This information is current as
of June 18, 2017.
Targeting Murine Immune Responses to
Selected T Cell- or Antibody-Defined
Determinants of the Hepatitis B Surface
Antigen by Plasmid DNA Vaccines Encoding
Chimeric Antigen
Reinhold Schirmbeck, Xin Zheng, Michael Roggendorf,
Michael Geissler, Francis V. Chisari, Jörg Reimann and
Mengji Lu
References
Subscription
Permissions
Email Alerts
This article cites 28 articles, 12 of which you can access for free at:
http://www.jimmunol.org/content/166/2/1405.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2001 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
J Immunol 2001; 166:1405-1413; ;
doi: 10.4049/jimmunol.166.2.1405
http://www.jimmunol.org/content/166/2/1405
Targeting Murine Immune Responses to Selected T Cell- or
Antibody-Defined Determinants of the Hepatitis B Surface
Antigen by Plasmid DNA Vaccines Encoding Chimeric
Antigen1
Reinhold Schirmbeck,2* Xin Zheng,† Michael Roggendorf,† Michael Geissler,‡
Francis V. Chisari,§ Jörg Reimann,* and Mengji Lu†
T
he fine specificity and biological role of individual components of complex (humoral and cellular) immune responses to viral Ags are difficult to study. An ideal approach would be to replace Ab-binding sites or T cell-defined
epitopes of the Ag with non-cross-reactive or nonimmunogenic
sequences and change as little as possible of the basic conformation of the Ag. This can be achieved by exchanging homologous
sequences of Ags from different but related viruses that maintain
the basic conformation of the Ag that is of critical importance for
its immunogenicity for T and B cells. The correct posttranslational
modifications, dimerizations, or assemblies into complex quaternary structures are essential factors in the immunogenicity of viral
Ags. In particular, the formation of pseudocapsids or virus-like
particles (VLP)3 conveys unique properties on viral Ags for Ab
binding as well as for Ag processing (1, 2).
*Institute of Medical Microbiology and Immunology, University of Ulm, Ulm, Germany; †Institute of Virology, University of Essen, Essen, Germany; ‡Department of
Internal Medicine II, University Hospital of Freiburg, Freiburg, Germany; and §Division of Experimental Pathology, The Scripps Research Institute, La Jolla, CA 92037
Received for publication July 28, 2000. Accepted for publication October 25, 2000.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This work was supported by German Federal Ministry for Science and Technology
Grants 01GE 9907, DFG Schi 505/2-1, and IZKF/A10 (to R.S. and J.R.), the IFORES
program of the University of Essen (01GE 9907, to M.L. and M.R.), and SFB 364 (to
M.G.), National Institutes of Health Grants CA40489 and CA54560 (to F.V.C.).
2
Address correspondence and reprint requests to Dr. Reinhold Schirmbeck, Institute
for Medical Microbiology and Immunology, University of Ulm, Albert Einstein
Allee 11, D-89081 Ulm, Germany. E-mail address: reinhold.schirmbeck@medizin.
uni-ulm.de
3
Abbreviations used in this paper: VLP, virus-like particle; MHC-I, MHC class I;
MHC-II, MHC class II; HBsAg, hepatitis B surface Ag; WHsAg, woodchuck hepatitis surface Ag; S, small-surface HBsAg; MS, middle-surface (pre-S2/S) HBsAg; LS,
large-surface (pre-S1/pre-S2/S) HBsAg; HBV, hepatitis B virus; WHV, woodchuck
hepatitis virus; wt, wild type; B6, C57BL/6J; tg, transgenic; HBs-tg, tg line B6TgN(Alb1HBV)44Bri expressing in the liver LS, MS, and S; CHO, Chinese hamster
ovary.
Copyright © 2001 by The American Association of Immunologists
In DNA vaccination, proteins are expressed after transient in
vivo transfection and subjected to the same posttranslational
modifications, changes in conformation, or oligomerizations as
during virus infection. In contrast to recombinant Ags purified
from eukaryotic or prokaryotic expression systems, genetic vaccination readily maintains the integrity of epitopes that stimulate neutralizing Ab (B cell) responses. DNA (or RNA) immunization is known to be exceptionally potent in stimulating T
cell responses because antigenic peptides are efficiently generated from intracellular or extracellular protein Ags expressed
from introduced genes in endogenous or exogenous processing
pathways (without interference by viral proteins) (3, 4). In DNA
vaccines, sequences can easily be exchanged between Ag-encoding genes to construct chimeric immunogens. We constructed chimeric VLP from the middle-surface (MS) Ag containing woodchuck hepatitis virus (WHV) and/or hepatitis B
virus (HBV) determinants. Three surface protein species are
present in the envelope of HBV virions, designated the largesurface (LS) (pre-S1/pre-S2/S), MS (pre-S2/S), and small-surface (S) proteins. In the LS protein (p39, gp42), the 108-residue
pre-S1 sequence and the 55-residue pre-S2 sequence precede
the S protein; in the MS protein (p31), the 55-residue pre-S2
sequence precedes the S protein (reviewed in Ref. 1). Using
DNA-based vaccination, we characterized the humoral (serum
Ab) and cellular (CTL) response of mice to selected determinants or epitopes of HBV expressed by these VLP. The MS
proteins from HBV and WHV have sequence homology of
about 70% (1). We show that Ab-defined pre-S2 determinants
(of MS) and “a” determinants (of S), as well as the Ld- and
Kb-restricted CTL epitopes of HBV, show no cross-reaction to
the respective determinants of MS or S from WHV. This approach allowed us to assay the biological role of selected Ab- or
CTL-defined determinants of the MS Ag in a transgenic (tg)
model.
0022-1767/01/$02.00
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
By exchanging sequences from the middle-surface (MS) and small-surface (S) Ag of hepatitis B virus (HBV) with corresponding
sequences of the MS Ag of woodchuck hepatitis virus, we constructed chimeric MS variants. Using these constructs as DNA
vaccines in mice, we selectively primed highly specific (non-cross-reactive) Ab responses to pre-S2 of the HBV MS Ag and the “a”
determinant of the HBV S Ag, as well as Ld- or Kb-restricted CTL responses to HBV S epitopes. In transgenic mice that
constitutively express large amounts of HBV surface Ag in the liver we could successfully suppress serum antigenemia (but not
Ag production in the liver) by adoptive transfer of anti-pre-S2 or anti-“a” immunity but not CTL immunity. DNA vaccines greatly
facilitate construction of chimeric fusion Ags that efficiently prime specific, high-affinity Ab and CTL responses. Such vaccines, in
which sequences of an Ag of interest are exchanged between different but related viruses, are interesting tools for focusing humoral
or cellular immunity on selected antigenic determinants and elucidating their biological role. The Journal of Immunology, 2001,
166: 1405–1413.
