G Model
DNAREP-1616; No. of Pages 11
ARTICLE IN PRESS
DNA Repair xxx (2011) xxx–xxx
Contents lists available at SciVerse ScienceDirect
DNA Repair
journal homepage: www.elsevier.com/locate/dnarepair
Multiple end joining mechanisms repair a chromosomal DNA break in fission
yeast
Peng Li, Jun Li, Ming Li, Kun Dou, Mei-Jun Zhang, Fang Suo, Li-Lin Du ∗
National Institute of Biological Sciences, 7 Science Park Road, Zhongguancun Life Science Park, Beijing 102206, China
a r t i c l e
i n f o
Article history:
Available online xxx
Keywords:
Schizosaccharomyces pombe
Non-homologous end joining
Microhomology-mediated end joining
a b s t r a c t
Non-homologous end joining (NHEJ) is an important mechanism for repairing DNA double-strand breaks
(DSBs). The fission yeast Schizosaccharomyces pombe has a conserved set of NHEJ factors including Ku,
DNA ligase IV, Xlf1, and Pol4. Their roles in chromosomal DSB repair have not been directly characterized before. Here we used HO endonuclease to create a specific chromosomal DSB in fission yeast and
examined the imprecise end joining events allowing cells to survive the continuous expression of HO.
Our analysis showed that cell survival was significantly reduced in mutants defective for Ku, ligase IV,
or Xlf1. Using Sanger sequencing and Illumina sequencing, we have characterized in depth the repair
junction sequences in HO survivors. In wild type cells the majority of repair events were one-nucleotide
insertions dependent on Ku, ligase IV, and Pol4. Our data suggest that fission yeast Pol4 is important
for gap filling during NHEJ repair and can extend primers in the absence of terminal base pairing with
the templates. In Ku and ligase IV mutants, the survivors mainly resulted from two types of alternative
end joining events: one used microhomology flanking the HO site to delete sequences of hundreds to
thousands of base pairs, the other rejoined the break using the HO-generated overhangs but also introduced one- or two-nucleotide base substitutions. The chromosomal repair assay we describe here should
provide a useful tool for further exploration of the end joining repair mechanisms in fission yeast.
© 2011 Elsevier B.V. All rights reserved.
1. Introduction
DNA double-strand breaks (DSBs) pose great threat to cellular survival and genome stability if not repaired properly. The
dominant DSB repair mechanism in mammalian cells is the nonhomologous end joining (NHEJ) pathway [1,2]. The conserved core
components of the classical NHEJ pathway include the Ku heterodimer complex, DNA ligase IV, and ligase IV associated protein
factors XRCC4 and XLF (also called Cernunnos). In vitro, these proteins by themselves not only can efficiently join DNA ends with
minimal terminal microhomology, but also can ligate completely
incompatible DNA ends [3–5]. Beyond these core components, the
capability of the NHEJ machinery is further enhanced by other factors such as the DNA polymerases belonging to the Pol X family,
some of which are capable of synthesizing across DNA ends or
template-independent polymerization [6,7].
In many eukaryotic organisms, alternative end joining mechanisms can be unmasked when one of the classical NHEJ components
is removed [8,9]. Repair events mediated by the alternative mechanisms often rely on microhomology in the range of 5–25 bp, and
thus the term microhomology-mediated end joining (MMEJ) has
∗ Corresponding author. Tel.: +86 10 80713938; fax: +86 10 80720499.
E-mail address: [email protected] (L.-L. Du).
been used to describe such repair processes [10]. MMEJ may play
important roles in chromosome rearrangement associated with
tumorigenesis in humans and is a major repair mechanism in
organisms lacking classical NHEJ components, such as African trypanosomes [11,12].
The unicellular model organism budding yeast Saccharomyces
cerevisiae has been used extensively to characterize the NHEJ
pathway [1]. It shares with mammals the same set of classical NHEJ components including the homologs of Ku heterodimer
(called Yku70 and Yku80 in budding yeast), DNA ligase IV
(Dnl4), XRCC4 (Lif1), XLF (Nej1), and X family polymerase (Pol4).
The in vivo functions of these proteins have been studied by
both transformation-based extrachromosomal repair assays using
linearized plasmids and chromosomal assays using meganucleaseinduced specific DSBs. Transformation-based assays are more
versatile in analyzing various DNA end configurations but have
the possible drawback of not entirely mimicking the situations of
chromosomal repair processes. For the chromosomal end joining
assays, the first and most commonly used version was developed
by the Haber lab, who took advantage of the highly specific HO
meganuclease and examined the survivors resistant to continuous
HO expression when homologous recombination-mediated repair
of the HO-induced DSB is not available [13,14]. In this assay system,
faithfully rejoined DNA ends will be cut again by the HO nuclease, and thus the HO-resistant survivors have undergone imprecise
1568-7864/$ – see front matter © 2011 Elsevier B.V. All rights reserved.
doi:10.1016/j.dnarep.2011.10.011
Please cite this article in press as: P. Li, et al., Multiple end joining mechanisms repair a chromosomal DNA break in fission yeast, DNA Repair
(2011), doi:10.1016/j.dnarep.2011.10.011
G Model
DNAREP-1616; No. of Pages 11
2
ARTICLE IN PRESS
P. Li et al. / DNA Repair xxx (2011) xxx–xxx
end joining events that mutate or remove the HO cleavage site
sequence. Nearly all end joining events in the HO survivors are
Ku-dependent [15]. The nature of sequence alternations caused by
imprecise end joining has provided important clues for establishing
the roles of Pol4 and replicative polymerases in NHEJ repair [16,17].
Another popular unicellular eukaryotic model species, the fission yeast Schizosaccharomyces pombe, has also provided important
insights into the conserved features and mechanistic diversity of
the end joining repair pathways. Similar to budding yeast, Ku proteins (called Pku70 and Pku80 in fission yeast), DNA ligase IV (Lig4)
and XLF homolog (Xlf1) are essential for classical NHEJ repair in
fission yeast [18–21]. Distinct from budding yeast, the Mre11Rad50-Nbs1 complex is not required for NHEJ in fission yeast [19],
even though the equivalent complex is crucial for NHEJ in budding
yeast [22]. The fission yeast homolog of XRCC4 has not been identified yet, maybe due to a high level of sequence divergence. Fission
yeast also has an X family polymerase called Pol4, whose in vitro
biochemical activities have been studied but its in vivo roles in NHEJ
remain uncharacterized [23].
Previous studies on fission yeast end joining repair pathways
have mainly relied on transformation-based extrachromosomal
repair assays. Here we report the establishment of a fission yeast
chromosomal end joining assay similar to the budding yeast HO
survivor assay developed by the Haber lab. We used this assay
system to investigate the roles of Ku, ligase IV, Xlf1, and Pol4 in
chromosomal DSB end joining repair. We demonstrated that fission
yeast Pol4 is required for gap filling during classical NHEJ repair, and
two types of alternative end joining mechanisms act in the absence
of Ku or ligase IV.
2. Materials and methods
2.1. Strains
All fission yeast strains used in this study are listed in Table 1.
