbAT1⫺/⫺ line. They were cultured in minimal essential medium modified
1003
1004
MATOVU ET AL.
according to the work of Baltz et al. (1), supplemented with 5% fetal bovine
serum. For transport experiments, adult female Wistar rats were infected by
intraperitoneal injection. At peak parasitemia, blood was collected by cardiac
puncture under terminal anesthesia. The parasites were isolated by using a DE52
(Whatman, Maidstone, United Kingdom) anion-exchange column (18) and
washed twice in assay buffer (33 mM HEPES, 98 mM NaCl, 4.6 mM KCl, 0.55
mM CaCl2, 0.07 mM MgSO4, 5.8 mM NaH2PO4, 0.3 mM MgCl2, 23 mM
NaHCO3, 14 mM glucose [pH 7.3]).
Constructs for the TbAT1 gene deletion. TbAT1 alleles were replaced sequentially with resistance markers for the antibiotics neomycin and puromycin. Flanking sequences upstream (700 bp) and downstream (300 bp) of the TbAT1 open
reading frame were amplified by PCR and cloned into plasmids so that they
flanked NEO or PAC genes. The resulting deletion constructs were released from
plasmid DNA by restriction digestion, purified by phenol extraction, and resuspended to 0.2 ␮g/␮l in water.
Transfection of trypanosomes. Bloodstream-form trypanosomes (s427) were
cultured to a density of 2 ⫻ 106 ml⫺1. A total of 108 cells were washed in 15 ml
of ZMG buffer (132 mM NaCl, 8 mM KCl, 8 mM Na2HPO4, 1.5 mM KH2PO4,
0.775 mM magnesium acetate, 0.063 mM calcium acetate [pH 7.5]) and resuspended in 450 ␮l of ZMG and 50 ␮l of deletion construct DNA solution. The cell
suspension was electroporated by using a Bio-Rad Genepulser at 1.5 kV, 25 ␮F,
and 200 ⍀F and was transferred to culture medium. Drug selection was applied
after 24 h, and trypanosomes were cloned in vitro after 7 days of selection.
Neomycin (1.5 ␮g/ml) was used for the first-round knockout, and neomycin plus
puromycin (0.15 ␮g/ml) was used for the second-round knockout.
Southern blotting. Genomic DNAs of the wild-type s427, two first-round
knockout clones, and two second-round derivatives of each were digested with
EcoRI and NdeI. Southern blotting was performed by standard protocols. TbAT1
and neomycin and puromycin resistance genes were labeled by using the DIG
system (Roche Diagnostics, Basel, Switzerland).
Transport assays. Transport assays for [3H]adenosine (NEN) and [3H]pentamidine (Amersham) were performed exactly as described previously (7, 31) by
using a rapid oil stop protocol. Briefly, trypanosomes were harvested, washed
twice with the assay buffer, and resuspended at 108 cells/ml. Cells were then
incubated with the radioligand in the presence or absence of a competitive
inhibitor and were spun through oil (for 30 s at 12,000 ⫻ g) after a predetermined
time as indicated in Results. Radioactivity in the cell pellet was determined, after
solubilization in 2% sodium dodecyl sulfate, by liquid scintillation counting.
In vitro drug sensitivity assays. In vitro drug sensitivity was determined by
using the Alamar Blue assay (25). Trypanosomes (104) were exposed to doubling
dilutions of drugs for 2 days at 37°C before Alamar Blue reagent (Bio-Source,
Camarillo, Calif.) was added. After a further 24 h of incubation, fluorescence was
determined in a fluorimeter (Perkin-Elmer LS55B). Fifty percent inhibitory
concentrations (IC50) were determined by nonlinear regression using the Prism
(GraphPad) software package. For in vitro lysis assays (14), trypanosomes were
exposed to 10 ␮M melarsen oxide or cymelarsan in the presence or absence of
potential inhibitors of drug uptake. Lysis was monitored spectrophotometrically
by determination of absorbance at 750 nm at 60-s intervals.
In vivo experiments. Twenty-eight NMRI outbred mice (young adults, female,
weighing around 25 g) were inoculated intraperitoneally with 105 trypanosomes.
Seven groups of four mice each were infected as follows: groups A, D, and G
received wild-type s427, groups B and E received knockout clone 12, and groups
C and F received knockout clone 21. Three days postinfection, all mice showed
strong parasitemia and were treated with melarsoprol at 2 mg kg of body
weight⫺1 (groups A, B, and C) or 10 mg kg⫺1 (groups D, E, and F) for four
consecutive days. Group G comprised untreated controls. Melarsoprol (3.6%
solution in propylene glycol) was diluted with phosphate-buffered saline to 60
and 300 ␮g/100 ␮l, and mice were treated by intraperitoneal injection of 100 ␮l
for the 2- and 10-mg kg⫺1 doses, respectively. The mice were monitored twice a
week for parasitemia by examination of smears of tail blood.
Data analysis. All experiments were performed in triplicate or more. Kinetic
data, given as means and standard errors, were determined in at least three
independent experiments and calculated by nonlinear regression using the Prism
(GraphPad) software package from a minimum of 8 points over the relevant
range. All uptake data are presented as “mediated uptake,” defined as total
uptake minus diffusion. Diffusion is taken to be uptake in the presence of
saturating concentrations of unlabeled permeant.
RESULTS
Construction of tbat1-null mutants. The TbAT1 gene was
replaced in two steps, by sequential transformation of T. b.
EUKARYOT. CELL
brucei s427 bloodstream forms with constructs containing the
neomycin and puromycin resistance markers. To investigate
whether the constructs had correctly integrated and replaced
TbAT1, genomic DNAs from several first- and second-round
antibiotic-resistant transformant clones, as well as from the
parental wild-type trypanosomes, were analyzed by Southern
blotting. Hybridization with probes for TbAT1 or resistance
marker genes revealed heterozygous and homozygous tbat1null clones as expected (data not shown).
The tbat1⫺/⫺ trypanosomes did not exhibit any obvious differences in morphology or motility from the wild-type parent
strain s427. The population doubling time in culture was not
significantly different, remaining at around 8 h for both strains.
tbat1⫺/⫺ trypanosomes remained fully infective to mice (data
not shown). Thus, TbAT1 is not essential for cell survival,
cell-cycle progression, or the course of infection in rodents,
presumably because of the presence of additional purine transporters in bloodstream-form trypanosomes (6, 9, 10, 13).
Adenosine transport in tbat1-null mutants. T. b. brucei
bloodstream forms possess two adenosine transporter activities, P1 and P2, which are selectively inhibited by inosine and
adenine, respectively (6, 10). The underlying genes encoding
each activity have not been determined conclusively so far. In
tbat1-null trypanosomes, uptake of 0.1 ␮M [3H]adenosine was
completely inhibited by inosine (Fig. 1), with an IC50 of 0.74 ⫾
0.09 ␮M, very similar to values reported previously for the P1
activity (6, 10, 12). In contrast, as much as 100 ␮M adenine
failed to inhibit [3H]adenosine transport (Fig. 1). This result
indicates that the P2 adenosine transport activity has been
completely deleted in the tbat1-null mutant, as adenosine
transport mediated by P2 has been shown to be sensitive to
adenine with a Ki of ⬃0.2 ␮M (6, 10).
Pentamidine transport in tbat1-null mutants. [3H]pentamidine transport in tbat1-null bloodstream forms was not inhibited by as much as 1 mM adenosine (Fig. 2). This is in marked
contrast with transport in wild-type T. b. brucei, where an
adenosine-sensitive pentamidine transporter (ASPT1) is responsible for about 50% of total pentamidine uptake (7, 11).
The absence of an adenosine-sensitive pentamidine flux in the
tbat1-null mutants clearly demonstrates that TbAT1 encodes
the previously described ASPT1 activity (7, 11). The reported
failure of pentamidine to inhibit adenosine uptake by TbAT1
expressed in yeast (19, 20) raises the question as to whether
auxiliary factors, present in the trypanosome plasma membrane, are required to confer diamidine transport by TbAT1.
Increasing concentrations of unlabeled pentamidine inhibited uptake of 15 nM [3H]pentamidine in a biphasic manner
(Fig. 2), revealing the presence of a high-affinity and a lowaffinity component of pentamidine transport, termed HAPT1
and LAPT1, respectively (7). At 15 nM, [3H]pentamidine
transport by HAPT1 and LAPT1 in tbat1-null trypanosomes
was inhibited by unlabeled pentamidine, with IC50 of 29 ⫾ 8
nM and 50 ⫾ 17 ␮M (n ⫽ 3), respectively, consistent with
values reported previously for wild-type trypanosomes (7, 11).
HAPT1 and LAPT1 can be further distinguished by the fact
that only HAPT1 is inhibited by propamidine (7). Propamidine
inhibited the high-affinity uptake of [3H]pentamidine in tbat1null trypanosomes with an IC50 of 13 ⫾ 3 ␮M (n ⫽ 4) (Fig. 2)
but had no effect on the low-affinity uptake phase.