1406
Materials and Methods
Mice
C57BL/6J (B6) mice (H-2b) and BALB/cJ (H-2d) mice were kept under
standard pathogen-free conditions in the animal colonies of Ulm University
(Ulm, Germany). B6-TgN(Alb1HBV)44Bri-tg (HBs-tg) mice were obtained from The Jackson Laboratory (Bar Harbor, ME). Mice were used at
10 –16 wk of age.
Ag-encoding plasmid DNA used for nucleic acid vaccination
Vaccination of mice
Adult mice were immunized i.m. into the tibialis anterior muscle with the
indicated amounts of plasmid DNA as described previously (7). For the
adoptive transfer experiments, spleens were obtained from B6 mice primed
and boosted with the indicated vaccines. Single-cell suspensions were prepared from these spleens in PBS/BSA. A total of 3 ⫻ 107 spleen cells were
injected i.p. or i.v. into HBs-tg hosts. Where indicated, CD4⫹ T cells were
suppressed in mice by repeated i.p. injections of 200 ␮g anti-CD4 mAb
YTS 191.1 (in 200 ␮l PBS) as described previously (8, 9). For Ab transfer
(serotherapy), 200 ␮l sera containing the indicated levels of anti-“a” reactivity or anti-pre-S2 reactivity from DNA-immunized mice was
injected i.p.
harvested, washed, and assayed for HBsAg-specific cytolytic reactivity as
described previously (10).
Determination of serum Ab levels
Serum samples were repeatedly obtained from individual, immunized, or
control mice by tail bleedings at different time points postinjection. Abs
against the HBV-S protein were detected in mouse sera using the commercial IMxAUSAB test (cat. no. 7A39-20; Abbott). Ab levels were quantified using six standard sera. The tested sera were diluted so that the
measured OD values were between standard serums one and six. Values
presented in this paper were calculated by multiplying the serum dilution
by the measured Ab level (mIU/ml). In addition, HBsAg-specific IgG serum Abs were determined by an end-point dilution ELISA. MicroELISA
plates (Maxisorp; Nunc, Wiesbaden, Germany) were coated with 150 ng
recombinant HBV- or WHV-derived surface Ag particles per well in 50 ␮l
0.1 M sodium carbonate buffer (pH 9.5) at 4°C. Serial dilutions of the sera
in loading buffer (PBS supplemented with 3% BSA and 2% Tween 20)
were added to the Ag-coated wells. Serum Abs were incubated for 2 h at
37°C followed by four washes with PBS supplemented with 0.05% Tween
20. Bound serum Abs were detected using HRP-conjugated anti-mouse
IgG Abs (cat. no. 02067E; PharMingen, Hamburg, Germany) at a dilution
of 1:2000 followed by incubation with o-phenylendiamine and 2⫻ HCl
(cat. no. 6172-24; Abbott) in PBS (pH 6.0). The reaction was stopped by
1 M H2SO4, and the extinction was determined at 492 nm. End-point titers
were defined as the highest serum dilution that resulted in an absorbance
value three times greater than that of negative control sera (derived from
nonimmunized mice).
Western blot analyses
Western blotting was performed as described previously (11). cT-HBV/
pre-S1pre-S2 fusion Ag expressed in Chinese hamster ovary (CHO) cells
was immunoprecipitated using an anti-T-Ag Ab. Immunoprecipitates were
processed for SDS-PAGE, and proteins were electroblotted onto nitrocellulose paper. Thereafter, sheets were incubated with murine serum Abs (at
the indicated dilutions), washed, and incubated with 1:500 diluted rabbit
anti-mouse Abs (a generous gift of Dr. W. Deppert, Heinrich-Pette-Institut,
Hamburg, Germany). Ab reactivity was developed with 35S-labeled
protein A.
Recombinant HBsAg
Nonglycosylated HBsAg containing the S protein of HBV was produced in
the Hansenula polymorpha host strain RB10 (12). HBsAg particles purified
from crude yeast extracts by adsorption to silica gel, column chromatography, and isopyknic ultracentrifugation were obtained from Dr. K. Melber
(Rhein Biotech, Düsseldorf, Germany) (12). Mixed HBsAg particles were
expressed in CHO cells (a generous gift from Drs. M. Goreki and N. Moav,
Bio-Technology General, Rehovot, Israel) as described (13). In these cells,
HBsAg genes are expressed under the control of the S gene promoter. The
transfected CHO cells synthesize and secrete HBsAg particles, which are
harvested from the growth medium using a combination of gel exclusion
and ion exchange chromatography. The peptide composition, analyzed by
SDS-PAGE with a reducing agent, revealed glycosylated and nonglycosylated LS (pre-S1/pre-S2/S), MS (pre-S2/S), and S proteins. WHsAg was
extracted from serum stocks of chronically WHV-infected woodchucks as
described previously (14). These recombinant Ags allowed us to detect
HBV- or WHV-specific pre-S2 and/or S Ab responses.
Results
Construction of chimeric MS Ags of HBV and WHV
HBsAg expression in transiently transfected cells
LMH-chicken hepatoma cells (a generous gift of Dr. H.-J. Schlicht, Ulm,
Germany) were transiently transfected with the indicated plasmid DNA
using the CaPO4 precipitation method or the commercial liposome-based
FuGENE6 transfection reagent (cat. no.1815091; Roche Diagnostics,
Mannheim, Germany). Two days later, steady-state levels of secreted
HBsAg particles were quantitatively determined in supernatants of cells
using a commercial AXSYM HBsAg (V2) kit (cat. no. 7A40-22; Abbott,
Wiesbaden, Germany).