They were constructed using standard genetic methods [24]. The
HO cleavage site was introduced into the fission yeast genome
as described [25]. Briefly, the coding sequence of the arg3 gene
on the left arm of chromosome 1 was replaced by transformation
with a PCR product containing both a kanMX cassette and a 24-bp
sequence (TTTCAGCTTTCCGCAACAGTATAA) from the MATa allele
of the budding yeast mating locus, which was shown to be sufficient for HO cleavage in vitro and in vivo [26]. In the strains used in
the present study, the kanMX marker next to the HO cleavage site
was switched to nourseothricin resistance natMX marker by PCRbased marker switching [27]. The plasmid pLD102 expressing HO
endonuclease was integrated at the ars1 replication origin region
located upstream of the hus5 gene as previously described [28]. The
Table 1
Yeast strains used in this study.
Strain
Genotype
DY49
h+ leu1-32 his3-D1 arg3!::HOsite-natMX
ars1::[pJR1-41XH + HO](his3+)
h+ leu1-32 his3-D1 arg3!::HOsite-natMX
ars1::[pJR1-41XH + HO](his3+) pku70!::kanMX
h+ leu1-32 his3-D1 arg3!::HOsite-natMX
ars1::[pJR1-41XH + HO](his3+) lig4!::kanMX
h+ leu1-32 his3-D1 arg3!::HOsite-natMX
ars1::[pJR1-41XH + HO](his3+) pol4!::kanMX
h+ leu1-32 his3-D1 arg3!::HOsite-natMX
ars1::[pJR1-41XH + HO](his3+) xlf1!::kanMX
h+ leu1-32 his3-D1 arg3!::HOsite-natMX
ars1::[pJR1-41XH + HO](his3+) pku70!::kanMX4
pol4!::kanMX
h+ leu1-32 his3-D1 arg3!::HOsite-natMX
ars1::[pJR1-41XH + HO](his3+) lig4!::kanMX pol4!::kanMX
DY2876
DY2879
DY2884
DY3137
DY3197
DY3222
deletion alleles of pku70, lig4, and xlf1 were from the strain collection of Paul Russell’s lab. The deletion of pol4 was from the Bioneer
deletion collection (http://pombe.bioneer.com/).
2.2. HO induction and survival rate measurement
Colonies grown on YES rich medium plate were inoculated into
liquid EMM minimal medium supplemented with leucine, arginine and 1.5 !M of thiamine (EMM + LRT). After overnight growth
at 30 ◦ C, OD600 of the cultures reached around 5. Cultures were
diluted into fresh EMM + LRT liquid medium to OD600 ∼ 0.1 and
allowed to grow at 30 ◦ C for about 8 h to OD600 ∼ 0.8. Cells were
harvested by centrifugation and washed with sterile water twice,
diluted, and then spread onto EMM plates supplemented with
leucine and arginine (EMM + LR). As controls, cells were also spread
onto EMM + LRT plates. The survival rate was calculated as the number of colonies formed on EMM + LR plate divided by the number
of colonies formed on EMM + LRT plate.
2.3. Repair junction analysis by PCR and Sanger sequencing
For each strain, six independent starting cultures were used
for HO induction as described above. Eight survivor colonies
derived from each starting cultures were randomly selected and
streaked onto EMM + LR plates. One single colony from each streak
was then used for colony PCR to amplify the repair junctions.
The following three primers were used together for the PCR
reactions: LD235 (5$ -GCATACGATATATTACGGCGCCAATCTCGC-3$ ),
Oligo563 (5$ -GGGATTTGCTCTGGAGATAATC-3$ ), and Oligo564 (5$ CCTCAGTGGCAAATCCTAACC-3$ ). For the parental strains and repair
products without nucleotide insertion or deletion, LD235 and
Oligo564 amplify a 596-bp PCR product, whereas Oligo563 and
Oligo564 amplify a 1621-bp product. For the repair junction
formed by the most frequent microhomology-mediated end joining
event that delete a 1234-bp region including the LD235 sequence,
Oligo563 and Oligo564 amplify a 387-bp PCR product. For colonies
that the three-primer combination failed to yield a PCR product,
additional PCR primers covering HO-site-flanking regions were
used to map and eventually amplify the repair junctions. The PCR
products were cleaned up with exonuclease 1 (Exo1) and shrimp
alkaline phosphatase (SAP) and then sequenced by Sanger sequencing.
2.4. Repair junction analysis by Illumina sequencing
For each strain, 1.2 × 107 cells were used for HO induction on
EMM + LR plates. Survivor colonies were scraped off the plates and
pooled together. Genomic DNA was extracted from the pooled survivor cells using MasterPure Yeast DNA Purification Kit (EPICENTRE
Biotechnologies). The repair junctions were amplified with the
following two primers, which contain the sequences necessary for
Illumina sequencing: Oligo1041 (5$ -AATGATACGGCGACCACCGAGACTCACTATAGGGCGAATTGGGT-3$ ), and Oligo1042 (5$ -CAAGCAGAAGACGGCATACGAACGTCAAGACTGTCAAGGAGGGTA-3$ ). For
intact HO site or repair junctions without nucleotide insertion or
deletion, these primers generate a 224-bp PCR product. The PCR
products were gel purified and used as the Illumina sequencing
template. Forty-two cycles of single-end sequencing were carried
out using an Illumina Genome Analyzer II. The sequencing primer
was Oligo1043 (5$ -TATAGGGCGAATTGGGTACGAATTCGGCCAGGT3$ ). The sequencing primer was designed such that the first three
bases of the sequencing reads were ACC immediately upstream
of the 24-nucleotide HO cleavage site sequence. About 1.5-to-2
million sequencing reads starting with ACC were obtained for each
survivor pool. After trimming off the ACC sequence, the reads from
the same survivor pool were compared to each other and identical
Please cite this article in press as: P. Li, et al., Multiple end joining mechanisms repair a chromosomal DNA break in fission yeast, DNA Repair
(2011), doi:10.1016/j.dnarep.2011.10.011
G Model
DNAREP-1616; No. of Pages 11
ARTICLE IN PRESS
P. Li et al. / DNA Repair xxx (2011) xxx–xxx
3
Fig. 1. A chromosomal DSB repair assay for monitoring the imprecise end joining events that allow cells to survive continuous HO expression. (A) A diagram of the HO
cleavage site sequence and its chromosomal context. The 24-nucleotide HO cleavage site sequence was inserted at the arg3 locus on the left arm of chromosome 1. The arg3
ORF was replaced with a natMX marker. The nearest essential gene on the telomere side of the HO site is rpc2, and the nearest essential gene on the centromere side of the
HO site is mrps5. (B) Survival rates of cells plated on thiamine-free medium that induced the expression of HO nuclease. The averages of three independent experiments are
shown, and the error bars represent the standard errors of the mean.
sequences were grouped together. All DNA sequences and their
corresponding read numbers from the survivor pools of wild type,
pol4, pku70, and lig4 strains are listed in Supplementary Tables
1–4.
2.5. Computational analysis of microhomologous sequences that
can potentially serve as MMEJ substrates
To identify the microhomologous sequences residing on opposite sides of the HO cleavage site within the 15.3-kb interval
between rpc2 and mrps5, we first searched for seed sequence pairs
with at least 5-bp perfect homology using suffix tree [29]. Then,
the perfect matched seeds were extended on both ends using the
Needleman–Wunsch algorithm [30], allowing at most a single-base
mismatch or a single-base indel until two consecutive bases cannot
be matched.