VOL. 2, 2003
MECHANISMS OF DRUG RESISTANCE IN TRYPANOSOMES
1005
FIG. 1. Uptake of [3H]adenosine by the tbat1-null mutant. Uptake of 20 nM [3H]adenosine was inhibited by inosine (filled squares) with an IC50
of 1.1 ⫾ 0.1 ␮M. Adenine failed to inhibit [3H]adenosine at concentrations as high as 100 ␮M when it was added alone (open squares). The
inhibition induced by 1 mM adenine is attributable to a low-affinity inhibition of P1.
Drug resistance profiles of tbat1-null mutants. In order to
test the hypothesis that loss of TbAT1 causes drug resistance,
tbat1-null and wild type trypanosomes were cultured in vitro in
the presence of serial dilutions of trypanocidal diamidines and
melaminophenyl arsenicals. The assays for both strains were
performed in parallel in order to minimize the influence of
interassay variation. As summarized in Table 1, tbat1-null mutants indeed showed decreased drug sensitivity. Resistance to
melaminophenyl arsenicals (melarsoprol, melarsen oxide,
cymelarsan), however, was consistently only two- to threefold
relative to the s427 parent strain. Pentamidine resistance was
in the same range. In contrast, tbat1-null mutants showed
markedly higher levels of resistance to stilbamidine, propamidine, and in particular diminazene aceturate (Berenil).
The low levels of resistance to melarsoprol in the null mutant were confirmed in vivo. Mice infected with s427 were all
cured after treatment with 2 or 10 mg of melarsoprol/kg for
four consecutive days. In contrast, all mice infected with one of
FIG. 2. Uptake of [3H]pentamidine by the tbat1-null mutant. The uptake of 15 nM [3H]pentamidine was unaffected by as much as 1 mM
adenosine (filled circles) but was inhibited to a maximum of 64% by propamidine (open squares), with an IC50 of 6.5 ␮M. When increasing amounts
of unlabeled pentamidine (filled squares) were added, [3H]pentamidine uptake was inhibited in a biphasic manner (P ⬍ 0.0001 by the F test), with
the high-affinity component (IC50 ⫽ 25.1 nM) contributing 62% of total [3H] pentamidine transport. The IC50 of the low-affinity component was
19.5 ␮M for this experiment.
1006
MATOVU ET AL.
EUKARYOT. CELL
TABLE 1. Drug resistance phenotype of the tbat1-null mutant
compared to the parental wild-type strain
Drug
Melarsoprol
Melarsen oxide
Cymelarsan
Pentamidine
Diminazene
Propamidine
Stilbamidine
IC50a (ng/ml)
Wild type
TbAT1⫺/⫺ mutant
Resistance
factor
21 ⫾ 3
3.7 ⫾ 0.1
6.1 ⫾ 1
5.1 ⫾ 2
120 ⫾ 30
67 ⫾ 7
680 ⫾ 70
49 ⫾ 9
11 ⫾ 0.1
12 ⫾ 3
12 ⫾ 3
2,300 ⫾ 500
750 ⫾ 20
5,000 ⫾ 1,300
2.3
3.0
2.0
2.4
19
11
7.4
a
IC50 were determined in vitro by using the Alamar Blue assay. Values are
means from at least three independent experiments ⫾ standard errors.
the two knockout clones relapsed after treatment with 2 mg of
melarsoprol/kg and died due to parasitemia by day 20 posttreatment. The 10-mg/kg dosage of melarsoprol still effectively
cured mice infected with tbat1-null trypanosomes.
Additional pathways for arsenical uptake. The comparably
small reduction of melarsoprol sensitivity in tbat1-null trypanosomes suggests the presence of further, TbAT1-independent
pathways for drug uptake. Transport of melaminophenyl arsenicals cannot be studied directly for lack of a radiotracer, but
the lytic effect of these compounds on trypanosomes in vitro
can serve as a bioassay for arsenical uptake (14, 29, 33). Treatment with 10 ␮M melarsen oxide or cymelarsan induced rapid
lysis of wild-type s427 bloodstream forms, with onset typically
occurring at 15 to 30 min and complete lysis within 1 h (Fig.
3a). Simultaneous incubation with adenosine, adenine, or pentamidine prevented lysis, while inosine, guanosine or hypoxanthine had no effect (Fig. 3a and data not shown). For the
tbat1-null mutant, however, the onset of melaminophenyl arsenical-induced lysis was significantly delayed (typically to 4 h)
and lysis was much slower (Fig. 3b). This is consistent with
TbAT1 representing the transporter responsible for the fast
component of melaminophenyl arsenical uptake.
Adenosine and other purines had no effect on the slow lysis
of tbat1-null cells by melaminophenyl arsenicals (data not
shown), but lysis was fully prevented by diamidines, most potently by pentamidine. Fifty percent effective concentrations
were 30 nM for pentamidine, 300 nM for propamidine, and
approximately 10 ␮M for stilbamidine (Fig. 3b). To investigate
whether this counteracting effect of diamidines was caused by
competition for a common transporter or occurred at the site
of arsenical action, phenylarsine oxide was used as an arsenical
trypanocide that diffuses rapidly across the cell membrane and
therefore does not rely on transporters for its trypanocidal
action (6, 29). Treatment of tbat1-null mutants with 0.5 ␮M
phenylarsine oxide caused rapid lysis (Fig. 3c, trace b). Neither
adenosine (10 mM), hypoxanthine (4 mM), pentamidine, stilbamidine, nor propamidine (the last three at 100 ␮M) prevented lysis; only a very high concentration of pentamidine (1
mM) did have some effect (Fig. 3c). The most likely explanation for the counteracting effects of diamidines on the slow
cymelarsan-induced lysis of tbat1-null trypanosomes is therefore the inhibition of a transport mechanism. Furthermore,
this transporter is likely to be HAPT1, as half-maximal diamidine concentrations for inhibition of cymelarsan-induced lysis
correlate well with Ki values of the respective diamidines for
HAPT1 (7). The observation that melarsen oxide exhibits low
affinity for HAPT1 (IC50, ⬃250 ␮M [data not shown]) is consistent with this hypothesis.
DISCUSSION
Since Carter and Fairlamb showed that adenosine and adenine protect T. b. brucei from melarsen-induced lysis in vitro
(6), several studies have pointed to a role for the P2 transport
FIG. 3. In vitro sensitivities of bloodstream-form trypanosomes to arsenical trypanocides. (a) Wild-type T. b. brucei s427 parasites were incubated with
or without 10 ␮M melarsen oxide in the presence of potential inhibitors. Traces: a, control (no arsenical); b, melarsen oxide only; c, melarsen oxide plus
4 mM adenosine; d, melarsen oxide plus 1 mM pentamidine; e, melarsen oxide plus 4 mM hypoxanthine. (b) Cells of the tbat1-null mutant were incubated
with or without 10 ␮M cymelarsan. Traces: a, control (no arsenical); b, cymelarsan only; c, cymelarsan plus 0.1 ␮M pentamidine; d, cymelarsan plus 0.03
␮M pentamidine; e, cymelarsan plus 0.01 ␮M pentamidine; f, cymelarsan plus 10 ␮M stilbamidine; g, cymelarsan plus 1 ␮M propamidine; h, cymelarsan
plus 0.3 ␮M propamidine; i, cymelarsan plus 0.1 ␮M propamidine. (c) Cells of the tbat1-null mutant were incubated with or without 0.5 ␮M phenylarsine
oxide. Traces: a, control (no arsenical); b, phenylarsine oxide only; c, phenylarsine oxide plus 10 mM adenosine; d, phenylarsine oxide plus 4 mM
hypoxanthine; e, phenylarsine oxide plus 1 mM pentamidine; f, phenylarsine oxide plus 100 ␮M pentamidine; g, phenylarsine oxide plus 100 ␮M
propamidine; h, phenylarsine oxide plus 100 ␮M stilbamidine. Arrow indicates time of phenylarsine oxide addition.
VOL. 2, 2003
MECHANISMS OF DRUG RESISTANCE IN TRYPANOSOMES
activity in the resistance of African trypanosomes to both melaminophenyl arsenicals and diamidines (2, 5, 27, 29, 30). A T.
b. brucei gene, TbAT1, was found to encode an adenine-sensitive adenosine transporter when expressed in yeast (19), but
formal proof that TbAT1 encodes the P2 activity in trypanosomes has awaited the gene deletion study presented here. The
total absence of P2-type transport in tbat1-null bloodstreamform trypanosomes proves that TbAT1 is the P2 transporter.