HBsAg-specific CTL
Single-cell suspensions were prepared from spleens of immunized mice. A
total of 3 ⫻ 107 responder cells were cocultured with 1 ⫻ 106 irradiated
syngenic HBsAg-expressing transfectants. Where indicated, 3 ⫻ 107 responder cells were cocultured with 1 ⫻ 106 irradiated syngenic stimulator
cells pulsed with recombinant HBsAg. After 5 days of culture, CTL were
The MS Ag of HBV comprises the 55-aa pre-S2 and the 226-aa S
sequence. It contains different Ab-binding determinants and (H-2d
or H-2b) CTL-defined epitopes (Fig. 1A). Most human and murine
anti-S Abs bind to the conformational “a” determinant located at
the S120 –147 region (1, 15–17). In H-2d and H-2b mice, Ab responses but not CTL responses are readily primed against determinants in the pre-S2 domain of HBsAg (11). The S Ag contains
the Ld-restricted CTL epitope S28 –39 (18) and the Kb-restricted
CTL epitopes S208 –215 (19) and S172–191 (this study).
We designed four plasmids encoding chimeric MS that contained surface Ag sequences from either HBV or WHV (Fig. 1B).
Construct I encodes the pre-S2 domain and the N-terminal 1–120
aa of the S Ag of HBV and the C terminus of the S Ag of WHV.
It contains the Ld-restricted S28 –39 CTL epitope, but neither the
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
The coding regions of hepatitis B surface Ag (HBsAg) and woodchuck
hepatitis surface Ag (WHsAg) were dissected by PCR. The following
primers were used for constructing chimeric genes from HBsAg and
WHsAg: PCR-defined coding regions included HBsAg-55/120 with primers HBs55s ATCCTCAGGCCATGCAGTGG (sense, 3163a)/HBs120a
CTGCAATTGCCCGTGCTGGTAGTTG (antisense, 521a), HBsAg-55/147
with primers HBs55s ATCCTCAGGCCATGCAGTGG (sense, 3163a)/
HBs147a ATACACGTGCAATTTCCGTCCG (antisense, 605a), HBs-148/
226 with primers HBs148s ATTGCACGTGTATTCCCATCCC (sense,
593a)/HBsstop CCATCTTTTTGTTTTGTTAGGG (antisense, 860a), HBs121/147 with primers HBs121s CGGGCAATTGCAGAACCTGCATGACT
(sense, 509a)/HBs147a ATACACGTGCAATTTCCGTCCG (antisense, 605a),
WHs-121/226 with WHs121s CAGTCAATTGCAGACAATGC (sense, 636b)/
Wsp2 CCACCATTTTGTTTTATTAA (antisense, 987b), WHs-148/226 with
primers WHs148s ATTGCACGTGTTGGCCCATC (sense, 720b)/Wsp2
CCACCATTTTGTTTTATTAA (antisense, 987b), WHs-55/147 with primers
Wpre-S2 CAGTTAACTATGAAAAATCAGAC (sense, 107b)/WHs147a
CCAACACGTGCAATTTCCTGCC (antisense, 733b), and WHs-55/120 with
primers Wpre-S2 CAGTTAACTATGAAAAATCAGAC (sense, 107b)/
WHs120a GTCTGCAATTGACTGTGTTGTTTC (antisense, 650b). The
numbering of the HBV genomea and WHV genomeb is according to Refs.
5 and 6.
Sequences of eight primers were modified to create MunI and BbrpI
sites for the construction of chimeric HBsAg/WHsAg genes. PCR fragments
were cloned into pCR2.1 according to the manufacturer’s instructions. The
cloned fragments were subjected to DNA sequencing analysis to verify the
correctness of the sequences. These fragments were recloned into pcDNA3
at the restriction sites HindIII and XhoI. Four chimeric genes of HBsAg and
WHsAg were constructed by ligation of fragments: construct I with HBs55/120 and WHs-121/226, construct II with HBs-55/147 and WHs-148/
226, construct III with WHs-55/147 and HBs-148/226, and construct IV
with WHs-55/120, HBs-120/147, and WHs-148/226. The fragments were
ligated either by the MunI site at junction 120/121 or by the Bbrp I site at
junction 147/148. In the generated plasmid constructs, the Ags were expressed under control of the human CMV immediate early promoter.
IMMUNE RESPONSES TO CHIMERIC VIRAL Ag
The Journal of Immunology
1407
FIGURE 1. A, Map of antigenic regions
within the HBV MS Ag. The 55-aa pre-S2
region, the “a” determinant, and murine
CTL epitopes within the 226-aa S Ag are
indicated. B, Chimeric constructs (I-IV) encoding different proportions of the HBV and
WHV MS Ag. The proportion of WHV preS2/S Ag as well as the presence of HBVspecific antigenic regions are indicated.
Priming CTL responses to HBsAg by injecting recombinant
plasmid DNA encoding chimeric HBV/WHV MS Ag
BALB/c and B6 mice were injected i.m. with 100 ␮g plasmid
DNA encoding wild-type (wt) MS (pre-S2/S) from either HBV or
WHV. Immune spleen cells were restimulated in vitro with irradiated syngenic transfectants expressing either the LS (pre-S1/preS2/S) or the S of HBV (19 –21) and assayed for specific CTL
reactivity. HBV S-specific CTL reactivity was readily detected in
mice vaccinated with MS-encoding plasmid DNA from HBV but
not WHV (Fig. 2, A and C, lanes a and b). These CTL were
specific for either the immunodominant, Ld-restricted HBV S28 –39
epitope in BALB/c mice (Fig. 2B, lanes a and b) or the Kb-restricted HBV S172–191 peptide in B6 mice (Fig. 2D, lanes a and b).
The latter CTL epitope was recognized by spleen cells from
primed B6 mice in the context of Kb because peptide-pulsed P1-Kb
cells (Kb-expressing P815 transfectants) were efficiently lysed
(Fig. 2D, lane a). Mapping of the correct Kb-binding motif in this
20-mer proved to be difficult because of the extreme hydrophobicity of this peptide. In addition, we analyzed HBV S-specific
CTL reactivity in B6 mice generated during MHC class I (MHCI)-restricted processing of recombinant (exogenous) but not endogenous expressed HBsAg (19). Spleen cells derived from immunized B6 mice were restimulated in vitro with irradiated
syngenic cells pulsed with recombinant HBsAg as described previously (19). CTL specific for exogenous HBsAg (Fig. 2E) and the
Kb-restricted HBV S208 –215 peptide (Fig. 2F) were detected in
mice vaccinated with MS-encoding plasmid DNA from HBV but
not from WHV (Fig. 2, E and F, lanes a and b). Our readout was
not designed to detect CTL reactivity in H-2d or H-2b mice specific
for MS from WHV. The data indicate that if CTL are primed by
plasmid DNA vaccination to epitopes of the MS Ag of WHV, they
do not cross-react with the known CTL epitopes of the MS Ag
of HBV. The sequence of the CTL epitope(s) S28 –39 IPQSLDSW
WTSL from HBV differs in three positions: IAQMLDWWWTSL
from the respective sequence of the WHV surface Ag; the sequence of the Kb-binding S172–191 epitope WLSLLVPFVQW
FVGLSPTVW of HBV differs in nine positions WLNLLV
PLLQWLGGISLIAW from the respective sequence of WHV S
Ag; and the Kb-binding S208 –215 epitope ILSPFLPL of HBV differs in three positions: ILPPFIPI from the respective sequence of
the S Ag of WHV. The species differences in the sequences of the
MS Ag from HBV and WHV are thus large enough to exclude
cross-reactivity at the CTL level.