We used the melt.pl script in the UNAFold software package
to compute minimum free energies ("G) for the hybridization of
sequence pairs using the temperature parameter of 30 ◦ C [31]. The
sequence pairs were ranked according to their free energies, and
the ones with free energies lower than −10.0 kcal/mol are listed in
Supplementary Table 5.
3. Results
3.1. A chromosome-based imprecise end joining assay for the
fission yeast
To characterize the roles of fission yeast NHEJ genes in repairing a chromosomal DSB, we exploited an inducible HO cleavage
system developed previously for monitoring protein recruitment
to site-specific DSBs [25]. In this system, a 24-nucleotide HO
cleavage site sequence is inserted at the arg3 locus of chromosomal 1 (Fig. 1A). The HO endonuclease is under the control of
the thiamine-repressible nmt1 promoter. Upon shifting cells to
thiamine-free medium, the expression of HO will lead to the
formation of persistent DSBs due to the lack of homologous
repair template, and eventually result in cell death for the vast
majority of the cells [25]. By plating a large number of cells on
thiamine-free plates, we observed rare survivor colonies growing
up after a few days, reminiscent of the low-frequency imprecise end joining events in the budding yeast S. cerevisiae when
homologous repair of an HO-induced DSB was blocked [13,14].
In wild type fission yeast background, the average survival rate
we observed was 1.67 × 10−3 (Fig. 1B), similar to the survival
rate previously reported for wild type budding yeast (2.2 × 10−3 )
[14].
In the budding yeast HO-based imprecise end joining assays,
deleting either Ku (YKU70) or ligase IV (DNL4) gene resulted in
about 1000-fold reduction of cell survival rate, indicating that Kuand ligase IV-dependent NHEJ pathway is the main mechanism
generating imprecise repair products [15,17]. Using our fission
yeast system, we observed a 7.0-fold reduction of survival for
pku70 mutant, and a 4.8-fold reduction of survival for lig4 mutant
(Fig. 1B), suggesting that on one hand, most of the fission yeast
survivors also resulted from a Ku- and ligase IV-dependent repair
process, and on the other hand, Ku- and ligase IV-independent
repair appeared to be much more efficient in the fission yeast
compared to the budding yeast. We also observed a significant
reduction of survival rates for the xlf1 mutant (Fig. 1B), consistent
with previous findings that it is as defective as Ku and ligase IV
mutants in circularizing linear plasmids [20,21]. Deletion of pol4
resulted in a 37% reduction of average survival rate compared
to the wild type (Fig. 1B). Combining pol4 deletion with either
Please cite this article in press as: P. Li, et al., Multiple end joining mechanisms repair a chromosomal DNA break in fission yeast, DNA Repair
(2011), doi:10.1016/j.dnarep.2011.10.011
G Model
DNAREP-1616; No. of Pages 11
4
ARTICLE IN PRESS
P. Li et al. / DNA Repair xxx (2011) xxx–xxx
Fig. 2. Microhomology-mediated end joining (MMEJ) events revealed by the HO survivor analysis. (A) The design of a three-primer combination for efficient amplification of
the repair junctions in the HO survivors. For repair junctions without nucleotide insertion or deletion, a 596-bp PCR product can be amplified using this primer combination,
whereas for repair junctions formed by the 1234-bp deletion event, a 387-bp PCR product is expected. (B) MMEJ-mediated repair junction sequences recovered from the HO
survivors. The microhomologous sequences originally residing on opposite sides of the HO site are in bold font, with perfectly matched bases colored in red and mismatched
positions colored in blue. The underlined sequences are the ones found in the survivors and the sequences in parentheses are the ones deleted (a one of the 1234-bp deletion
events preserved the sequence in parentheses). (C) The percentages of MMEJ events among the 48 survivors analyzed for each strain.
pku70 or lig4 deletion did not enhance the phenotype, suggesting that Pol4 may not function independently of Ku and ligase IV
(Fig. 1B).
3.2. Microhomology-mediated end joining (MMEJ) is the
dominant repair mechanism in NHEJ mutants
To characterize the nature of the repair events occurring in
the survivors, we randomly selected 48 survivors for each of the
7 strains shown in Fig. 1B, amplified by PCR the genomic region
spanning the HO cleavage site, and subjected the PCR products
to Sanger sequencing. Preliminary data suggested that a recurring
repair event removes a 1234-bp-long sequence spanning the HO
site (hereafter referred to as the 1234-bp deletion), and thus we
adopted a 3-primer PCR assay allowing the efficient amplification
of repair junctions with small nucleotide changes as well as the
1234-bp deletion events (Fig. 2A). For the rare survivors harboring
larger deletions and thus refractory to the 3-primer PCR assay, we
used other PCR primers further away from the HO site to map and
amplify the repair junctions.
Among the 336 survivors we examined, we observed a total of
136 deletion events removing more than 200 bp of sequences surrounding the HO site, mostly occurring in NHEJ mutants (Fig. 2B).
The repair junctions of these events belong to 11 different types, all
of which involve microhomology shared by sequences on opposite
sides of the HO cleavage site (Fig. 2B). The extent of the microhomology ranges from a 5-bp perfect match to a 25-bp imperfect
homologous stretch containing three single-base mismatch/indel.
The prevalent use of 5–25 bp microhomology and the independence of Ku and ligase IV suggest that these repair events are typical
microhomology-mediated end joining (MMEJ) events [10].
One of the most notable patterns emerging from our repair junction analysis is the dramatic increase of the relative frequency of the
MMEJ events when the NHEJ genes were deleted (Fig. 2C). Only one
out of 48 wild type survivors resulted from a MMEJ event (a 1234-bp
deletion), whereas in pku70 mutant, 67% (32/48) of the survivors
were due to MMEJ, including thirty-one 1234-bp deletion events
(Fig. 2C). High levels of MMEJ events were also observed among
the survivors of lig4 and xlf1 mutants (Fig. 2C). Because a significant
number of survivors in NHEJ mutant background did not have any
sequence change at the HO site and thus might not have suffered
the DSB (10% among pku70 survivors and 17% among lig4 survivors),
MMEJ-mediated events probably represented even higher proportions of the repair events in NHEJ mutants than shown in Fig. 2C.
Given the lower survival rates of NHEJ mutants compared to the
wild type, the absolute frequency of MMEJ events occurring in NHEJ
Please cite this article in press as: P. Li, et al., Multiple end joining mechanisms repair a chromosomal DNA break in fission yeast, DNA Repair
(2011), doi:10.1016/j.dnarep.2011.10.011
G Model
DNAREP-1616; No. of Pages 11
ARTICLE IN PRESS
P. Li et al. / DNA Repair xxx (2011) xxx–xxx
mutants did not increase as much as the relative MMEJ frequency.
Nonetheless, after normalizing with survival rates, the absolute
frequencies of MMEJ events in pku70, lig4, and xlf1 mutants were
estimated to be 4.6 folds, 6.3 folds, and 4.9 folds of the frequency in
wild type, suggesting that chromosomal MMEJ may be suppressed
by NHEJ factors in wild type fission yeast cells.
