Biol 200, Autumn 2014 Exam 1, Key N This exam is worth 90 points. Pages 2-5 have questions. Page 1 is for your reference only. Honor Code Agreement - Signature: ________________________________ Date: ____________ (You agree to not accept or provide assistance to anyone else during this exam.) Thank you! *********************************************************************************************************** FOR YOUR REFERENCE ONLY. NOTHING Point WILL BE GRADED ON THIS PAGE. Page # 2 3 12 4 6 5 Exam Total (out of 90) 5 12 The number next to each intermediate represents the total # of C-C and C-H bonds in that molecule. 5 12 5 4 12 9 9 5 5 5 6 6 8 6 6 1 7 7 total Biol 200, Autumn 2014 Exam 1, Key N 1. (10 pts) For each choice below, write an "X" in the blank for the stronger interaction or bond in each pair. 2 points each a. ___X___ a C-G base pair vs. an A-U base pair ______ b. ___X___ disulfide bond in protein structure vs. ionic bond in protein structure ______ c. ___X___ bond formed by a ribozyme's catalysis vs. a bond in protein 2° structure ______ d. ______ interaction between sigma and RNA polymerase vs. phosphodiester bonds ___X___ e. ____ interaction between phospholipid tails vs. ester linkage between glycerol and fatty acid __X__ 2. (10 pts) The diagram to the right shows the Na+/K+ ATPase. Cells normally have high K+ and low Na+ concentrations in their cytoplasm, whereas outside the cell Na+ is high and K+ is low. (2 pts each) a. When the Na+/K+ ATPase is working normally, it moves K+ which way? (Circle ONE best answer) - cytoplasm outside - outside cytoplasm outside cell -R P cytoplasm Conformation A Conformation B b. Which ion binds more tightly to conformation A? __K+____ c. Which conformation is more likely to bind ATP? ___B___ d. Which of the R-groups to the right is most likely found where you see the "R" in conformation A? (Circle the BEST answer) e. Which of the following is responsible for the change from conformation A to B? A. Addition of the phosphate group to an amino acid on the Na+/K+ ATPase B. Energy released as heat when ATP is broken apart C. Binding of Na+ ions to ATP D. Breaking of the bond between the Na+/K+ ATPase and the phosphate group 3. (6 pts) Imagine you have a lipid bilayer made primarily of phospholipids with unsaturated tails. (2 points each) a. Which of the following molecules will be permeable through this bilayer? (Circle ALL correct answers) - ATP - H2 O - H+ - CO2 - RNA polymerase b. Would permeability increase or decrease if you changed to saturated tails? decrease c. Would permeability increase or decrease if you lowered the temperature? decrease 2 Biol 200, Autumn 2014 Exam 1, Key N 4. (6 pts) Imagine a cell in which there is a mutation in the gene for the amino-acyl tRNA synthetase that binds to the tRNAs with the 3'UCU5' and 3'UCC5' anticodons. The mutant amino-acyl tRNA synthetase enzyme still binds to the same tRNAs, but it binds to the amino acid asparagine (Asn) instead of the normal amino acid. There are no other mutations in the cell. Which of the following will be true? Put an "X" in the blank for all correct answers. (The codon table is printed below.) (+3 points each correct, -2 for "Arg" will never be included, -3 for any other incorrect answer) ______ Most proteins will be a bit shorter than in normal cells ______ The amino acid "Arg" will sometimes be added where "Asn" normally would be in proteins ______ The amino acid "Asn" will sometimes be added where "Ser" normally would be in proteins __X___ There will be more tRNAs carrying "Asn" in the mutant cell compared to normal cells ______ There will be more tRNAs with the 3'UCU5' anticodon in the mutant cell ______ The amino acid "Arg" will never be included in any proteins in the mutant cell ______ There will be more tRNAs carrying "Ser" in the mutant cell compared to normal cells ___X__ The amino acid "Asn" will sometimes be added where "Arg" normally would be in proteins 5. (12 pts) Below is the sequence of a complete mRNA transcribed from a gene in bacteria. 