In the next series of experiments, we immunized mice with plasmid DNA encoding the chimeric expression constructs I-IV. Vaccination of BALB/c mice with DNA from construct I or II but not
construct III or IV elicited S-specific CTL (Fig. 2A, lanes c–f).
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
Kb-restricted CTL epitopes nor the Ab-defined “a” determinant of
HBV S Ag. Construct II encodes the pre-S2 domain and the Nterminal 1–147 aa of the S Ag of HBV and the C terminus of the
S Ag of WHV. It contains the “a” determinant, as well as the
Ld-restricted S28 –39 CTL epitope, but does not include the Kbrestricted CTL epitopes of HBV because the C-terminal sequence
is from WHV. Construct III encodes the C-terminal 148 –226 aa of
S Ag of HBV and the corresponding N terminus (including the
pre-S2 domain) of S Ag of WHV. It contains only the Kb-restricted
CTL epitopes of S Ag from HBV. Construct IV encodes the 120 –
147 aa domain of the S Ag of HBV, whereas the remaining pre-S2,
N-terminal, and C-terminal S sequences were from WHV. It contains only the “a” determinant of the S Ag of HBV. These four
constructs allowed us to prime humoral and CTL responses to
selected determinants of the MS Ag of HBV by DNA vaccination
in mice.
1408
IMMUNE RESPONSES TO CHIMERIC VIRAL Ag
These CTL were Ld-restricted and specific for the well-known
S28 –39 epitope (Fig. 2B, lanes c and d). Vaccination of B6 mice
with DNA from construct III but not construct I, II, or IV primed
CTL that were specific for the Kb-restricted HBV S172–191 peptide
generated during endogenous processing of HBsAg (Figs. 2C,
lanes c–f, and 2D, lane c) and the Kb-restricted HBV S208 –215
peptide generated during exogenous processing of HBsAg (Figs.
2E, lanes c and d; 2F, lane c; and data not shown). All CTL
expressed the CD3⫹CD8⫹CD4⫺ surface phenotype (data not
shown). These results confirm the known MHC-I-restricted
epitopes of S Ag from HBV that are recognized by CTL from
vaccinated H-2d or H-2b mice. They demonstrate that these
epitopes are equally well processed from wt or chimeric MS Ag.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 2. Induction of HBV S-specific CTL.
BALB/c mice (A and B) or B6 mice (C–F) were injected
i.m. with 100 ␮g DNA encoding the MS Ag from HBV
or WHV, or the hybrid constructs I, II, III, or IV, or not
encoding any Ag (control). Specific CTL reactivity was
determined in spleen cell populations of primed mice 4
wk postvaccination. Cells were restimulated in vitro with
syngenic HBsAg-expressing transfectants (A–D) or with
stimulator cells pulsed with recombinant HBsAg (E and
F) and tested in a standard 4-h 51Cr release assay. Targets
were: P815/S and nontransfected P815 cells (A); P815
cells pulsed for 1 h with 10⫺8 M of the S28 –39 peptide and
untreated P815 cells (B); RBL5/LS cells and nontransfected RBL5 cells (C); P1-Kb cells pulsed for 1 h with
10⫺8 M of the S172–191 peptide and untreated P1-Kb cells
(D); RBL5 cells pulsed for 1 h with recombinant HBsAg
and untreated RBL5 cells (E); and P1-Kb cells pulsed for
1 h with 10⫺8 M of the S208 –215 peptide and untreated
P1-Kb cells (F). In the data shown, spleens from three
mice/group were pooled, restimulated in vitro, and assayed for specific CTL lysis. Mean lysis values measured
at an E:T ratio of 20:1 are shown (the unspecific lysis
values against the nontransfected or nonpulsed target
cells were subtracted).
The studies did not reveal cryptic or subdominant CTL-defined
epitopes of the MS Ag of HBV that could prime CTL when immunodominant epitopes are deleted.
Vaccination with plasmid DNA encoding chimeric HBV/WHV
MS Ag primes species-specific Ab responses to pre-S2 and “a”
determinants
Mice were primed and boosted with plasmid DNA encoding either
the wt MS Ag from HBV or WHV, or one of the chimeric HBV/
WHV MS Ags. Sera were collected at different time points postvaccination. Serum Abs binding to the conformational “a” determinant of the HBsAg were detected in the commercial
The Journal of Immunology
IMxAUSAB test (Abbott) and were measured in mIU/ml. This
read-out revealed “a”-specific Abs in mice vaccinated with plasmid
DNA encoding either the wt MS Ag of HBV or the chimeric MS
Ags II and IV (Fig. 3A, lanes a, d, and f). No “a”-specific Abs were
measurable in mice vaccinated with wt MS Ag from WHV or with
the chimeric MS Ags I and III (Fig. 3A, lanes b, c, and e). Priming
Ab responses against the “a” determinant of the S Ag of HBV thus
correlated with the presence of the S120 –147 sequence of HBV (Fig.
1B). This was confirmed when we studied the expression of wt or
chimeric MS Ag in vitro in cells transiently transfected with plasmid DNA that was also used for DNA vaccination (Fig. 3B). Release by cells of MS Ag bearing the “a” determinant was measured
48 h posttransfection in the commercial AXSYM HBsAg (V2)
ELISA (Abbott) that relies on “a”-specific mAb. The assay detected HBV-specific “a”-bearing MS Ag in supernatants conditioned by cells transfected with DNA encoding wt HBV MS Ag or
the chimeric MS Ags II and IV (Fig. 3B, lanes a, d, and f). The
level of HBsAg expression was lower in cells transfected with
construct IV (compare lanes a and d with lane f). In contrast,
“a”-bearing MS Ag was not detected in cells transfected with DNA
encoding wt WHV MS Ag or the chimeric MS Ags I or III (Fig.