The sizes of the deletions found in the survivors are limited by
the distances between the HO site and the most adjacent essential genes. On the telomere side, the closest essential gene is rpc2,
4553 bp away from HO site; on the centromere side, the closest
essential gene is mrps5, 10750 bp away from HO site (Fig. 1A). All
of the MMEJ-mediated deletions we observed occurred within the
15.3-kb interval between rpc2 and mrps5. The uneven frequencies
of the 11 types of MMEJ events suggest that some sequences are
favored by the MMEJ repair mechanism. We hypothesized that the
annealing energy may be a major factor in play. To test this idea, we
computationally predicted all the homologous sequences containing ≥5 bp of perfect homology within the rpc2–mrps5 interval (see
Section 2) and calculated their hybridization free energies using the
UNAFold software [31]. Consistent with our hypothesis, the most
frequent MMEJ event (1234-bp deletion) employed the homologous sequence pair with the lowest hybridization free energy at
−19.0 kcal/mol (Supplementary Table 5). The free energy of the
homologous sequence pair used by the second most frequent MMEJ
event (8960-bp deletion) ranked number six among all predicted
homologous sequences at −16.6 kcal/mol. Another factor that may
have favored these two MMEJ events is the distance between the
homologous sequences and the DSB. For both events, at least one of
the homologous sequences is within 1 kb from the DSB, thus can be
converted by resection to single stranded DNA more rapidly than
other sequences farther away from the DSB.
For MMEJ events mediated by two sequences sharing imperfect homology, it has been reported before that one sequence is
often preferentially retained in the repair product [32,33]. We also
observed strong sequence bias for the two types of MMEJ events
observed more than once in our analysis. For the 1234-bp deletion event, 109 out of 110 times the sequence on the centromere
side ended up in the repair product, whereas for the 8960-bp deletion event, all 17 events chose the sequence on the telomere side
(Fig. 2B). The selection bias observed here is consistent with the
previously proposed model that the strand with mismatched bases
closer to the DSB is preferentially degraded during the repair process [33].
3.3. Imprecise end joining events revealed by Sanger sequencing
and Illumina sequencing
Our analysis of 48 wild type survivors using PCR and Sanger
sequencing revealed the genomic sequences surrounding the HO
site in 45 survivors (Fig. 3A). We failed to obtain PCR products from
3 survivors, probably due to extensive sequence alterations that
had occurred in them. We did not find any sequence change in one
survivor (denoted as intact in Fig. 3A), whose survival might have
resulted from mutations affecting HO gene or genes controlling HO
expression. Large deletion and insertion were found in two survivors: MMEJ-mediated 1234-bp deletion event occurred in one,
and in the other we found an insertion of a 389-bp rDNA sequence
into the HO cleavage overhang sequence (AACA), mediated by a
2-bp homology on the telomere side and a 1-bp homology on the
centromere side.
In the remaining 42 wild type survivors, we found 10 different types of small sequence alterations, the majority of which
are 1–2 bp nucleotide insertions and 1–3 bp nucleotide deletions
(Fig. 3A). All of these sequence changes either occurred within the
4-bp HO cleavage overhang sequence or affected the bases within
2 bp from the overhang, suggesting that these mutations are likely
5
the outcome of imprecise end joining repair rather than random
mutations existing before the HO induction, because preexisting
mutations that can prevent HO cleavage should also afflict bases
farther away from the overhang [34].
HO-based imprecise end joining assays in budding yeast have
shown that the two most frequent mutations found in survivors
are the +CA and −ACA types, which together account for more than
half of the survivors in the wild type background [14,16,17,35]. We
also observed these two types of events in wild type fission yeast
background. However, neither is the most frequent event, and the
+CA event was only observed once (Fig. 3A). Interestingly, the two
most frequent events we observed in wild type background both
add an A base within the AACA overhang sequence. To differentiate them, we call the most frequent event (16/48) +A event, the
second most frequent event (12/48) +A* event. The +A event has
been observed before in budding yeast, albeit only occurring at
frequencies of lower than 10% [17,35]. This event can be readily
explained as an A-T base-pair mediated misalignment of the overhangs followed by trimming of a CA dinucleotide sequence on the
upper strand and gap filling-in on both strands (Fig. 3B). A similar
mechanism has been invoked to explain the +CA event observed in
budding yeast [14,16].
As far as we are aware, the +A* event has never been reported
before in budding yeast. It is harder to explain than the +A event. We
propose a model as depicted in Fig. 3B. In this model, the two overhangs shifted their positions away from perfect base pairing by one
nucleotide, thus are in a similar configuration as the intermediate
we propose for the +A event. But instead of trimming off the unbase-paired CA dinucleotide on the top strand, a DNA polymerase
adds an A to the 3$ end of the top strand using the T on the bottom
strand 3$ overhang as template, thus allowing a ligation step to seal
the nick on the top strand. Such ability of a DNA polymerase to use
a discontinuous template has been demonstrated for mammalian
X family polymerase pol ! by in vitro assays [6,7] and predicted for
budding yeast Pol4 based on in vivo evidence [36]. We hypothesize
that fission yeast Pol4 may also possess such an activity. The high
frequency of the +A* event may be related to the high frequency
of the +A event, as it can be envisioned that both events involve
a similar overhang configuration that occurs at a higher frequency
compared to other possible misalignment configurations.
Because of labor and assay cost concerns, we limited our Sanger
sequencing analysis of individual survivor clones to 48 per strain.
Similar concerns may have also limited the previous analyses
in budding yeast to no more than 50 survivor clones per strain
[14,16,17,35]. One obvious drawback of such small-scale analysis
is the uncertainty about the true frequencies of rare events occurring at lower-than-10% rates. Thus, the previous studies in budding
yeast have mainly used the frequencies of the most common +CA
and −ACA events for repair pathway choice analysis.
Compared to Sanger sequencing, second-generation sequencing
technologies offer significant cost advantage and allow huge numbers of DNA molecules to be sequenced in parallel [37]. To achieve
a better assessment of rare repair events, we adopted an Illumina
sequencing procedure to analyze repair junctions of survivors in
wild type, pol4, pku70, and lig4 backgrounds. HO survivor colonies
derived from 1.2 × 107 cells of the same strain background were
pooled together. We then PCR amplified from these survivors the
genomic DNA sequence spanning the HO site using a pair of primers
whose 5$ -sequences are compatible with flow cell attachment on
the Illumina Genome Analyzer. After gel purification, the PCR products are sequenced for 42 cycles using a sequencing primer adjacent
to the 24-nucleotide HO cleavage site. We obtained more than 1
million sequencing reads for each survivor pool. Based on the survival rates, we estimated that the numbers of independent clones
in the survivor pools ranged from around 3000 for pku70 mutant to
about 20,000 clones for the wild type. Thus, the sequencing depth
Please cite this article in press as: P. Li, et al., Multiple end joining mechanisms repair a chromosomal DNA break in fission yeast, DNA Repair
(2011), doi:10.1016/j.dnarep.2011.10.011
G Model
DNAREP-1616; No. of Pages 11
6
ARTICLE IN PRESS
P. Li et al. / DNA Repair xxx (2011) xxx–xxx
Fig. 3. The frequent repair events that occurred in wild type survivors and their frequencies in wild type and NHEJ mutants as revealed by Illumina sequencing. (A) Repair
junction sequences recovered from wild type survivors. The inserted nucleotides are in bold font and colored in blue; the deleted nucleotides are in strike-through font and
colored in green; the base substitutions are colored in red. ND (not determined) denotes the survivors that we failed to obtain repair junction sequences. In addition to data
corresponding to the repair events found in the 48 individual survivors, we also list at the bottom repair events not found in the individual survivors but represent more
than 1% of the Illumina sequencing reads derived from the wild type survivor pool. (B) Diagrams of the proposed models explaining the two most frequent repair events
found in wild type survivors. Sequences on the opposite sides of the HO-induced DSB are colored in maroon and green respectively. Nucleotides inserted during gap filling
are highlighted with a red bold font.
we reached should be sufficient to match the complexities of our
survivor pools. To focus our analysis on the most frequent repair
events, we introduced an arbitrary cutoff, only presenting and discussing here DSB repair events associated with more than 1% of the
Illumina reads in at least one of the four samples unless the events
were also observed during individual survivor analysis (Fig. 3A and
Supplementary Figs. 1–6). According to the complexity of the survivor pools, 1% of the reads should in theory represent more than
a few dozens of independent survivors, and thus are likely to be a
more accurate representation of the true frequency than any single
digit colony counts obtained in the individual survivor analysis.