We found that loss of TbAT1 did indeed reduce the sensitivity
of trypanosomes to melaminophenyl arsenicals, but only by
factors of 2 to 3 (Table 1). However, even such a limited loss
of sensitivity could be significant in a clinical setting, since the
drug levels in the cerebrospinal fluid of melarsoprol-treated
patients are at the threshold of those needed to kill trypanosomes (reviewed in reference (8)). A small reduction in drug
sensitivity could therefore lead to survival of some parasites in
the central nervous system or other extravascular sites and
cause clinical relapse in an increased percentage of patients.
This model is in agreement with the lack of high-level arsenical
resistance in clinical isolates from melarsoprol-refractory patients (4, 21).
The P2 transporter, when analyzed in trypanosomes, displays high affinity for several trypanocidal diamidines, including pentamidine, as judged by their ability to inhibit adenosine
uptake (2, 5, 7, 10). [3H]pentamidine transport, however, was
only partially blocked by adenosine in T. brucei (5). Here we
show that adenosine-sensitive pentamidine transport (ASPT1)
is completely lost in tbat1-null trypanosomes. Nevertheless,
tbat1-null trypanosomes are only about twofold more resistant
to pentamidine than wild-type trypanosomes, while resistance
to other diamidines such as diminazene is much more pronounced. This can be explained by the presence of two additional, adenosine-insensitive transporters specific for pentamidine: the high-affinity pentamidine transporter HAPT1 and
the low-affinity pentamidine transporter LAPT1 (7). We show
here that both activities are retained in the tbat1-null mutants.
The veterinary trypanocide diminazene, though structurally
related to pentamidine, is not an effective substrate for HAPT1
or LAPT1 (7, 11) and may not enter trypanosomes, to an
appreciable extent, by routes other than TbAT1. This may
explain why trypanosomes have not developed resistance to
pentamidine in the field while resistance to diminazene is
much more common (17, 23), although both drugs have been
used extensively over several decades (3, 32).
Some laboratory strains of T. brucei, selected for arsenical
resistance by prolonged exposure to subcurative doses, have
been shown to be deficient in P2 activity, but, unlike the tbat1null trypanosomes, exhibit high levels of resistance to melaminophenyl arsenicals (14, 29). This indicates that besides
loss of TbAT1, further events are required for high-level arsenical resistance. At least part of this is likely to occur at the
level of plasma membrane transport, as the in vitro lysis assays
showed that the tbat1-null trypanosomes remained fully sensitive to phenylarsine oxide, which is lipophilic and diffuses
across membranes without the need for transporters (6, 29).
This arsenical contains the same trivalent toxophore as melarsen oxide, differing only in the presence of an extra melamine haptophore in the latter arsenical at the para position of
the phenyl ring. It is therefore probable that the cause for
high-level melaminophenyl arsenical resistance, like that for
1007
low-level resistance, is associated with the uptake of the drug
over the plasma membrane. The in vitro lysis assays with tbat1null trypanosomes also revealed a slow, adenosine-insensitive
uptake of melaminophenyl arsenicals. Inhibitor analysis indicated that this transporter could be HAPT1. These data need
to be interpreted with some caution, since the possibility that
these diamidines inhibit an additional transport mechanism
with affinities similar to those they exhibit for HAPT1 cannot
be discounted. In this scenario, pentamidine might well be an
inhibitor rather than a permeant for any such putative transport protein for melaminophenyl arsenicals, as there is currently no evidence of pentamidine transporters in addition to
HAPT1, LAPT1, and TbAT1 (7, 11). However, if HAPT1 and
TbAT1 do both mediate cellular uptake of melaminophenyl
arsenicals, loss of both may be necessary for high-level drug
resistance.
In conclusion, genetic knockout of TbAT1 in T. b. brucei
bloodstream forms revealed a major role for TbAT1 in the
uptake of clinically important trypanocides. Loss of TbAT1
activity appears to cause loss of sensitivity to melaminophenyl
arsenicals and diamidines and is an obligatory component of
high-level resistance. Tbat1-null trypanosomes further allowed
the characterization and possible identification of additional
drug transport activities. The exploitation of alternative pathways for drug uptake will be crucial for the development of
new-generation trypanocides that do not share cross-resistance
with P2 substrates.
ACKNOWLEDGMENTS
This work was supported by grant 3100-058927.99 from the Swiss
National Science Foundation, grant C00.0042 from COST program
B16, the BBSRC (17/C13486), grant 970391 from the UNDP/World
Bank/WHO Special Programme for Research and Training in Tropical
Diseases, and the Wellcome Trust. E.M. was the recipient of WHO
Training Grant ID 990028, and P.M. is the holder of a Human Frontiers fellowship.
REFERENCES
1. Baltz, T., D. Baltz, C. Giroud, and J. Crockett. 1985. Cultivation in a semidefined medium of animal infective forms of Trypanosoma brucei, T. equiperdum, T. evansi, T. rhodesiense and T. gambiense. EMBO J. 4:1273–1277.
2. Barrett, M. P., Z. Q. Zhang, H. Denise, C. Giroud, and T. Baltz. 1995. A
diamidine-resistant Trypanosoma equiperdum clone contains a P2 purine
transporter with reduced substrate affinity. Mol. Biochem. Parasitol. 73:223–
229.
3. Bray, P. G., M. P. Barett, S. A. Ward, and H. P. de Koning. 2003. Pentamidine uptake and resistance in pathogenic protozoa: past, present and future.
Trends Parasitol. 19:232–239.
4. Brun, R., R. Schumacher, C. Schmid, C. Kunz, and C. Burri. 2001. The
phenomenon of treatment failures in human African trypanosomiasis. Trop.
Med. Int. Health 6:906–914.
5. Carter, N. S., B. J. Berger, and A. H. Fairlamb. 1995. Uptake of diamidine
drugs by the P2 nucleoside transporter in melarsen-sensitive and -resistant
Trypanosoma brucei brucei. J. Biol. Chem. 270:28153–28157.
6. Carter, N. S., and A. H. Fairlamb. 1993. Arsenical-resistant trypanosomes
lack an unusual adenosine transporter. Nature 361:173–175.
7. De Koning, H. P. 2001. Uptake of pentamidine in Trypanosoma brucei is
mediated by three distinct transporters: implications for cross-resistance with
arsenicals. Mol. Pharmacol. 59:586–592.
8. De Koning, H. P. 2001. Transporters in African trypanosomes: role in drug
action and resistance. Int. J. Parasitol. 31:512–522.
9. De Koning, H. P., and S. M. Jarvis. 1997. Purine nucleobase transport in
bloodstream forms of Trypanosoma brucei brucei is mediated by two novel
transporters. Mol. Biochem. Parasitol. 89:245–258.
10. De Koning, H. P., and S. M. Jarvis. 1999. Adenosine transporters in bloodstream forms of Trypanosoma brucei brucei: substrate recognition motifs and
affinity for trypanocidal drugs. Mol. Pharmacol. 56:1162–1170.
11. De Koning, H. P., and S. M. Jarvis. 2001. Uptake of pentamidine in Trypanosoma brucei brucei is mediated by the P2 adenosine transporter and at least
one novel, unrelated transporter. Acta Trop. 80:245–250.
1008
MATOVU ET AL.
12. De Koning, H. P., C. J. Watson, and S. M. Jarvis. 1998. Characterization of
a nucleoside/proton symporter in procyclic Trypanosoma brucei brucei.
J. Biol. Chem. 273:9486–9494.
13. De Koning, H. P., C. J. Watson, L. Sutcliffe, and S. M. Jarvis. 2000. Differential regulation of nucleoside and nucleobase transporters in Crithidia fasciculata and Trypanosoma brucei brucei. Mol. Biochem. Parasitol. 106:93–
107.
14. Fairlamb, A. H., N. S. Carter, M. Cunningham, and K. Smith. 1992. Characterisation of melarsen-resistant Trypanosoma brucei brucei with respect to
cross-resistance to other drugs and trypanothione metabolism. Mol. Biochem. Parasitol. 53:213–222.
15. Frommel, T. O., and A. E. Balber. 1987. Flow cytofluorimetric analysis of
drug accumulation by multidrug-resistant Trypanosoma brucei brucei and T.
b. rhodesiense. Mol. Biochem. Parasitol. 26:183–192.
16. Fulton, J. D., and P. T. Grant. 1955. The preparation of a strain of Trypanosoma rhodesiense resistant to stilbamidine and some observations on its
nature. Exp. Parasitol. 4:377–388.
17. Geerts, S., P. H. Holmes, O. Diall, and M. C. Eisler. 2001. African bovine
trypanosomiasis: the problem of drug resistance. Trends Parasitol. 17:25–28.
18. Lanham, S. M. 1968. Separation of trypanosomes from the blood of infected
rats and mice by anion-exchangers. Nature 218:1273–1274.
19. Mäser, P., C. Sütterlin, A. Kralli, and R. Kaminsky. 1999. A nucleoside
transporter from Trypanosoma brucei involved in drug resistance. Science
285:242–244.
20. Mäser, P., D. Vogel, C. Schmid, B. Räz, and R. Kaminsky. 2001. Identification and characterization of trypanocides by functional expression of an
adenosine transporter from Trypanosoma brucei in yeast. J. Mol. Med. 97:
121–127.