3B, lanes b, c, and e). Thus, the murine Ab response to the “a”
determinant of the HBsAg shows no cross-reactivity to the “a”
determinant of the WHsAg.
Pre-S2-specific IgG Abs binding to the N-terminal domain of
the MS Ag of HBV were measured in an end-point dilution ELISA
using different recombinant HBsAg for detection (Fig. 3, C and D).
A similar pattern of Ab binding to HBV S Ag was seen, both when
yeast-derived S particles were used as the test Ag in the ELISA
and when the commercial ELISA test was used (compare Fig. 3, A
and C). An apparently similar Ab-binding pattern was seen when
CHO-derived HBV large surface Ag (composed of LS, MS, and S
Ag) (13) was used for Ab detection (Fig. 3D, lanes a, d, and f).
With the latter test Ag we detected Abs binding to the native
pre-S2 domain of the MS Ag of HBV that were elicited by vaccination with DNA encoding construct I (Fig. 3D, lane c). Note
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 3. Induction of surface Agspecific Ab responses. B6 mice were injected i.m. with 100 ␮g DNA encoding
HBV MS, WHV MS, or the hybrid constructs I-IV. Eight weeks postvaccination, mice were boosted with the same
constructs, and serum samples were
collected 2– 8 wk after the booster. We
tested serum probes for the presence of
specific Abs using the commercial antiHBV S ELISA (A). Expression of secreted MS particles carrying the HBV
“a” determinant was detected in transiently transfected cells (B). LMH cells
were transfected with the indicated
plasmid constructs. At 36 h, the culture
medium was changed. After 12 h, supernatants were analyzed for secreted
HBsAg levels (ng/ml) by a commercial
ELISA. HBV- and WHV-specific IgG
serum Abs were determined by endpoint dilution ELISA using yeast-derived HBV S Ag particles (C), CHOderived HBV LS particles (containing
LS, MS, and S Ag of HBV) (D), or
WHV LS particles (containing LS, MS,
and S Ag of WHV) (E) for detection.
Furthermore, serum Abs were tested in
Western blot analyses using the cTHBV/pre-S1pre-S2 fusion Ag for detection (F). Mean Ab titers ⫾ SEM of two
to five mice/group are shown.
1409
1410
CD4⫹ T cell-dependent Ab responses against the pre-S2 or the
“a” domain of the MS Ag suppress HBsAg antigenemia of
HBs-tg mice
We used HBs-tg mice (24) to test the biological effect of Ab responses primed to selected domains of the MS Ag. HBs-tg mice
produce large amounts of surface particles from HBV (containing
LS, MS, and S Ag) in the liver, and readily detectable levels of
antigenemia build up in their blood and peripheral tissues. Using
an adoptive transfer system described previously (9), we engrafted
immune cells with different well-characterized immune reactivities
to MS Ag into congenic HBs-tg hosts. We have shown that this
adoptive transfer of congenic immune spleen cells into HBs-tg
hosts establishes a stable and rising CD4⫹ T cell-dependent Ab
response to HBsAg that suppresses antigenemia (9, 25).
B6 mice were primed and boosted by injections of plasmid
DNA encoding either the wt MS Ag of HBV or the hybrid MS Ag
constructs I-IV. The immune mice were shown to have developed
the expected Ab and CTL reactivity against MS described above
(Figs. 2 and 3). Injection of serum from immune B6 mice into
HBs-tg hosts (serotherapy) transiently suppressed HBsAg antigenemia in some (Fig. 4, F–H and K) but not all (Fig. 4I) groups of
treated tg mice. We injected i.p. either 200 ␮l serum containing
either 260 mIU (Fig. 4F), 190 mIU (Fig. 4H), or 40 mIU (Fig. 4K)
anti-“a” seroreactivity, or antiserum with a 1:3000 anti-pre-S2 titer
(Fig. 4G). Suppression of HBsAg antigenemia was transient, and
serum HBsAg always reappeared 2–10 days after the serotherapy.
HBsAg antigenemia was transiently suppressed in mice injected
with sera from immune donor B6 mice vaccinated with plasmid
DNA encoding wt MS Ag from HBV or chimeric MS Ag expressed from constructs I, II, and IV (Fig. 4, F–H and K). HBsAg
antigenemia was not suppressed in HBs-tg hosts injected with immune sera from B6 donor mice vaccinated with plasmid DNA
encoding chimeric MS Ag expressed by construct III or injected
with 100 ␮l nonimmune sera (from donor B6 mice injected with
noncoding plasmid DNA) (Fig. 4I, and data not shown). The transfer of Abs specific for either the “a” determinant (Fig. 4K) or the
pre-S2 determinant (Fig. 4G) of MS from HBV could therefore
transiently suppress HBsAg antigenemia in HBs-tg mice.
A stable suppression of HBsAg antigenemia and the establishment of stable MS-specific Ab titers were obtained in HBs-tg mice
by adoptive transfer of immune spleen cells from B6 donors vaccinated with plasmid DNA encoding wt or some of the chimeric
variants of MS (Fig. 4, A–E). The transfer of immune spleen cells
(3 ⫻ 107 cells/mouse) from B6 donor mice vaccinated with plasmid DNA encoding wt MS of HBV (Fig. 4A) or with the chimeric
variant MS constructs I, II, or IV (Fig. 4, B, C, and E) but not III
(Fig. 4D) led to stable suppression of HBsAg antigenemia and
the appearance of a HBV S-specific serum Ab titer in the
HBs-tg host (Fig. 4, A, C, and E). The HBsAg-specific serum
Ab titers increased for months posttransplantation in the HBs-tg
hosts, suggesting a restimulation of the Ab response in the
adoptive host by transgene-encoded HBsAg (Refs. 9, 25, and
26, and data not shown). A stable suppression of HBsAg antigenemia in the absence of anti-S serum Ab titers was observed
in tg mice transplanted with cells from immune donors vaccinated with plasmid DNA encoding construct I (Fig. 4B). However, sera of these transplanted mice contained increasing serum Ab levels binding the HBV pre-S2 domain of MS that
efficiently clear up serum HBsAg antigenemia (Fig. 4B). Hence,
all serum HBsAg particles in HBs-tg mice carry Ab-binding
pre-S2 determinants (present on the LS or MS Ags) and can be
eliminated by an Ab-dependent effector mechanism specific for
this epitope.