In addition, applying this cutoff also avoided problems associated
with PCR and sequencing errors, as it is unlikely that these random
errors can result in any single spurious sequence reaching 1% level.
Because of the specific combination of PCR primers and sequencing primer we used, our Illumina sequencing procedure cannot
detect the large sequence alterations such as the MMEJ events
listed in Fig. 2, but is well suited for monitoring the small insertion and deletion events occurring frequently among the wild type
survivors. For the wild type strain, all repair junction types seen
Please cite this article in press as: P. Li, et al., Multiple end joining mechanisms repair a chromosomal DNA break in fission yeast, DNA Repair
(2011), doi:10.1016/j.dnarep.2011.10.011
G Model
DNAREP-1616; No. of Pages 11
ARTICLE IN PRESS
P. Li et al. / DNA Repair xxx (2011) xxx–xxx
in the individual survivor analysis except for the 1234-bp deletion
event and the rDNA insertion event were detected by the Illumina
sequencing procedure (Fig. 3A). Moreover, the relative frequencies
of these events calculated using the Illumina read numbers correlated well with the frequencies estimated from the individual
survivor analysis, suggesting that the Illumina read numbers provide a reliable measure for gauging the frequencies of rare repair
events. To ensure read number-derived frequencies relate to meaningful biological events, for repair events with read number ratios
lower than 0.01% in any given sample, we no longer used the read
number percentage; instead, we denoted the frequency as <0.01%.
3.4. Pol4 performs gap filling during chromosomal NHEJ in the
fission yeast
The only reported in vivo function of fission yeast Pol4 is its
importance for MMEJ-mediated circularization of an extrachromosomal DNA fragment containing discontinuous microhomology at
the ends [33]. In the same study, Pol4 is found to be dispensable
for MMEJ using continuous microhomologies ranging from 5 to
8 bp. We did not see a significant reduction of MMEJ frequencies
when pol4 is deleted in either pku70 or lig4 mutant background
(Fig. 2C), possibly because of the relatively long continuous microhomologies used by the most frequent MMEJ events we detected
here (10 bp for the 1234-bp deletion and 13 bp for the 8960-bp
deletion).
In budding yeast, through the use of both plasmid circularization assay and HO-based imprecise end joining assay, it has been
demonstrated that Pol4 is critical for gap filling during the NHEJmediated repair of DSBs with 3$ -overhangs [16,17,38]. In particular,
the +CA event, the most frequent imprecise NHEJ event among wild
type HO survivors, could no longer be found among budding yeast
pol4 mutant survivors [16,17]. Similarly, in our individual survivor
analysis, neither +A nor +A* event was seen among the 48 pol4
survivors (Supplementary Fig. 1), and the relative frequency of the
Illumina reads of these two events decreased 1.1 × 103 folds and
41 folds respectively (Fig. 3A), suggesting that fission yeast Pol4
is also essential for filling in gaps during NHEJ repair of the HOinduced DSB. In fact, elimination of these two events is sufficient to
account for the 37% reduction of the survival rate in the pol4 mutant
compared to the wild type.
Besides the +A and the +A* events, Illumina sequencing data
suggested that two other lower frequency events in wild type are
also Pol4 dependent. The first one is the −C* event, which represents 3.4% of the Illumina reads in wild type, but the ratio drops to
<0.01% in the pol4 mutant (Fig. 3A). We propose that, similar to the
+A* event, this event may also require Pol4 to carry out a nucleotide
addition using a discontinuous template. In our model depicted in
Fig. 4A, the last two nucleotides on the top strand overhang are
removed by nuclease activities first, then an A-T misalignment stabilizes an overhang configuration that allows Pol4 to add an A to
the top strand using a T on the bottom strand overhang despite the
A-G mismatch.
The other Pol4-dependent event is the −TA event, whose frequency drops from 3.0% in wild type to 0.12% in pol4 mutant
(Fig. 3A). We can model this event as a template slippage at the
TATA dinucleotide tandem repeat 1 bp away from the HO cleavage
overhang (Fig. 4A). It is known that fission yeast Pol4, like other
Pol X family members, has very low processivity [23]. Low processivity will result in high frequency of slippage errors as mispairing
can occur more easily when the polymerase falls off the template.
The fact that the −TA event is Pol4-dependent suggests that other
fission yeast polymerases that participate in NHEJ in the absence of
Pol4 may have better processivity and are not as prone for slippage
errors.
7
3.5. Some Pol4-independent NHEJ events involve ligation of DNA
ends with no homology
All of the four types of Pol4-dependent events we discussed
above are also Ku-dependent and ligase IV-dependent (Fig. 3A),
suggesting that they are bona fide classical NHEJ repair events
that occur only in the presence of Pol4. On the flip side of these
cases, we also observed a number of repair events dependent on
Ku and ligase IV but independent of Pol4. Some are easy to explain,
such as the two examples depicted in Fig. 4B. The −ACA event
can be modeled by an overhang misalignment that leaves no gap
to be filled. In budding yeast, it has been shown that the −ACA
event is the dominant event among pol4 survivors [16,17]. Similarly, we also found that the −ACA event was the most frequent
repair events in pol4 mutant survivors, representing 29% (14/48)
of the individual survivors and 33% of the Illumina reads (Fig. 3A
and Supplementary Fig. 1). Another Pol4-independent event, the
−CA event, does require gap filling, but only on the bottom strand
(Fig. 4B). Presumably the NHEJ repair enzymes can seal the nick on
the top strand, turning the DSB into a single stranded gap, which
can be filled in by polymerases other than Pol4. A number of other
Pol4-independent deletion events, such as the −7 bp and −17 bp
events listed in Fig. 3A, can be explained similarly. Our interpretation is consistent with a previous finding that budding yeast Pol4
is not required for circularization of linear plasmid DNA with partially compatible 3$ overhanging ends that contain gap on only one
strand [38].