21. Matovu, E., J. C. Enyaru, D. Legros, C. Schmid, T. Seebeck, and R. Kaminsky. 2001. Melarsoprol refractory T. b. gambiense from Omugo, north-western Uganda. Trop. Med. Int. Health 6:407–411.
22. Matovu, E., F. Geiser, V. Schneider, P. Mäser, J. C. K. Enyaru, R. Kaminsky,
S. Gallati, and T. Seebeck. 2001. Genetic variants of the TbAT1 adenosine
transporter from African trypanosomes in relapse infections following melarsoprol therapy. Mol. Biochem. Parasitol. 117:73–81.
EUKARYOT. CELL
23. Matovu, E., T. Seebeck, J. C. Enyaru, and R. Kaminsky. 2001. Drug resistance in Trypanosoma brucei spp., the causative agents of sleeping sickness in
man and nagana in cattle. Microbes Infect. 3:763–770.
24. Pospichal, H., R. Brun, R. Kaminsky, and L. Jenni. 1994. Induction of
resistance to melarsenoxide cysteamine (Mel Cy) in Trypanosoma brucei
brucei. Acta Trop. 58:187–197.
25. Räz, B., M. Iten, Y. Grether-Bühler, R. Kaminsky, and R. Brun. 1997. The
Alamar Blue assay to determine drug sensitivity of African trypanosomes in
vitro. Acta Trop. 68:139–147.
26. Rollo, I. M., and J. Williamson. 1951. Acquired resistance to ‘melarsen’,
tryparsamide and amidines in pathogenic trypanosomes after treatment with
⬘melarsen’ alone. Nature 167:147–148.
27. Ross, C. A., and A. M. Barns. 1996. Alteration to one of three adenosine
transporters is associated with resistance to Cymelarsan in Trypanosoma
evansi. Parasitol. Res. 82:183–188.
28. Sanchez, M., R. Tryon, J. Green, I. Boor, and S. Landfear. 2002. Six related
nucleoside/nucleobase transporters from Trypanosoma brucei exhibit distinct
biochemical functions. J. Biol. Chem. 277:21499–21504.
29. Scott, A. G., A. Tait, and C. M. R. Turner. 1997. Trypanosoma brucei: lack of
cross-resistance to melarsoprol in vitro by cymelarsan-resistant parasites.
Exp. Parasitol. 86:181–190.
30. Suswam, E. A., D. W. Taylor, C. A. Ross, and R. J. Martin. 2001. Changes in
properties of adenosine transporters in Trypanosoma evansi and modes of
selection of resistance to the melaminophenyl arsenical drug, Mel Cy. Vet.
Parasitol. 102:193–208.
31. Wallace, L. J. M., D. Candlish, and H. P. de Koning. 2002. Different substrate recognition motifs of human and trypanosome nucleobase transporters: selective uptake of purine antimetabolites. J. Biol. Chem. 277:26149–
26156.
32. Williamson, J. 1970. Review of chemotherapeutic and chemoprophylactic
agents, p. 125–221. In H. W. Mulligan (ed.), The African trypanosomiases.
George Allen and Unwin Ltd., London, United Kingdom.
33. Yarlett, N., B. Goldberg, H. C. Nathan, J. Garofalo, and C. J. Bacchi. 1991.
Differential sensitivity of Trypanosoma brucei rhodesiense isolates to in vitro
lysis by arsenicals. Exp. Parasitol. 72:205–215.
79
Molecular pharmacology of adenosine transport in
Trypanosoma brucei: P1/P2 revisited
1
1
Federico Geiser , Alexandra Lüscher , Thomas Seebeck and Pascal Mäser
Institute of Cell Biology
University of Bern
Switzerland
80
Running title:
T. brucei adenosine transporters
Corresponding author:
name:
Pascal Mäser
address:
Institute of Cell Biology
Baltzerstrasse 4
CH-3012 Bern
Switzerland
Number of:
tel.
+41 31 631 4673
fax
+41 31 631 4684
e-mail
[email protected]
text pages
tables
1
figures
6
references
Abbreviations:
27
32
words in Abstract
237
words in Introduction
618
words in Discussion
784
No non-standard abbreviations are used.
81
Abstract
Trypanosoma brucei spp. are unicellular parasites that cause sleeping sickness in humans
and nagana in livestock. Trypanosomes salvage purines from their hosts through a variety of
transporters, of which adenosine permeases deserve particular attention due to their role in
drug sensitivity. T. brucei possess two distinct adenosine transport systems, P1 and P2, the
latter of which also mediates cellular uptake of the drugs melarsoprol and pentamidine. Loss
or mutation of P2 has been associated with drug resistance and sleeping sickness treatment
failures. However, genetic disruption in T. b. brucei of the gene encoding P2, TbAT1, reduced
the susceptibility to melarsoprol and pentamidine only by a factor of about two. Here we show
stronger phenotypes of the tbat1 null mutant with respect to its sensitivity towards toxic
+/+
adenosine analogs. Compared to parental TbAT1
-/-
trypanosomes, the tbat1 mutant is 77-
fold less sensitive to tubercidin and 14-fold less sensitive to cordycepin. Resistance is further
-/-
increased by the addition of inosine, but reverted by adenine. Surprisingly, the tbat1 mutant
grows faster than TbAT1
+/+
trypanosomes and it overexpresses genes of the TbNT cluster
encoding P1-type transporters. These unexpected phenotypes show that there are conditions
other than drug pressure, under which loss of P2 may confer a selective advantage to
bloodstream-form trypanosomes. Overexpression of P1 by trypanosomes after loss of P2
indicates that combinatorial chemotherapy with trypanocidal P1 and P2 substrates may be a
promising strategy to prevent drug resistance in sleeping sickness.
82
Introduction
Human African sleeping sickness is re-emerging in sub-Saharan Africa. The WHO
estimates an annual incidence of 400’000, and from certain villages in Angola, the Democratic
Republic of Congo, or southern Sudan a prevalence of up to 50% has been reported (Kioy et
al., 2004). Sleeping sickness is caused by Trypanosoma brucei gambiense and T. b.
rhodesiense, protozoan parasites which are transmitted by the tsetse fly (Glossina spp.). T.
brucei spp. evade the mammalian immune system by antigenic variation of their surface
glycoproteins and proliferate extracellularly in the blood. In the late stage of the disease the
parasites invade the central nervous system, ultimately causing death of the patient. Since
there is no perspective for a vaccine, treatment of sleeping sickness relies entirely on
chemotherapy. Suramin (introduced 1916) and the diamidine pentamidine (1937) are used for
the early stage, melarsoprol (1949) and eflornithine (1977) for the late stage of the disease
due to their blood-brain barrier permeability. Eflornithine is expensive and mainly used to treat
patients who relapse from melarsoprol therapy. In addition, it is effective only against West
African but not against East African sleeping sickness. Melarsoprol, a melamine-based
trivalent arsenical, is still the drug of choice for treatment of late-stage sleeping sickness.
However, melarsoprol treatment failure rates of 25 to 30% have been reported from Uganda
(Legros et al., 1999) and northern Angola (Stanghellini and Josenando, 2001), possibly
indicating the spread of drug-resistant trypanosomes.
Molecular mechanisms of drug resistance in T. brucei have mainly been studied in
laboratory strains selected at suboptimal drug concentrations. Adenosine permeases turned
out to play an important role in the uptake of, and resistance to, trypanocides. Carter and
Fairlamb differentiated two types of adenosine transporter systems, P1 and P2 (Carter and
Fairlamb, 1993). P1 was shown to be a broad-specificity purine transporter, while P2
transports only adenine and adenosine (Table 1). Interestingly however, P2 transports also
melarsen-based drugs and diamidines (Carter et al., 1995). P2-type adenosine transport was
found to be absent or impaired in drug-resistant trypanosomes (Carter and Fairlamb, 1993;
Barrett et al., 1995).
83
P1 is encoded by multiple genes of the TbNT family (Table 1). The genes TbNT2 to
TbNT7 cluster on a single locus. TbNT2, TbNT5, TbNT6, and TbNT7 exhibited P1-type
substrate specificities when expressed in Xenopus laevis oocytes, while no substrate has
been identified for TbNT3 and TbNT4 so far (Sanchez et al., 2002). P2 is apparently encoded
by a single gene, TbAT1 (Mäser et al., 1999; Matovu et al., 2003). Trypanosomes selected for
melarsoprol resistance harbored point-mutations in TbAT1 that abolished function (Mäser et
al., 1999). Surprisingly, identical point mutations were found in T. b. gambiense field isolates
(Mäser et al., 1999; Matovu et al., 2001a), and the occurrence of such mutations correlated to
some degree with melarsoprol treatment failure (Matovu et al., 2001b).