The establishment of stable humoral immunity to HBsAg was
CD4⫹ T cell dependent because the depletion of CD4⫹ T cells
from the immune donor cell inoculum prevented its establishment
in the tg host (data not shown), confirming previously published
data (9, 26). Thus, primed donor-derived CD4⫹ T cells are critical
for the establishment of HBsAg-specific Ab responses in the
HBs-tg host. The immunity to HBsAg we adoptively established in
HBs-tg mice did not suppress HBsAg expression in the liver from
the transgene. Despite the rising titers of anti-HBsAg Abs and the
stable suppression of HBsAg antigenemia in transplanted HBs-tg
mice, we detected no decrease in the HBsAg content of the liver
(data not shown), confirming previous data (9, 26). Furthermore,
we detected no increase in serum transaminase levels after immune
cell transfer and/or Ab transfer, indicating that the adoptive transfer of this type of immunity does not damage HBsAg-expressing
liver cells.
A MHC-I (H-2b)-restricted CTL reactivity against epitopes in
the C terminus of HBsAg was present in immune cell populations
primed by plasmid DNA encoding either the complete wt MS Ag
of HBV or the chimeric MS Ag III (Figs. 1 and 2). Using immune
spleen cells from B6 mice vaccinated with DNA of construct III,
we selectively transferred the Kb-restricted CTL (immune cells did
not contain anti-HBV “a” or pre-S2-reactivity) to HBs-tg hosts
(Fig. 4D). However, this transfer established neither humoral (Fig.
4D) nor cellular immunity to HBsAg (data not shown) in the tg
host, nor did it induce histopathological changes in the liver or a
rise in serum transaminase levels (data not shown) when tested
at different time points posttransfer. In addition, the tg-specific
HBsAg expression in the liver was not reduced. Following transfer
of immune spleen cells from B6 donors vaccinated with these two
vector DNA constructs, we could not recover this HBsAg-specific
CTL reactivity from the adoptive tg host posttransfer (data not
shown). This further confirms our previously published data (9). It
seems that the H-2b-restricted, HBsAg-specific CTL that were
transferred in these experiments were rapidly silenced in the tg
recipients. This is in contrast to the observation that transplantation
of large numbers of H-2d-restricted, HBsAg-specific CTL were
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
that these mice had no Abs in the serum that bound to the “a”
determinant of the S Ag of HBV (Fig. 3, A and C, lane c). Abs
binding the pre-S2 domain of the MS Ag of HBV were also detected in Western blot analyses. We have described a system that
allows stable expression of mutated, truncated, or chimeric protein
domains fused to a hsp73-binding cytosolic T-Ag fragment (11,
22, 23). We expressed the N-terminal 163-aa pre-S (i.e., preS1pre-S2) domain of the LS Ag of HBV in this system (11). These
analyses showed that Abs binding to linear epitopes of the HBV
pre-S2 domain were present in the serum of mice vaccinated with
DNA encoding construct I or II (or wt MS Ag of HBV) but not
with DNA encoding wt MS Ag of WHV or construct III or IV
(which all contained a pre-S2 domain of the MS Ag of WHV) (Fig.
3F, and data not shown).
In addition, we analyzed by ELISA the serum Ab response of
vaccinated mice against the pre-S2 or “a” determinant of the surface Ag of WHV, using surface particles purified from the serum
of chronically WHV-infected woodchucks (which contain LS, MS,
and S Ag from WHV) (Fig. 3E). Abs binding WHV-derived surface particles were present in sera of mice vaccinated with DNA
encoding wt MS from WHV but not from HBV (Fig. 3E, lanes a
and b). These Abs do not cross-react with the S and LS Ag of HBV
(Fig. 3, C and D, lane b). Similar to the exquisite species specificity of the murine CTL response to epitopes on the S Ag of HBV,
the murine Ab response to the pre-S2 and to the “a” determinant of
the MS Ag of HBV is specific and does not cross-react with homologous determinants of the MS Ag from WHV.
IMMUNE RESPONSES TO CHIMERIC VIRAL Ag
The Journal of Immunology
1411
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 4. Transfer of immune cells (A–E), but not passive Ab transfer with sera (serotheraphy) (F–K), establishes stable HBsAg immunity in HBs-tg
hosts. B6 mice were primed and boosted with 100 ␮g DNA encoding HBV MS Ag or the plasmids encoding the hybrid constructs I-IV. From parallel
immunized animals we confirmed anti HBV-specific humoral and cellular immunity (for detail, see Figs. 2 and 3). The presence or absence of HBV pre-S2
or “a” determinant Abs and of Kb-restricted CTL are indicated. Spleen cells (3 ⫻ 107 cells/mouse) from individual donor mice were injected i.p. into HBs-tg
B6 hosts (immune cell transfer). Alternatively, we injected 200 ␮l serum pooled from three immunized donor mice (Ab transfer); the sera contained 260
mIU (F), 190 mIU (H), and 40 mIU (K) anti-HBV S Ab titers, 1:3000 anti-HBV pre-S2 Ab titer (G), or no detectable anti-HBsAg Abs (I). At the indicated
time points posttransfer, we quantitatively determined serum HBsAg (E) of treated HBs-tg mice using a commercial AXSYM HBsAg (V2) kit (A–I). Mean
anti-HBV S Ab titers (F) were tested in mouse sera using the commercial IMxAUSAB test. Ab titers (mIU/ml) ⫾ SEM of three transplanted mice/group
measured at different time points postinjection are shown (A–K). We further quantitatively determined serum pre-S2 Ab titers (ⴱ) in HBs-tg hosts adoptively
transferred with construct I-primed spleen cells using HBV LS Ag (containing LS, MS, and S Ag of HBV) for detection (B).
detectable for 2– 4 wk posttransfer in adoptive tg hosts (reviewed
in Ref. 27).
Discussion
Serum Ab responses of mice to the pre-S2 and “a” determinant of
the HBV MS Ag were elicited by DNA vaccines encoding natural
or chimeric MS Ag and showed no cross-reactivity to the homologous determinants of the WHV MS Ag. Neither HBV, nor WHV,
nor any other known species of the Hepadnavirus group are natural pathogens of the mouse. The exceptional serological specificity observed may result either from the two MS Ags chosen or
from the use of DNA vaccination (which preferentially primes
1412
biological role of individual components of anti-viral immune
responses.