The other Pol4-independent deletion events are more unusual,
as they do not seem to use any terminal microhomology. For
example, the −AACA event shown in Fig. 4C, which can be most parsimoniously modeled as a blunt end ligation after both overhangs
are trimmed off. It is known that fission yeast is distinct from budding yeast in its ability to circularize linear DNA with blunt ends as
efficiently as DNA with cohesive ends [19,39]. Furthermore, either
pku70 or lig4 deletion reduced the efficiency of blunt-end ligation
by 1000 folds [19]. Up-to-40% of these NHEJ-dependent blunt-end
ligation events resulted in precise rejoining without any deletions,
suggesting that fission yeast NHEJ machinery is capable of directly
ligating DSB ends with no homology [19,32]. Thus, we propose that
the −AACA event and the other deletion events with no apparent
microhomology involved can be attributed to the strong capability
of the fission yeast NHEJ factors in ligating blunt and incompatible
ends. Two other events belonging to this category occurred at high
enough frequency in wild type background to be listed in Fig. 3A:
the −G event and the −GC event. We depict a possible model for
the −G event in Fig. 4C. In this model, nuclease activities trim off
the bottom strand overhand plus an additional base pair to form
a blunt end, then ligation occurs between the intact top strand 3$
overhang and the blunt end, as has been observed in in vitro reactions catalyzed by Ku, XRCC4, ligase IV, and XLF (Cernunnos) [5].
An alternative possibility is that the −G event and the −GC event
resulted from one- or two-nucleotide removal at one 5$ end followed by a ligation-across-gap event catalyzed by the NHEJ ligase
complex, as has been observed in vitro [3,4].
3.6. End joining events independent of Ku and ligase IV are
associated with high levels of nucleotide substitution errors
In the absence of either pku70 or lig4, the repair junctions recovered from extrachromosomal DSB repair assays were exclusively
deletions, the vast majority of which were mediated by MMEJ
[19,32]. Thus, we were surprised to find that a significant fraction of the HO survivors in the pku70 and lig4 mutant background
resulted from repair events that only introduced base substitutions
at or near the HO cleavage overhang sequence (Supplementary Figs.
2 and 3). For example, 13% (6/48) of the individual survivors and
Please cite this article in press as: P. Li, et al., Multiple end joining mechanisms repair a chromosomal DNA break in fission yeast, DNA Repair
(2011), doi:10.1016/j.dnarep.2011.10.011
G Model
DNAREP-1616; No. of Pages 11
8
ARTICLE IN PRESS
P. Li et al. / DNA Repair xxx (2011) xxx–xxx
Fig. 4. The models explaining representative Pol4-dependent and Pol4-independent NHEJ events. Sequences on the opposite sides of the HO-induced DSB are colored in
maroon and green respectively. Nucleotides needed to be removed by nuclease action are in grey. Nucleotides inserted during gap filling are highlighted with a red bold font.
The blue oval denotes the protein factors holding the DSB ends together in the absence of any base pairing. The frequencies of Illumina sequencing reads corresponding to
these events are shown underneath the diagrams. (A) Two Pol4-dependent events. (B) Two Pol4-independent events mediated by misalignment of the overhangs. (C) Two
Pol4-independent events that did not use any apparent homology.
38% of the Illumina reads in the pku70 background correspond to
the A → G event, which mutated the last A base in the AACA overhang to a G. This and four other types of base substitution events
(C → T, CA → GT, G → T, and T → C) together account for most than
80% of the pku70 and lig4 individual survivors that contain neither
MMEJ-mediated large-scale deletion nor intact HO cleavage site
sequence.
By inspecting the base substitution events observed in the pku70
and lig4 mutants (Supplementary Figs. 2 and 3), we noticed that
the substitutions only affect the first or the fourth base of the AACA
Please cite this article in press as: P. Li, et al., Multiple end joining mechanisms repair a chromosomal DNA break in fission yeast, DNA Repair
(2011), doi:10.1016/j.dnarep.2011.10.011
G Model
DNAREP-1616; No. of Pages 11
ARTICLE IN PRESS
P. Li et al. / DNA Repair xxx (2011) xxx–xxx
9
Fig. 5. The models explaining representative Ku-independent and ligase IV-independent end joining events associated with base substitutions. Color schemes are as in
Figs. 3B and 4.
overhang, or the bases immediately adjacent or 1 base away from
the overhang, but never the second or the third base of the overhang. According to a previous mutagenesis study of the HO cleavage
site, all the positions where we observed substitutions in the pku70
and lig4 mutants are essential for HO cleavage [34]. In the same
study, the third base of the overhang was also found to be critical for
HO cleavage. Thus, the non-random distribution of the base substitutions suggests that they are caused by repair-induced mutations,
rather than preexisting mutations or errors introduced during PCR
and sequencing. Furthermore, because the substitutions affect at
most one of the two outside bases of the 4-bp overhang, it is likely
that this Ku-independent and ligase IV-independent repair mechanism needs the complementary 3$ overhangs to form at least 3
consecutive base pairings. Thus, we propose models depicted in
Fig. 5 to explain these substitutions. For the A → G event, a nuclease activity removes the last base of the 3$ overhang on the top
strand. The two overhangs anneal together using the remaining
3-nucleotide base pairings and a polymerase misincorporates a G
when filling in the gap. The mutation is later fixed on both strands
during replication or through mismatch repair. The C → T event can
be explained similarly, except that the gap is introduced by the
degradation of the 5$ end on the bottom strand.
Based on the relative frequencies of the base substitution events
among the 48 individual survivors and the survival rates, we estimated that the absolute frequencies of these events are 4.5 × 10−5
for the pku70 mutant and 4.4 × 10−5 for the lig4 mutant. Such error
rates suggest the involvement of a low fidelity polymerase. Pol4
is known to lack proofreading activity and thus expected to be
error-prone in vivo [23]. However, we did not see a reduction of
the frequencies of the base substitution events in the pku70 pol4
double mutant and the lig4 pol4 double mutant (Supplementary
Figs. 5 and 6), suggesting that these base substitutions are caused
by other polymerase(s).
The Illumina sequencing data suggested that these base
substitution events also occurred in wild type background
(Supplementary Figs. 5 and 6 and Table 1). For example, the
A → G event represents 0.86% of the Illumina reads from the
wild type sample, which translates to an absolute frequency of
1.4 × 10−5 per cell. In comparison, the absolute frequencies of this
event is 3.1 × 10−5 and 2.2 × 10−5 in the pku70 and lig4 mutants
based on the individual survivor analysis. Thus, it is possible
that the same Ku-independent and ligase IV-independent repair
mechanism operates in both wild type cells and NHEJ mutant
cells.
4. Discussion
We report here a chromosomal DSB repair assay in fission yeast
that allowed us to monitor both MMEJ and imprecise NHEJ in wild
type and mutant backgrounds. Using this assay, we uncovered the
critical role of fission yeast Pol4 in gap filling during classical NHEJ.
Furthermore, by profiling repair junctions from thousands of HO
survivors using second-generation sequencing, we were able to
confidently define the genetic requirement for a number of rare
repair events, thereby revealing the remarkable activities of the
fission yeast NHEJ factors in mediating unconventional polymerization and ligation reactions when repairing a chromosomal DSB.
Lastly, we reported a novel base-substitution-prone characteristic
of a Ku-independent and ligase IV-independent repair mechanism
that can rejoin a DSB without any nucleotide loss.