Recently, a T. b. brucei tbat1 null mutant was generated by homozygous replacement of
the gene (Matovu et al., 2003). tbat1
-/-
trypanosomes had no detectable P2 activity. They
exhibited reduced sensitivity towards melarsen-based arsenicals as well as diamidines, albeit
with resistance factors of only about two to three (Matovu et al., 2003). However, the tbat1
null mutant was 20-fold resistant to the veterinary drug diminazene (Matovu et al., 2003; de
Koning et al., 2004a). Melamine-based nitrofurans designed to be P2 substrates were not, or
+/+
only marginally more toxic to TbAT1
-/-
than to tbat1 trypanosomes (Stewart et al., 2004).
Here we characterize tbat1 null trypanosomes with respect to their sensitivity towards
adenosine antimetabolites, re-evaluating the P1/P2 model and its implications for
antitrypanosomal chemotherapy. Surprising phenotypes regarding cell growth and drug
resistance reveal relationships between transport, salvage, and toxicity of adenosine analogs,
and they indicate a possible interplay between P1 and P2 purine uptake systems.
84
Materials and Methods
Cultivation of trypanosomes
All experiments were performed with bloodstream-form trypanosomes. T. b. brucei strain BS
-/-
221 (synonymous for MiTat 1.2/221 or s427) and its tbat1 derivative (Matovu et al., 2003)
were cultured at 37 °C in a humidified atmosphere of 5% CO2 in HMI-9 medium (BioConcept,
Allschwil, Switzerland) containing 10% heat-inactivated fetal bovine serum (BioConcept),
supplemented according to (Hirumi and Hirumi, 1989) plus 36 mM NaHCO3 and 100 IU/ml
penicillin/streptomycin (BioConcept). Population doubling times were measured in Minimum
Essential Medium (MEM, Life Technologies) supplemented with MEM nonessential amino
acids, Earle's salts (Life Technologies), 10% heat-inactivated horse serum (slaughterhouse,
Basel, Switzerland), 25 mM HEPES, 5.6 mM glucose, 26 mM NaHCO3, 0.2 mM 2mercaptoethanol, 2 mM sodium pyruvate, and 0.1 mM hypoxanthine (Baltz et al., 1985).
In vitro drug sensitivity assays
Trypanosomal drug sensitivity was determined with the redox-activated fluorescent dye
3
Alamar-Blue as described (Räz et al., 1997). Briefly, trypanosomes (10 /well) were cultivated
in 96-well plates for 70 h in the presence of serial dilutions of compounds. After this growth
period 10 µl of Alamar-Blue reagent (Bio-Source, Camarillo CA) were added to each well, and
after a further 2 h of incubation fluorescence was measured (Spectramax Gemini fluorimeter,
Molecular Devices Corp., excitation at 536 nm, emission at 588 nm). All assays were
performed at least three times, each in triplicate. IC50 were determined by nonlinear
regression to sigmoid dose-response parameters using the Prism4 (GraphPad) software
package. All chemicals were purchased from Fluka Chemie GmbH (Buochs, Switzerland).
85
Gene expression analyses
Total RNA was isolated from cultured trypanosomes by extraction with hot phenol (95 °C, pH
4.5) and chloroform, followed by ethanol precipitation. After DNase treatment (DNA-away,
Ambion Biotech), cDNA was synthesized from 1 µg RNA with AMV reverse transcriptase
(Roche) and T16 primer in a volume of 15 µl. PCR was performed with Taq polymerase
(Qiagen) on 3 µl of cDNA. Negative controls lacking reverse transcriptase were always
included. For amplification of TbNT subgroup genes, a forward primer specific to the 5'
spliced leader sequence (cgctattattagaacagtttctgtac), which all T. brucei mRNAs have in
common, was combined with the primer Actin_rev (ccacctgcataacattg) and one of the
following: NT2-7_rev (gcrgcaagagagcgttgac), NTII_rev (agggcagaacaaaaatgaagc), NTIII_rev
(gcaatccgctttcaaatcg), or NTIV_rev (tgtaatggtctcttgaacaggt). Gene-specific primers were
NT4_rev (tttacatcaaagtcacacactgtt) and NT6_rev (tagtatcgcctgtcttcgc). Genes of the TbNT2TbNT7 cluster were amplified with the primers NT2-7_fw (ggatgtcggtgatgaatgtgacg) and NT27_rev. PCR products (200 ng) were purified (QIAquick PCR purification kit, Qiagen) and
sequenced directly at the CMPG facility, Zoological Institute Bern.
Phylogenetic analysis
Predicted protein sequences were obtained from the T. brucei genome database at
www.genedb.org (TbNT2, Tb927.2.6150; TbNT3, Tb927.2.6200; TbNT4, Tb927.2.6220;
TbNT5, Tb927.2.6240; TbNT6, Tb927.2.6320; TbNT7, Tb927.2.6280; TbNT8.1,
Tb11.02.1100) and from GenBank (TbAT1, AAD45278; HsENT1, Q99808). ClustalX
(Thompson et al., 1994) was used for multiple alignment and bootstrap analysis, TreeView
(Page, 1996) to display the dendrogram.
86
Results
Susceptibility of bloodstream form trypanosomes to purine analogs
The sensitivity of T. b. brucei 221 bloodstream forms to purine analogs was determined in
vitro using the redox-sensitive fluorophore Alamar blue as an indicator of cell viability (Räz et
al., 1997). The two adenosine antimetabolites tubercidin (7-deazaadenosine; Fig. 1) and
cordycepin (3'-deoxyadenosine; Fig. 1) are known trypanocides (Drew et al., 2003;
Williamson, 1972), and indeed both compounds were highly active with IC50 values of 15 nM
(Fig. 1). In contrast, 2',3'-dideoxyadenosine was much less potent with an IC50 of 48 µM (Fig.
1), and the IC50 of 2',3'-dideoxyinosine was above 50 µM (not shown). Interestingly, 3'deoxyadenosine and 2',3'-dideoxyadenosine were about equally active on amastigote forms
of Trypanosoma cruzi (Nakajima-Shimada et al., 1996). The reason why 3'-deoxyadenosine
was over 1000-fold more toxic to T. b. brucei bloodstream forms than 2',3'-dideoxyadenosine
probably lies in trypanosomal purine salvage rather than transport, e. g. different substrate
specificities of adenosine kinase and deoxyadenosine kinase (Drabikowska et al., 1985).
Genetic disruption of TbAT1 causes resistance to purine analogs
The same set of sensitivity tests were carried out with tbat1 knock-out trypanosomes in
order to investigate the role of P2 in cellular uptake of these purine analogs. Again,
dideoxyadenosine (Fig. 1) and dideoxyinosine (not shown) were hardly active, and they did
+/+
not show a difference in toxicity between TbAT1
tbat1
-/-
-/-
and tbat1 trypanosomes. However, the
mutant was 77-fold more resistant to tubercidin and 14-fold more resistant to
cordycepin (Fig. 1). This demonstrates that both tubercidin and cordycepin are taken up to a
substantial part via TbAT1 in wild-type trypanosomes. To test whether residual uptake in the
-/-
tbat1 mutant occurs via P1-type adenosine transporters, the sensitivity tests were repeated
in the presence of excess amounts of known P1 and P2 substrates.
87
Effects of physiological purines on sensitivity to adenosine antimetabolites
Adenosine is a substrate of both transport activities P1 and P2, whereas inosine is
+/+
imported exclusively by P1 and adenine only by P2 (Table 1). In "wild-type", TbAT1
trypanosomes, supplementation of the medium with 1 mM adenosine or 1 mM inosine caused
a four- to five-fold reduction of tubercidin susceptibility (Fig. 2a). Addition of 1 mM adenine
had a much stronger effect, rendering trypanosomes 220-fold less susceptible to tubercidin
(Fig. 2a). Effects of excess purines on cordycepin toxicity were less dramatic. Addition of
adenosine hardly had an effect, and inosine, if anything, sensitized trypanosomes towards
cordycepin (Fig. 2b). Again, excess adenine exerted the most pronounced reduction of
sensitivity, increasing the IC50 of cordycepin by a factor of 6 (Fig. 2b).
-/-
The same set of experiments was carried out with the tbat1
null mutant. Again,
resistance to tubercidin was further increased upon addition of adenosine or inosine (Fig. 2a),
presumably by blocking P1-mediated uptake. Excess adenine, as expected, did not further
-/-
increase the resistance of tbat1 trypanosomes, since adenine is not a P1 substrate (Table
1). Surprisingly, however, adenine even re-sensitized the resistant tbat1
-/-
strain towards
adenosine antimetabolites (Fig. 2a). A similar pattern was observed for cordycepin. Addition
-/-
of excess inosine further increased the resistance of tbat1 trypanosomes, adenosine only
had little effect, and adenine rendered the null mutant hypersensitive to cordycepin (Fig. 2b).