Acknowledgments
The expert technical assistance of T. Güntert and T. Krieg are gratefully
acknowledged. We thank Dr. K. Melber (Rhein Biotech, Düsseldorf, Germany) for purified yeast-derived HBV S particles, Drs. M. Goreki and N.
Moav (Bio-Technology General) for CHO-derived HBV LS particles, and
Dr. H. J. Schild (Institute for Cell Biology, Tübingen, Germany) for P1-Kb
cells.
References
1. Heermann, K.-H., and W. H. Gerlich. 1991. Surface proteins of hepatitis B virus.
In Molecular Biology of Hepatitis B Virus. A. McLachlan, ed. CRC Press, Boca
Raton, Ann Arbor, Boston, London, p. 109.
2. Reimann, J., and R. Schirmbeck. 1999. Alternative processing pathways for exogenous and endogenous antigens that can generate peptides for MHC class
I-restricted presentation. Immunol. Rev. 171:131.
3. Donnelly, J. J., J. B. Ulmer, J. W. Shiver, and M. A. Liu. 1997. DNA vaccines.
Annu. Rev. Immunol. 15:617.
4. Gurunathan, S., D. M. Klinman, and R. A. Seder. 2000. DNA vaccines: immunology, application and optimization. Annu. Rev. Immunol. 18:927.
5. Stoll, B. S., R. Repp, D. Glebe, S. Schaefer, J. Kreuder, M. Kann, F. Lampert, and
W. H. Gerlich. 1997. Transcription of hepatitis B virus in peripheral blood mononuclear cells from persistently infected patients. J. Virol. 71:5399.
6. Girones, R., P. J. Cote, W. E. Hornbuckle, B. C. Tennant, J. L. Gerin,
R. H. Purcell, and R. H. Miller. 1989. Complete nucleotide sequence of a molecular clone of woodchuck hepatitis virus that is infectious in the natural host.
Proc. Natl. Acad. Sci. USA 86:1846.
7. Davis, H. L., R. Schirmbeck, J. Reimann, and R. G. Whalen. 1995. DNA-mediated immunization in mice induces a potent MHC class I-restricted cytotoxic T
lymphocyte response to hepatitis B virus surface antigen. Hum. Gene Ther.
6:1447.
8. Wild, J., M. J. Grusby, R. Schirmbeck, and J. Reimann. 1999. Priming MHC-Irestricted, cytotoxic T lymphocyte responses to exogenous hepatitis B surface
antigen is CD4⫹ T cell-dependent. J. Immunol. 163:1880.
9. Schirmbeck, R., J. Wild, D. Stober, H. E. Blum, F. V. Chisari, M. Geissler, and
J. Reimann. 2000. Ongoing murine T1 or T2 immune responses to the hepatitis
B surface antigen are excluded from the liver that expresses transgene-encoded
hepatitis B surface antigen. J. Immunol. 164:4235.
10. Böhm, W., A. Kuhröber, T. Paier, T. Mertens, J. Reimann, and R. Schirmbeck.
1996. DNA vector constructs that prime hepatitis B surface antigen-specific cytotoxic T lymphocytes and antibody responses in mice after intramuscular injection. J. Immunol. Methods 193:29.
11. Schirmbeck, R., O. Gerstner, and J. Reimann. 1999. Truncated or chimeric endogenous protein antigens gain immunogenicity for B cells by stress proteinfacilitated expression. Eur. J. Immunol. 29:1740.
12. Janowicz, Z. A., K. Melber, A. Merckelbach, E. Jacobs, N. Harford,
M. Comberbach, and C. P. Hollenberg. 1991. Simultaneous expression of the S
and L surface antigens of hepatitis B, and formation of mixed particles in the
methylotrophic yeast, Hansenula polymorpha. Yeast 7:431.
13. Diminsky, D., R. Schirmbeck, J. Reimann, and Y. Barenholz. 1997. Comparison
between surface antigen (HBsAg) particles derived from mammalian cells (CHO)
and yeast cells (Hansenula polymorpha): composition, structure and immunogenicity. Vaccine 15:637.
14. Menne, S., J. Maschke, M. Lu, W. H. Grosse, and M. Roggendorf. 1998. T-cell
response to woodchuck hepatitis virus (WHV) antigens during acute self-limited
WHV infection and convalescence and after viral challenge. J. Virol. 72:6083.
15. Shouval, D., Y. Ilan, R. Adler, R. Deepen, A. Panet, C. Z. Even, M. Gorecki, and
W. H. Gerlich. 1994. Improved immunogenicity in mice of a mammalian cellderived recombinant hepatitis B vaccine containing pre-S1 and pre-S2 antigens as
compared with conventional yeast-derived vaccines. Vaccine 12:1453.
16. Prange, R., M. Werr, M. Birkner, R. Hilfrich, and R. E. Streeck. 1995. Properties
of modified hepatitis B virus surface antigen particles carrying pre-S epitopes.
J. Gen. Virol. 76:2131.
17. Le, S. J., P. Chouteau, I. Cannie, G. C. Guguen, and P. Gripon. 1998. Role of the
pre-S2 domain of the large envelope protein in hepatitis B virus assembly and
infectivity. J. Virol. 72:5573.
18. Ishikawa, T., D. H. Kono, P. Fowler, A. N. Theofilopoulos, S. Kakumu, and
F. V. Chisari. 1998. Polyclonality and multispecificity of the CTL response to a
single viral epitope. J. Immunol. 161:5842.
19. Schirmbeck, R., J. Wild, and J. Reimann. 1998. Similar as well as distinct MHCI-binding peptides are generated by exogenous and endogenous processing of
hepatitis B virus surface antigen (HBsAg). Eur. J. Immunol. 28:4149.
20. Schirmbeck, R., K. Melber, A. Kuhröber, Z. A. Janowicz, and J. Reimann. 1994.
Immunization with soluble hepatitis B virus surface (S) protein particles elicits
murine H-2 class I-restricted CD8⫹ cytotoxic T lymphocyte responses in vivo.