NHEJ and MMEJ in fission yeast have been characterized mainly
by extrachromosomal DSB repair assays. These assays have been
instrumental in defining the conserved roles of Ku, ligase IV,
and Xlf1 in classical NHEJ [18–21], and in revealing the genetic
requirement for the MMEJ pathway [33]. However, there have
been concerns about whether results obtained with these assays
can reflect the situations in a chromosomal context. For example, restriction-digested plasmids with 4-nucleotide cohesive ends
were precisely ligated 100% of the time in wild type budding
yeast [40], whereas >90% of similarly digested plasmids suffered
nucleotide loss when rejoined by NHEJ in wild type fission yeast
[19,39], suggesting that exonucleases are more active and NHEJ
tends to be inaccurate in fission yeast. In contrast, results from a
chromosomal DSB repair assay hinted at the possibility that chromosomal NHEJ in fission yeast is largely precise with the caveat that
precise end joining event cannot be distinguished from uncut DNA
and product of sister-chromatid conversion repair [41]. We show
here that in wild type fission yeast, >50% of the NHEJ-mediated
imprecise end joining events found in HO survivors are nucleotideaddition events with no sequence loss, and most of the remaining
events delete only 1–3 nucleotides at or near the HO overhang.
Thus, our data support the idea that chromosomal NHEJ in fission
yeast is not associated with high levels of exonuclease-mediated
processing and preserves DSB ends better than what extrachromosomal repair assays have suggested.
We note that like the commonly used HO survivor assays in
budding yeast, our assay system only monitors the imprecise end
joining events that mutate or delete the HO cleavage site, and thus
fails to capture the more frequent simple re-ligation events, which
Please cite this article in press as: P. Li, et al., Multiple end joining mechanisms repair a chromosomal DNA break in fission yeast, DNA Repair
(2011), doi:10.1016/j.dnarep.2011.10.011
G Model
DNAREP-1616; No. of Pages 11
10
ARTICLE IN PRESS
P. Li et al. / DNA Repair xxx (2011) xxx–xxx
do not cause any sequence alterations. We expect that the development of a suicide deletion assay like the one applied in budding
yeast in Ref. [42] may in the future help us assess the frequency of
precise end joining events.
The in vivo functions of fission yeast Pol4 in NHEJ have not been
studied before. Here we show that Pol4 is crucial for joining a chromosomal DSB when there are gaps on both strands of partially
annealed 3$ overhanging ends. Furthermore, the Pol4-dependence
of the +A* and −C* events suggests that like the Pol X family polymerases in mammals and budding yeast [6,36], fission yeast Pol4
can catalyze nucleotidyl transfer with unpaired primer termini,
probably with the help of other NHEJ factors. We did not detect
significant change of survival or the types of repair product when
Pol4 was eliminated in pku70 and lig4 mutant background, suggesting that Pol4 mainly functions in the Ku- and ligase IV-dependent
classical NHEJ pathway.
A surprising finding of this work is that pku70 or lig4 deletion reduced the HO survival less than 10 folds, and consequently
the survival rates of fission yeast NHEJ mutants are two orders of
magnitude higher than the budding yeast NHEJ mutants examined with similar assays [15,17]. MMEJ mediated by a pair of
16-nt imperfect microhomologous sequences contributed the bulk
of NHEJ-independent survival. This pair of sequences stands out
among all the possible MMEJ substrates by its superior hybridization free energy. The lack of a similarly good MMEJ substrate may
explain why budding yeast assays did not detect such high levels
of MMEJ events. Another possible contributing factor for the higher
MMEJ frequencies of the fission yeast NHEJ mutants is that fission
yeast cells spend more time in the G2 phase of the cell cycle than
budding yeast cells. As DSB resection preferentially occurs in G2
[43], the DSB ends in fission yeast cells may have more opportunities to be processed. Regardless of the reasons, this fortuitous
high-frequency MMEJ detection system may provide a useful tool
for further dissection of chromosomal MMEJ in fission yeast.
Another Ku-independent and ligase IV-independent end joining mechanism revealed by this work can ligate the DSB overhangs
with no nucleotide addition or loss. Faithful rejoining of a chromosomal DSB has been observed to occur at a frequency of 0.04% in
budding yeast Ku mutant using a suicide deletion assay [42]. What
is unique about our finding is the indication that this mechanism is
associated with a high level of base substitution errors, providing
a clue for further characterization of this heretofore understudied
pathway.
Conflict of interest statement
The authors declare that there are no conflicts of interest.
Acknowledgements
We thank Dr. Paul Russell for providing the xlf1, pku70, and lig4
strains. We are grateful to Yang Liu and Pengcheng Wu for helping
with Illumina sequencing sample preparation. This work was supported by grants from Chinese Ministry of Science and Technology.
Appendix A. Supplementary data
Supplementary data associated with this article can be found, in
the online version, at doi:10.1016/j.dnarep.2011.10.011.
References
[1] T.E. Wilson, Nonhomologous end-joining: mechanisms, conservation and relationship to illegitimate recombination, in: A. Aguilera, R. Rothstein (Eds.),
Molecular Genetics of Recombination, Springer, Berlin, Heidelberg, 2007, pp.
487–513.
[2] M.R. Lieber, The mechanism of double-strand DNA Break repair by the nonhomologous DNA end joining pathway, Annu. Rev. Biochem. 79 (2010) 181–211.
[3] J. Gu, H. Lu, B. Tippin, N. Shimazaki, M.F. Goodman, M.R. Lieber, XRCC4:DNA
ligase IV can ligate incompatible DNA ends and can ligate across gaps, EMBO J.
26 (2007) 1010–1023.
[4] J. Gu, H. Lu, A.G. Tsai, K. Schwarz, M.R. Lieber, Single-stranded DNA ligation
and XLF-stimulated incompatible DNA end ligation by the XRCC4-DNA ligase
IV complex: influence of terminal DNA sequence, Nucleic Acids Res. 35 (2007)
5755–5762.
[5] C.J. Tsai, S.A. Kim, G. Chu, Cernunnos/XLF promotes the ligation of mismatched
and noncohesive DNA ends, Proc. Natl. Acad. Sci. 104 (2007) 7851–7856.
[6] S.A. Nick McElhinny, J.M. Havener, M. Garcia-Diaz, et al., A gradient of template dependence defines distinct biological roles for family X polymerases in
nonhomologous end joining, Mol. Cell 19 (2005) 357–366.
[7] B.J. Davis, J.M. Havener, D.A. Ramsden, End-bridging is required for pol mu to
efficiently promote repair of noncomplementary ends by nonhomologous end
joining, Nucleic Acids Res. 36 (2008) 3085–3094.
[8] A. Nussenzweig, M.C. Nussenzweig, A backup DNA repair pathway moves to
the forefront, Cell 131 (2007) 223–225.
[9] J.E. Haber, Alternative endings, Proc. Natl. Acad. Sci. U.S.A. 105 (2008) 405–406.
[10] M. McVey, S.E. Lee, MMEJ repair of double-strand breaks (director’s cut):
deleted sequences and alternative endings, Trends Genet. 24 (2008) 529–538.
[11] P. Burton, D.J. McBride, J.M. Wilkes, J.D. Barry, R. McCulloch, Ku heterodimerindependent end joining in Trypanosoma brucei cell extracts relies upon
sequence microhomology, Eukar. Cell 6 (2007) 1773–1781.
[12] L. Glover, J. Jun, D. Horn, Microhomology-mediated deletion and gene conversion in African trypanosomes, Nucleic Acids Res. 39 (2011) 1372–1380.