The data are summarized in Fig. 2c. Addition of excess adenosine reduced the sensitivity
-/-
to adenosine analogs of the tbat1 mutant and parental TbAT1
+/+
trypanosomes to a similar
-/-
extent, leaving the resistance factor R unchanged (R equals IC50 of tbat1 divided by IC50 of
+/+
TbAT1 ). The same effect was observed for inosine regarding tubercidin toxicity. With
-/-
cordycepin, however, excess inosine reduced the susceptibility more strongly in tbat1 than
in wild-type trypanosomes. Thus, the resistance factor to cordycepin increased to 130-fold in
the presence of inosine, reaching the level of R for tubercidin. This finding is in agreement
with the P1/P2 model, and it indicates that P1 also contributes to cordycepin uptake. A
puzzling effect was exerted by the P2 substrate adenine which reverted the tbat1
-/-
phenotype, re-sensitizing null mutant trypanosomes towards both tubercidin and cordycepin
+/+
(Fig. 2c). This effect was not observed with TbAT1
trypanosomes, where addition of excess
adenine – as expected (Table 1) – reduced the sensitivity towards adenosine analogs. As a
88
consequence, tbat1
-/-
mutants were more sensitive to tubercidin and cordycepin than wild-
type trypanosomes in the presence of 1 mM adenine. In addition, excess adenine sloweddown the growth of T. brucei bloodstream forms already in the absence of drugs (data not
shown). This phenomenon was observed for parental as well as for tbat1
-/-
mutant
trypanosomes.
tbat1-/- trypanosomes grow faster than their parental strain
-/-
The tbat1 mutant had not shown any growth defect (Matovu et al., 2003), as might be
expected given (i) the large number of purine transporters encoded in the genome of T. brucei
(Mäser et al., 2003) and (ii) the fact that the purine source in standard culture medium is
hypoxanthine and not adenosine (Baltz et al., 1985). Surprisingly, however, we observed here
-/-
+/+
that tbat1 trypanosomes grew even faster than their TbAT1
parents. To quantify growth,
-/-
tbat1 and its parental strain were propagated in vitro and the population doubling times were
calculated from linear regression of the log-transformed growth curves. Under all conditions
tested, tbat1 null trypanosomes grew slightly but reproducibly faster than their parental strain
(Fig. 3). The difference was more pronounced at limiting serum concentrations; at 5%, the
-/-
population doubling times were 13.3 ± 3.6 h for wildtype and 10.8 ± 2.3 h for tbat1
trypanosomes (p = 0.012 for significant difference in a two-tailed t-test).
Expression analysis of trypanosomal ENT genes
To investigate eventual secondary effects of TbAT1 disruption, we measured expression
+/+
levels of other trypanosomal nucleoside transporter genes in parental TbAT1
and in tbat1
-/-
bloodstream form trypanosomes. Fig. 4a shows members of the equilibrative nucleoside
transporter family from T. brucei (the ENT family; Pfam PF01733, TC 2.A.57). More
trypanosomal ENT genes are emerging as the genome sequencing initiative approaches
completion. As apparent from the phylogenetic analysis, the majority of trypanosomal
nucleoside transporters cluster into different subgroups (Fig. 4a; see also Table 1).
Expression levels of each subgroup were measured in a semi-quantitative way, by performing
89
reverse-transcriptase (RT) PCR in the presence of a forward primer of the T. brucei spliced
mRNA leader sequence (Walder et al., 1986) and two different reverse primers, one specific
for actin and one for the ENT group of interest. These latter primers were chosen from
perfectly conserved regions within the respective genes in order to amplify all members of a
particular group. For one singleton gene, Tb09.160.5480, expression was not detectable. For
two subgroups, III and IV, expression was confirmed but did not vary between parental and
-/-
tbat1 trypanosomes (Fig. 4b). The large subgroup I, however, was expressed more strongly
in tbat1
-/-
trypanosomes than in their parents as determined by comparison to the internal
actin control (Fig. 4b). This finding was confirmed by three independent RT-PCR experiments
and also by Northern blot analysis (data not shown). The six genes in this group, TbNT2 to
TbNT7, are all located within 9 kb on chromosome 2 of T. brucei (Sanchez et al., 2002).
TbNT2, TbNT5, TbNT6, and TbNT7 are P1-type transporters of slightly varying substrate
specificities, the substrates of TbNT3 and TbNT4 are unknown (Sanchez et al., 2002).
Expression analysis within the TbNT gene cluster
Expression of individual genes within the TbNT cluster on chromosome 2 was again
investigated by RT-PCR. mRNA isolated from T. brucei bloodstream forms was reversetranscribed and amplified by PCR as described above. The resulting products were then
sequenced directly, in order to avoid eventual bias introduced by cloning. Single nucleotide
polymorphisms became apparent in the electropherogram of the sequencing products
terminated with fluorescent dideoxynucleotides. This method was highly reproducible and
allowed distinction between individual TbNT genes (Fig. 5). Of the five genes in the TbNT
cluster, TbNT2 appeared to be predominantly expressed as apparent from positions where it
differs from the rest. Expression of TbNT3, TbNT4, TbNT5, and TbNT7, on the other hand,
+/+
was not detectable (Fig. 5). Overall expression patterns were highly similar in TbAT1
and in
-/-
tbat1 trypanosomes. However, the signal strength of TbNT4 and TbNT6 relative to the other
-/-
genes in the cluster appeared to be higher in the tbat1 mutant, as indicated from positions
were they differ in sequence (Fig. 5). We therefore investigated expression of TbNT4 and
90
TbNT6 by semi-quantitative RT-PCR using gene-specific primers. As shown in Figure 6, the
-/-
two genes were indeed overexpressed in the tbat1 mutant.
91
Discussion
The P1/P2 model for uptake of adenosine and antitrypanosomal drugs in T. brucei was
proposed based on phenotypic observations without knowledge of the underlying genes
(Carter and Fairlamb, 1993). A number of adenosine transporters have since been cloned
from T. brucei and functionally characterized (Sanchez et al., 1999; Mäser et al., 1999;
Sanchez et al., 2002; Sanchez et al., 2004). All of them also transported either adenine or
inosine (Table 1); hence, the P1/P2 model still holds. Here we used a T. brucei mutant
homozygously disrupted in the adenosine transporter gene TbAT1 to further validate the
P1/P2 model. One prediction is that P2 null trypanosomes should be resistant to melarsoprol
but not to adenosine analogs (since of all trypanosomal adenosine transporters only P2 is
permeable to melarsoprol). Surprisingly however, the opposite was observed for tbat1
-/-
trypanosomes: They were markedly resistant to the adenosine antimetabolites tubercidin (77fold more; Fig. 1) and cordycepin (14-fold more; Fig. 1), while their susceptibility to
melarsoprol only decreased by a factor of two to three (Matovu et al., 2003). The mild
phenotype towards melarsoprol can be explained by the presence of adenosine-independent
import pathways (Matovu et al., 2003), the nature of which is unknown. The strong phenotype
towards tubercidin and cordycepin indicates that among the comparably large number of
adenosine transporters in T. brucei (Table 1), TbAT1 constitutes the principal route of import
for these adenosine analogs. This is further illustrated by the finding that of the physiological
purines tested, adenine exerted the maximal protection of wild-type trypanosomes from
-/-
tubercidin or cordycepin (Fig. 2). At the same time, adenine re-sensitized tbat1 mutants to
adenosine antimetabolites, which led to the paradoxical situation that in the presence of
adenine, tbat1
+/+
TbAT1
-/-
mutants were more sensitive to tubercidin and cordycepin than parental
trypanosomes (Fig. 2c). This surprising effect cannot be explained by the P1/P2
model; we are currently investigating the physiological effects of excess adenine to growth of
T. brucei.
P1-mediated import of tubercidin and cordycepin only became relevant in the absence of
TbAT1, indicated by the fact that the alleviating effect of excess inosine on toxicity of the
-/-
adenosine analogs was much stronger for tbat1 than for TbAT1
+/+
trypanosomes (Fig. 2a
92
and 2b). In the presence of 1 mM inosine, tbat1 null cells were 130-fold resistant to tubercidin
and 112-fold to cordycepin (Fig. 2c). Thus the surprising drug resistance phenotype of tbat1
-/-
trypanosomes is, at least in part, explainable by different affinities of P1- and P2-type
transporters towards adenosine analogs. This is in agreement with measurements of
3
transport kinetics of [ H]adenosine, where Ki values for adenosine analogs differed
substantially between experiments performed in the presence of excess adenine to block P2,
or excess inosine to block P1 (de Koning and Jarvis, 1999). This study, carried out before the
cloning of trypanosomal adenosine transporters, already indicated that tubercidin (Ki of 78
µM) and cordycepin (Ki of 210 µM) are not high-affinity P1 substrates (de Koning and Jarvis,
1999).