J. Immunol. 152:1110.
21. Schirmbeck, R., K. Melber, T. Mertens, and J. Reimann. 1994. Selective stimulation of murine cytotoxic T cell and antibody responses by particulate or monomeric hepatitis B virus surface (S) antigen. Eur. J. Immunol. 24:1088.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
high-affinity Abs). The HBV “a” determinant is the immunodominant, Ab-defined epitope of the S Ag. It has some variability, is a
conformational epitope on the surface of HBsAg particles, and is
formed exclusively by protein (although there is a glycosylation
site in the “a” region). The large majority of variants of the HBsAg
“a” determinants stimulate cross-reactive Ab responses; this underlies the efficacy of the currently used commercial anti-HBV
vaccine. Our data suggest that the “a” determinants on the WHsAg
are quite different. Our data confirm the importance of anti-pre-S2
Abs, which has been suggested before (15, 16, 28). This supports
the notion that a new generation of anti-HBV vaccine should contain this epitope. Similar to the data described by the group previously (9), the Ab responses to the pre-S2 and the “a” determinant
described in this study were IgG, and their induction was CD4⫹ T
cell dependent. This was shown in CD4⫹ T cell depletion experiments (data not shown). The adoptive-transferred immune
CD4⫹ T cell populations were restimulated in HBs-tg mice by host
HBsAg (9). No restimulation by WHV-derived determinants took
place in the adoptive host (data not shown). The MHC class II
(MHC-II)-binding epitopes of HBsAg that stimulate CD4⫹ T cell
responses in B6 H-2b mice are not known. This suggests either that
there is extensive cross-reactivity between CD4⫹ T cell-defined
epitopes from WHsAg and HBsAg (in contrast to B cell- and CTLdefined epitopes) or that many CD4⫹ T cell-defined epitopes are
present in HBsAg. The i.m. injection of a high dose of a DNA
vaccine is known to prime Th1-biased responses. The complement-fixing IgG2a isotype was largely over-represented in the Ab
responses we measured (data not shown). Rising titers of these Abs
in the serum of transplanted HBs-tg mice did not induce damage in
the liver, the site of HBsAg secretion in the tg mice, confirming
our previously published data (9).
We primed CTL with non-cross-reactive specificity to epitopes
of the HBV S Ag by DNA vaccines encoding wt or chimeric Ag.
The approach allowed us to confirm the presence of an N-terminal
Ld- and two C-terminal Kb-restricted CTL epitopes on the S Ag of
HBV. Different (DNA- or protein-based) vaccination techniques
have not revealed additional (subdominant or cryptic) CTL
epitopes of HBsAg in B6 mice. These data generated in H-2d and
H-2b mice make it unlikely that additional immunodominant or
subdominant epitopes of the HBV S Ag will be discovered in these
strains and confirm the absence of H-2d and H-2b CTL-defined
epitopes in the HBV pre-S2 domain (11). This was independently
confirmed in vaccination experiments with chimeric DNA vaccines expressing 80- to 100-aa fragments of HBsAg fused to heterologous viral Ags (data not shown). This was unexpected because different computer screening programs indicated a multitude
of Kb- and Db-binding 8-mer and 9-mer motifs in the HBsAg molecule. The two Kb-restricted epitopes of HBsAg we defined in B6
mice are unusual. The Kb/S208 –215 epitope is only generated by
cells processing exogenous HBsAg (19). Processing and presentation of this epitope is TAP and brefeldin A independent but
blocked by NH4Cl or selected acid-protease inhibitors. In contrast,
the Kb/S172–191 epitope is generated by endogenous processing of
HBsAg. Fine mapping of this epitope is difficult because the sequence is extremely hydrophobic. Within 12 h posttransfer, the
adoptively transferred, Kb-restricted CTL immunity was lost in
HBs-tg hosts. The mechanism that silences these CD8⫹ T cells in
HBs-tg mice is unknown. Therefore, in the HBs-tg host, the maintenance of the Th1 CD4⫹ T cell-dependent humoral immunity to
HBsAg in vivo seems independent of the immunoregulatory control of CD8⫹ T cells (29). The experimental approach of priming
humoral or cellular immune responses to selected determinants of
a complex viral Ag is thus an efficient technique for defining the
IMMUNE RESPONSES TO CHIMERIC VIRAL Ag
The Journal of Immunology
22. Schirmbeck, R., and J. Reimann. 1994. Peptide transporter-independent, stress
protein-mediated endosomal processing of endogenous protein antigens for major
histocompatibility complex class I presentation. Eur. J. Immunol. 24:1478.
23. Schirmbeck, R., W. Bohm, and J. Reimann. 1997. Stress protein (hsp73)-mediated, TAP-independent processing of endogenous, truncated SV40 large T antigen for Db-restricted peptide presentation. Eur. J. Immunol. 27:2016.
24. Chisari, F. V., K. Klopchin, T. Moriyama, C. Pasquinelli, H. A. Dunsdorf, S. Sell,
C. A. Pinkert, R. L. Brinster, and R. D. Palmiter. 1989. Molecular pathogenesis
of hepatocellular carcinoma in hepatitis B virus transgenic mice. Cell 59:1145.
25. Moriyama, T., S. Guilhot, K. Klopchin, B. Moss, C. A. Pinkert, R. D. Palmiter,
R. L. Brinster, O. Kanagawa, and F. V. Chisari. 1990. Immunobiology and pathogenesis of hepatocellular injury in hepatitis B virus transgenic mice. Science
248:361.
1413
26. Wirth, S., L. G. Guidotti, K.-I. Ando, H. J. Schlicht, and F. V. Chisari. 1995.
Breaking tolerance leads to autoantibody production but not autoimmune liver
disease in hepatitis B virus envelope transgenic mice. J. Immunol. 154:2504.
27. Chisari, F. V., and C. Ferrari. 1995. Hepatitis B virus immunopathogenesis.
Annu. Rev. Immunol. 13:29.
28. Milich, D. R., J. E. Jones, A. McLachlan, G. Bitter, A. Moriarty, and
J. L. Hughes. 1990. Importance of subtype in the immune response to the pre-S(2)
region of the hepatitis B surface antigen. II. Synthetic pre-S(2) immunogen. J. Immunol. 144:3544.
29. Gurunathan, S., L. Stobie C. Prussin, D. L. Sacks, N. Glaichenhaus, D. J. Fowell,
R. M. Locksley, J. T. Chang, C. Y. Wu, and R. A. Seder. 2000. Requirement for
the maintenance of Th1. immunity in vivo following DNA vaccination: a potential immunoregulatory role for CD8⫹ T cells. J. Immunol. 165: 915.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017