5' CUCGGAAGGUUACCUAAUGCUCGGGAUGUCCUAGGAACCCAUAAUAAU 3' a. Write the protein sequence that is translated from this mRNA on the line below, and label the amino (N) and carboxyl (C) termini of the protein. (6 pts) Version A: N-Met-Leu-Gly-Met-Ser-C Version B: N-Met-Pro-Glu-Met-Val-C -2 pts incorrect or missing N/C labels, -2 if started wrong AUG, -4 if translated entire mRNA, -1 for writing "stop" in the amino acid sequence, -1 for each missing or incorrectly translated aa. b. (1pt) How many tRNAs in total will bind the ribosome during the complete translation of this protein? 5 c. (5 pts) Put the following items in order (1-4) of when they bind to the mRNA during translation. One item does not directly bind mRNA, for that item write an "X" in its blank. +1 each correct ordered item, -2 if "X" incorrect __3__ the large ribosomal subunit __4__ release factor __2__ a tRNA carrying f-Met __X__ an amino-acyl tRNA synthetase __1__ small ribosomal subunit Codon Table 3 Biol 200, Autumn 2014 Exam 1, Key N 6. (14 pts) The diagram to the right shows two prokaryotic genes that are next to each other on the bacterial chromosome. "Gene A" 5' codes for an mRNA that is translated into the protein "RNA polymerase". 3' "Gene B" codes for a tRNA that carries the amino acid valine (Val). "P" stands for the promoter sequence and "T" stands for the terminator sequence. Gene A P Gene B T T +1 +1 a. (2 pts) The two grey boxes in the promoter of gene B represent the -35 and -10 regions. Which is more likely the -10 region? (Circle ONE) C C D b. (2 pts) Can these two genes be transcribed at the same time? Yes Answer questions c-f with "gene A", "gene B", "both" or "neither": c. (2 pts) Which gene uses the top strand as a template for transcription? Gene B d. (3 pts) Which gene's promoter will bind sigma? both e. (3 pts) Which gene has a sequence of T's and C's in the template strand close to +1? Gene A f. (2 pts) For which gene will RNA polymerase end transcription at a stop codon? neither 7. (4 pts) The DNA below is a portion of a bacterial gene. One of the two ends of the DNA shown represents the +1 base pair. RNA polymerase will be moving from right to left, as shown. RNA polymerase moving What will the first 6 nucleotides of the RNA transcribed be? (Circle the ONE best answer) ... 5' TAGGTAGCATAGAT 3' ... ... 3' ATCCATCGTATCTA 5' ... a. 5' AGGUAG 3' d. 5' AUCUAU 3' b. 5' UCCAUC 3' e. 5' UAGAUA 3' c. 5' AUGGAU 3' f. There is not enough information to answer this question 4 3' 5' P D Biol 200, Autumn 2014 Exam 1, Key N 8. (8 pts) Consider a molecule of glucose (C6H12O6) and a molecule of the fatty acid shown to the right (C6H12O2). For this question, one molecule of each type is completely oxidized using cellular respiration. Note: fatty acids are modified and enter the Krebs Cycle. (2 pts for each blank) a. Which has more potential energy stored in its bonds? the fatty acid b. How many electron carriers will be reduced for glucose? 12 the fatty acid? 16 c. Which molecule will result in more CO2 as a product? (Circle ONE) - glucose - the fatty acid - they produce the same amount 9. (20 pts) The reaction to the right occurs during the Krebs cycle. Not all of the reactants or products are shown. a. For each statement below, write an "X" in the T or F column. (1 pt each) T F T F _X__ ____ A carbon is oxidized. ____ __X_ In cells, this is an endergonic reaction. __X_ ATP drives this reaction forward. ____ __X_ CO2 is a product. ____ ____ __X_ Water is a product. __X_ ____ An electron carrier is reduced. b. (3 pts) Enzyme "X" catalyzes the reaction shown above. Can enzyme X catalyze different steps of the Krebs cycle? Why or why not? No. Each step of the Krebs cycle requires its own enzyme because enzymes are specific for their substrates. (explanation must be reasonable for full credit) c. (3 pts) Enzyme X is shown to the right. It consists of two identical polypeptides. The pH of the matrix is 7.8. Which of the following levels of structure will change if I place enzyme X in a solution at pH 13? (Choose ALL correct answers) - 1° - 2° - 3° - 4° d. (3 pts) Which of the following types of bonds will change if I place enzyme X in a solution at pH 13? (Choose ALL correct answers) - hydrogen bonds - disulfide bonds - ionic bonds e. (2 pts) How many genes encode this enzyme? one f. (3 pts) In eukaryotes, this Krebs cycle enzyme is encoded by DNA in the nucleus and the mRNA is translated in the cytoplasm. What should be present in the sequence of the eukaryotic protein that the prokaryotic version will not have? A mitochondrial localization sequence 5
© Copyright 2026 Paperzz