-/-
A second reason for the stronger effect inosine had in the tbat1 mutant compared to wildtype in decreasing the susceptibility to adenosine analogs, could be the fact that tbat1
-/-
trypanosomes overexpressed genes of the TbNT cluster (Fig. 4). TbNT4 and particularly
-/-
+/+
TbNT6 showed higher mRNA levels in tbat1 than in TbAT1
trypanosomes (Fig. 6). While
TbNT6 is a P1-type adenosine permease as determined by functional expression in Xenopus
oocytes, no substrate was identified for TbNT4 (Sanchez et al., 2002). The finding that
deletion of one trypanosomal ENT may lead to overexpression of other members of the same
family complicates the assessment of individual transporters' contributions to drug
susceptibility by molecular genetics. Whether overexpression of TbNT genes also occurs in
P2 loss-of-function T. brucei spp. field isolates remains to be investigated. If so, this might be
exploited for drug targeting towards melarsoprol-resistant trypanosomes.
A further unexpected finding was that tbat1
+/+
TbAT1
-/-
trypanosomes grew faster than parental
cells at limiting serum concentrations (Fig. 3). Whether this was a consequence of
overexpression of TbNT genes can at present only be speculated. The finding that tbat1
+/+
trypanosomes grew faster than their TbAT1
-/-
parents indicates that there are conditions
other than chemotherapy where loss of P2 confers a selective advantage to bloodstream-form
trypanosomes. This may have implications for the stability of drug resistance in the absence
of drug pressure, which is remarkably high for African trypanosomes. In summary, the P1/P2
model is still valid but received some new twists. In particular, P1 and P2 may be functionally
linked such that overexpression of the former compensates for lack of the latter. If this also
93
happens in field isolates, combination of trypanocidal P1 and P2 substrates will be a good
strategy towards drug cocktails of minimal propensity for resistance by loss of import.
94
Acknowledgments
We are grateful to Pinar Önal and Erwin Studer for technical assistance, and to Reto Brun for
help with cultivation of trypanosomes.
95
References
Baltz T, Baltz D, Giroud C and Crockett J (1985) Cultivation in a semi-defined
medium of animal infective forms of Trypanosoma brucei, T. equiperdum, T.
evansi, T. rhodesiense and T. gambiense. EMBO J 4:1273-1277.
Barrett MP, Zhang ZQ, Denise H, Giroud C and Baltz T (1995) A diamidineresistant Trypanosoma equiperdum clone contains a P2 purine transporter with
reduced substrate affinity. Mol. Biochem. Parasitol. 73:223-229.
Burchmore RJ, Wallace LJ, Candlish D, Al-Salabi MI, Beal PR, Barrett MP,
Baldwin SA and de Koning HP (2003) Cloning, heterologous expression,
and in situ characterization of the first high affinity nucleobase transporter
from a protozoan. J Biol Chem 278:23502-7.
Carter NS, Berger BJ and Fairlamb AH (1995) Uptake of diamidine drugs by the
P2 nucleoside transporter in melarsen-sensitive and -resistant Trypanosoma
brucei brucei. J. Biol. Chem. 270:28153-28157.
Carter NS and Fairlamb AH (1993) Arsenical-resistant trypanosomes lack an
unusual adenosine transporter. Nature 361:173-175.
de Koning HP, Anderson LF, Stewart M, Burchmore RJ, Wallace LJ and Barrett
MP (2004a) The trypanocide diminazene aceturate is accumulated
predominantly through the TbAT1 purine transporter: additional insights
on diamidine resistance in African trypanosomes. Antimicrob Agents Chemother
48:1515-9.
de Koning HP, Anderson LF, Stewart M, Burchmore RJS, Wallace LJM and
Barrett MP (2004b) The trypanocide diminazene aceturate is accumulated
predominantly through the TbAT1 purine transporter: Additional insights
on diamidine resistance in African trypanosomes. Antimicrob Agents Chemother
48:1515-1519.
de Koning HP and Jarvis SM (1997) Purine nucleobase transport in bloodstream
forms of Trypanosoma brucei brucei is mediated by two novel transporters.
Mol. Biochem. Parasitol. 89:245-258.
de Koning HP and Jarvis SM (1999) Adenosine Transporters in Bloodstream
Forms of Trypanosoma brucei brucei: Substrate Recognition Motifs and
Affinity for Trypanocidal Drugs. Mol Pharmacol 56:1162-1170.
Drabikowska AK, Halec L and Shugar D (1985) Purification and properties of
adenosine kinase from rat liver: separation from deoxyadenosine kinase
activity. Z Naturforsch 40:34-41.
Drew ME, Morris JC, Wang Z, Wells L, Sanchez M, Landfear SM and Englund
PT (2003) The adenosine analog tubercidin inhibits glycolysis in
Trypanosoma brucei as revealed by an RNA interference library. J Biol
Chem 278:46596-600.
Henriques C, Sanchez MA, Tryon R and Landfear SM (2003) Molecular and
functional characterization of the first nucleobase transporter gene from
African trypanosomes. Mol Biochem Parasitol 130:101-10.
Hirumi H and Hirumi K (1989) Continuous cultivation of Trypanosoma brucei
blood stream forms in a medium containing a low concentration of serum
protein without feeder cell layers. J Parasitol 75:985-9.
Kioy D, Jannin J and Mattock N (2004) Focus: Human African trypanosomiasis.
Nature Rev Microbiol 2:186-187.
96
Legros D, Evans S, Maiso F, Enyaru JC and Mbulamberi D (1999) Risk factors
for treatment failure after melarsoprol for Trypanosoma brucei gambiense
trypanosomiasis in Uganda. Trans R Soc Trop Med Hyg 93:439-42.
Mäser P, Lüscher A and Kaminsky R (2003) Drug transport and drug resistance in
African trypanosomes. Drug Resist Updat 6:281-90.
Mäser P, Sütterlin C, Kralli A and Kaminsky R (1999) A nucleoside transporter
from Trypanosoma brucei involved in drug resistance. Science 285:242-4.
Mäser P, Vogel D, Schmid C, Räz B and Kaminsky R (2001) Identification and
characterization of trypanocides by functional expression of an adenosine
transporter from Trypanosoma brucei in yeast. J Mol Med 97:121-127.
Matovu E, Enyaru JC, Legros D, Schmid C, Seebeck T and Kaminsky R (2001a)
Melarsoprol refractory T. b. gambiense from Omugo, north-western
Uganda. Trop Med Int Health 6:407-11.
Matovu E, Geiser F, Schneider V, Mäser P, Enyaru JCK, Kaminsky R, Gallati S
and Seebeck T (2001b) Genetic variants of the TbAT1 adenosine transporter
from African trypanosomes in relapse infections following melarsoprol
therapy. Mol Biochem Parasitol 117:73-81.
Matovu E, Stewart ML, Geiser F, Brun R, Mäser P, Wallace LJ, Burchmore RJ,
Enyaru JC, Barrett MP, Kaminsky R, Seebeck T and de Koning HP
(2003) The mechanisms of arsenical and diamidine uptake and resistance in
Trypanosoma brucei. Euk Cell 2:1003-1008.
Nakajima-Shimada J, Hirota Y and Aoki T (1996) Inhibition of Trypanosoma
cruzi growth in mammalian cells by purine and pyrimidine analogs.
Antimicrob Agents Chemother 40:2455-8.
Page RD (1996) TreeView: an application to display phylogenetic trees on personal
computers. Comput Appl Biosci 12:357-8.
Räz B, Iten M, Grether-Bühler Y, Kaminsky R and Brun R (1997) The Alamar
Blue assay to determine drug sensitivity of African trypanosomes in vitro.
Acta Trop 68:139-147.
Sanchez M, Drutman S, van Ampting M, Matthews KR and Landfear SM (2004)
A novel purine nucleoside transporter whose expression is up-regulated in
the short stumpy form of the Trypanosoma brucei life cycle. Mol Biochem
Parasitol 136:265-272.
Sanchez M, Tryon R, Green J, Boor I and Landfear S (2002) Six related
nucleoside/nucleobase transporters from Trypanosoma brucei exhibit
distinct biochemical functions. J Biol Chem 277:21499-21504.
Sanchez MA, Ullman B, Landfear SM and Carter NS (1999) Cloning and
functional expression of a gene encoding a P1 type nucleoside transporter
from Trypanosoma brucei. J Biol Chem 274:30244-9.
Stanghellini A and Josenando T (2001) The situation of sleeping sickness in
Angola: a calamity. Trop Med Int Health 6:330-4.
Stewart ML, Bueno GJ, Baliani A, Klenke B, Brun R, Brock JM, Gilbert IH and
Barrett MP (2004) Trypanocidal activity of melamine-based
nitroheterocycles. Antimicrob Agents Chemother 48:1733-8.
Thompson JD, Higgins DG and Gibson TJ (1994) CLUSTAL W: improving the
sensitivity of progressive multiple sequence alignment through sequence
weighting, position-specific gap penalties and weight matrix choice. Nucleic
Acids Res 22:4673-80.