[13] K.M. Kramer, J.A. Brock, K. Bloom, J.K. Moore, J.E. Haber, Two different types
of double-strand breaks in Saccharomyces cerevisiae are repaired by similar
RAD52-independent, nonhomologous recombination events, Mol. Cell. Biol. 14
(1994) 1293–1301.
[14] J.K. Moore, J.E. Haber, Cell cycle and genetic requirements of two pathways of
nonhomologous end-joining repair of double-strand breaks in Saccharomyces
cerevisiae, Mol. Cell. Biol. 16 (1996) 2164–2173.
[15] S.E. Lee, F. Pâques, J. Sylvan, J.E. Haber, Role of yeast SIR genes and mating type
in directing DNA double-strand breaks to homologous and non-homologous
repair paths, Curr. Biol. 9 (1999) 767–770.
[16] T.E. Wilson, M.R. Lieber, Efficient processing of DNA ends during yeast nonhomologous end joining, J. Biol. Chem. 274 (1999) 23599–23609.
[17] S.-F. Tseng, A. Gabriel, S.-C. Teng, Proofreading activity of DNA polymerase Pol2
mediates 3$ -end processing during nonhomologous end joining in yeast, PLoS
Genet. 4 (2008) e1000060.
[18] P. Baumann, T.R. Cech, Protection of telomeres by the Ku protein in fission yeast,
Mol. Biol. Cell 11 (2000) 3265–3275.
[19] K.G. Manolis, E.R. Nimmo, E. Hartsuiker, A.M. Carr, P.A. Jeggo, R.C. Allshire, Novel
functional requirements for non-homologous DNA end joining in Schizosaccharomyces pombe, EMBO J. 20 (2001) 210–221.
[20] P. Hentges, P. Ahnesorg, R.S. Pitcher, et al., Evolutionary and functional conservation of the DNA non-homologous end-joining protein, XLF/Cernunnos, J.
Biol. Chem. 281 (2006) 37517–37526.
[21] S. Cavero, C. Chahwan, P. Russell, Xlf1 is required for DNA repair by nonhomologous end joining in Schizosaccharomyces pombe, Genetics 175 (2007) 963–967.
[22] S.J. Boulton, S.P. Jackson, Components of the Ku-dependent non-homologous
end-joining pathway are involved in telomeric length maintenance and telomeric silencing, EMBO J. 17 (1998) 1819–1828.
[23] S. González-Barrera, A. Sánchez, J.F. Ruiz, et al., Characterization of SpPol4, a
unique X-family DNA polymerase in Schizosaccharomyces pombe, Nucleic Acids
Res. 33 (2005) 4762–4774.
[24] S.L. Forsburg, N. Rhind, Basic methods for fission yeast, Yeast 23 (2006)
173–183.
[25] L.-L. Du, T.M. Nakamura, B.A. Moser, P. Russell, Retention but not recruitment
of Crb2 at double-strand breaks requires Rad1 and Rad3 complexes, Mol. Cell.
Biol. 23 (2003) 6150–6158.
[26] J.A. Nickoloff, E.Y. Chen, F. Heffron, A 24-base-pair DNA sequence from the MAT
locus stimulates intergenic recombination in yeast, Proc. Natl. Acad. Sci. U.S.A.
83 (1986) 7831–7835.
[27] M. Sato, S. Dhut, T. Toda, New drug-resistant cassettes for gene disruption and
epitope tagging in Schizosaccharomyces pombe, Yeast 22 (2005) 583–591.
[28] L.-L. Du, T.M. Nakamura, P. Russell, Histone modification-dependent and
-independent pathways for recruitment of checkpoint protein Crb2 to doublestrand breaks, Genes Dev. 20 (2006) 1583–1596.
[29] D. Gusfield, Algorithms on Strings, Trees, and Sequences: Computer Science
and Computational Biology, Cambridge University Press, 1997.
[30] S.B. Needleman, C.D. Wunsch, A general method applicable to the search for
similarities in the amino acid sequence of two proteins, J. Mol. Biol. 48 (1970)
443–453.
[31] N.R. Markham, M. Zuker, UNAFold: software for nucleic acid folding and
hybridization, Methods Mol. Biol. 453 (2008) 3–31.
[32] A. Decottignies, Capture of extranuclear DNA at fission yeast double-strand
breaks, Genetics 171 (2005) 1535–1548.
[33] A. Decottignies, Microhomology-mediated end joining in fission yeast is
repressed by Pku70 and relies on genes involved in homologous recombination,
Genetics 176 (2007) 1403–1415.
[34] J.A. Nickoloff, J.D. Singer, F. Heffron, In vivo analysis of the Saccharomyces cerevisiae HO nuclease recognition site by site-directed mutagenesis, Mol. Cell. Biol.
10 (1990) 1174–1179.
Please cite this article in press as: P. Li, et al., Multiple end joining mechanisms repair a chromosomal DNA break in fission yeast, DNA Repair
(2011), doi:10.1016/j.dnarep.2011.10.011
G Model
DNAREP-1616; No. of Pages 11
ARTICLE IN PRESS
P. Li et al. / DNA Repair xxx (2011) xxx–xxx
[35] E.Y. Shim, J.-L. Ma, J.-H. Oum, Y. Yanez, S.E. Lee, The yeast chromatin remodeler
RSC complex facilitates end joining repair of DNA double-strand breaks, Mol.
Cell. Biol. 25 (2005) 3934–3944.
[36] B. Pardo, E. Ma, S. Marcand, Mismatch tolerance by DNA polymerase Pol4 in the
course of nonhomologous end joining in Saccharomyces cerevisiae, Genetics 172
(2006) 2689–2694.
[37] J. Shendure, H. Ji, Next-generation DNA sequencing, Nat. Biotechnol. 26 (2008)
1135–1145.
[38] J.M. Daley, R.L.V. Laan, A. Suresh, T.E. Wilson, DNA joint dependence of Pol X
family polymerase action in nonhomologous end joining, J. Biol. Chem. 280
(2005) 29030–29037.
[39] S. Wilson, N. Warr, D.L. Taylor, F.Z. Watts, The role of Schizosaccharomyces pombe
Rad32, the Mre11 homologue, and other DNA damage response proteins in
non-homologous end joining and telomere length maintenance, Nucleic Acids
Res. 27 (1999) 2655–2661.
11
[40] S.J. Boulton, S.P. Jackson, Saccharomyces cerevisiae Ku70 potentiates illegitimate
DNA double-strand break repair and serves as a barrier to error-prone DNA
repair pathways, EMBO J. 15 (1996) 5093–5103.
[41] J.C. Hope, S.M. Mense, M. Jalakas, J. Mitsumoto, G.A. Freyer, Rqh1 blocks
recombination between sister chromatids during double strand break repair,
independent of its helicase activity, Proc. Natl. Acad. Sci. 103 (2006) 5875–5880.
[42] E. Karathanasis, T.E. Wilson, Enhancement of Saccharomyces cerevisiae endjoining efficiency by cell growth stage but not by impairment of recombination,
Genetics 161 (2002) 1015–1027.
[43] G. Ira, A. Pellicioli, A. Balijja, et al., DNA end resection, homologous recombination and DNA damage checkpoint activation require CDK1, Nature 431 (2004)
1011–1017.
Please cite this article in press as: P. Li, et al., Multiple end joining mechanisms repair a chromosomal DNA break in fission yeast, DNA Repair
(2011), doi:10.1016/j.dnarep.2011.10.011