Walder JA, Eder PS, Engman DM, Brentano ST, Walder RY, Knutzon DS,
Dorfman DM and Donelson JE (1986) The 35-nucleotide spliced leader
97
sequence is common to all trypanosome messenger RNA's. Science 233:56971.
Williamson J (1972) Further experiments with the nucleoside trypanocide,
cordycepin. Trans R Soc Trop Med Hyg 66:354-5.
98
Footnotes
This work was supported by the Swiss National Science Foundation (SNF professorship grant
#631-066150 to P.M., SNF research grant #3100-067225 to T.S.) and COST-B16 project
#C00.0042 (to T.S.).
Reprint request should be made to P.M.
1
Both authors contributed equally.
99
Tables, figures and legends
100
Table 1 Pharmacological characteristics of trypanosomal adenosine transport systems.
Genes
P1
P2
Refs.
TbNT2, TbNT5, TbNT6,
TbAT1
1-4
adenosine, inosine,
adenine, adenosine, 2'-
5, 6
guanosine, 2'-
deoxyadenosine
TbNT7, TbNT10
Substrates
a) Physiological
deoxyadenosine, 2'deoxyinosine
b) Purine analogs
formycin A, formycin B
tubercidin, cordycepin
6, 7, this
work
c) Trypanocides
melarsoprol, pentamidine,
5, 8, 9
diminazene
Inhibitors
flavone, silibinin
both are insensitive to NBMPR and dilazep
7
7
References: 1, Sanchez et al. (1999); 2, Mäser et al. (1999); 3, Sanchez et al. (2002); 4,
Sanchez et al. (2004); 5, Carter and Fairlamb (1993); 6, de Koning and Jarvis (1999); 7,
Mäser et al. (2001); 8, Carter et al. (1995); 9, de Koning et al. (2004b).
101
Figure 1
Sensitivity of T. brucei to purine analogs.
TbAT1+/+ (filled circles) and tbat1-/- (open circles) bloodstream-form trypanosomes were
incubated for 72 h with the adenosine analogs tubercidin (red), cordycepin (green), and
dideoxyadenosine (blue). Cell number and viability was measured by fluorescence of the
redox-activated dye Alamar blue and expressed as percentage of untreated controls. Error
bars (standard deviations) are shown in only one direction for sake of readability.
tubercidin
cordycepin
NH2
NH2
N
NH2
N
N
N
HO
HO
dideoxyadenosine
N
O
N
HO
N
N
HO
O
OH
N
N
N
O
OH
Growth [%]
100
75
50
25
0
0
1
2
3
4
lg (Conc. [nM])
5
102
Figure 2
Effects of competitors on sensitivity to purine analogs.
Drug sensitivity assays for tubercidin (a) and cordycepin (b) were carried out with parental
TbAT1+/+ trypanosomes (white bars) and the tbat1-/- mutant (black bars) in the presence of 1
mM purine competitors (Ado, adenosine; Ino, inosine; Ade, adenine). In (c) the resulting
resistance factors (IC50[ TbAT1+/+] / IC50[tbat1-/-]) are summarized (light bars, tubercidin; dark
bars, cordycepin). Asterisks indicate significant differences between tbat1-/- and TbAT1+/+ (p
< 0.05 in a two-tailed t-test; for cordycepin plus adenine, p was 0.057).
lg (IC50/nM)
a
5
4
lg (IC50/nM)
*
*
ctr
Ado
Ino
Ade
*
*
*
ctr
Ado
Ino
ctr
Ado
2
1
4
3
2
1
0
c
*
3
0
b
*
Ade
3
lg R
2
1
0
-1
Ino
Ade
103
Figure 3
Growth of TbAT1+/+ and tbat1-/- trypanosomes.
Population doubling time [h]
Bloodstream-form trypanosomes ( TbAT1+/+, white bars; tbat1-/-, black bars) were
propagated in vitro at different serum concentrations. At 5%, the tbat1 null mutant grew
significantly faster than its parental strain (p = 0.012, n = 20).
18
16
14
12
10
8
6
4
2
0
*
5
10
20
Serum concentration [%]
104
Figure 4
Expression levels of TbNT family members.
a) Dendrogram of T. brucei ENT protein sequences. Different subgroups are indicated by
brackets and roman numbers. Numbers in italics are the positive percentiles of 1000 rounds
of bootstrapping. Human HsENT1 is included for reference. b) Semi-quantitative RT-PCR of
TbNT subgroup genes with primers complementary to conserved sequences within each
group. Actin (lower band) served as an internal control. Aliquots were removed after the
indicated numbers of cycles.
a
I
IV
Tb09.244.2020
Tb09.218.0180
NT7 NT5
NT6
NT2
NT4
NT3
100
100
99 100
Tb09.160.5480
II
100
AT1
NT8.1
NT1
0.1
HsENT1
b
21 23 25 27 29 31 33 35
21 23 25 27 29 31 33 35
I
II
III
IV
TbAT1+/+
III
tbat1-/-
105
Figure 5
Concomitant expression of almost identical TbNT genes.
Expression of TbNT2 to TbNT7 was monitored in parallel by direct sequencing of first-strand
cDNA synthesized with a primer binding to a perfectly conserved region. The six genes are
highly similar, here a region is depicted where they diverge (asterisk, identical base in all six
genes; colon, identical in five genes; dot, identical in four genes). Bases that are not
detectable in TbAT1+/+ cDNA are typed in small letters and underlined.
TbAT1+/+
tbat1-/-
NT2
NT3
NT4
NT5
NT6
NT7
ATGGCAATGGCAACGGGAAAGTACCAAAAGTTATTAAGATC
ATGGCAACaACAATtGTAAAGTACCAtCCcCCATgAgTtGg
ATGGCAACGACGATGTTAAAATACCAAAAGTCtTTtATtGt
ATGGCAATGACAATAGTAAAGTACCAtCCATTtTTAACATt
ATGGCAACGACAACAGTAAAGTACCAACCACTAGTATCGCC
ATGGCAACaAtAATtGTAtAATACCAAAAGTTtTTtACcGt
*******..:::*. ::*:*.*****.
.. ::..
106
Figure 6
TbNT4 and TbNT6 are overexpressed in the tbat1 null mutant.
TbNT4 and TbNT6 mRNA levels were measured by semi-quantitative RT-PCR using actin
as an internal control (lower band). After the indicated numbers of cycles, aliquots were
removed from the reaction. Expression of TbNT4 was not detectable in TbAT1+/+ cells
21 22 24 26 28 30 32 34 35
21 22 24 26 28 30 32 34 35
NT4
actin
NT6
actin
TbAT1+/+
tbat1-/-
107
3. Acknowledgments
I am very grateful to Thomas Seebeck for giving me the opportunity to do my PhD in his
laboratory, for his help, his confidence, his patience and his constant encouragement to see
the work finished. I had an unforgettable time in his group.
A special thank goes to Pascal Mäser for his support and the inspiring discussions about
life and science.
I am grateful to Isabel Roditi for the constructive comments in the group meetings and
seminars, and for accepting to examine this thesis.
I would also like to express my gratitude to Ernst and Sabine Schweingruber for their
support and for my short excursion in the world of yeasts. We had a good time during the
practical courses.
A special and sincere thank to all present and former members of Tom’s an Isabel’s
groups. Without their help this work would have not been possible. In particular I am thankful
to Enock Matovu for introducing me to the subject of drug resistance, to Rahel Schaub not
only for helping me out with molecular biology problems and to Alexandra Lüscher for direct
contribution to this work.
I am lucky to have found good friends. I firmly believe in an everlasting friendship! They
know who they are 
I am indebted with everybody I forgot to mention here but who contributed in any way to
the development of my thesis.
And finally, I wish to thank my parents, my brother and Carlotta for motivation, support and
love.
108
4. Curriculum Vitae
Name
Federico Geiser
Nationality
Swiss
Place and Date of Birth
Bellinzona, July 11 1975
Work Address
Institute of Cell Biology (ICB)
Baltzerstr. 4
CH-3012 Bern
Home Address
Waldheimweg 2
CH-3052 Zollikofen
th
Education
1987-1996
Sekundarschule and Gymnasium at the Feusi
Gymnasium in Bern.
March 1996
Matura type D.
1996-2000
Studies in molecular biology at the “Philosophischnaturwissenschaftlichen Fakultät” at the University
of Bern.
December 2000
Master of Science in Microbiology in the laboratory
of Prof. Dr T. Seebeck at the ICB.
“Mutation
Analysis of the Adenosine
Transporter 1 in Trypanosoma brucei
gambiense Isolates from North Western
Uganda”
Feb 2001-Dec 2004
PhD thesis in the laboratory of Prof. Dr T. Seebeck
at the ICB.
“Molecular Mechanisms of Drug Resistance
in Human African Trypanosomiasis:
Investigations on the Role of the
Trypanosoma brucei Adenosine Transporter1”