Volume 3
†
Number 1
†
March 2010
10.1093/biohorizons/hzq006
Advance Access publication 23 February 2010
.........................................................................................................................................................................................................................................
Research article
TnAbaR1: a novel Tn7-related transposon in
Acinetobacter baumannii that contributes to the
accumulation and dissemination of large
repertoires of resistance genes
Alexander Rose*
Department of Infection, Immunity and Inflammation, University of Leicester, UK.
* Corresponding author: Lab 212, Department of Infection, Immunity and Inflammation, Maurice Shock Medical Sciences Building, University of Leicester,
University Road, Leicester LE1 9HN, UK. Tel: þ44 0116 2523056. Email: [email protected]
Supervisor: Kumar Rajakumar, Department of Infection, Immunity and Inflammation, University of Leicester, UK.
........................................................................................................................................................................................................................................
Acinetobacter baumannii is an opportunistic bacterial pathogen that is a frequent cause of severe hospital-associated infections.
Treatment is problematic given the organism’s cunning ability to acquire antibiotic resistance. Indeed, strains resistant to almost all antibiotics have already emerged. Several A. baumannii strains for which the genome sequence has been determined contain large clusters
of chromosomally integrated resistance genes. AbaR1, the archetypal A. baumannii ‘resistance island’ found in strain AYE, harbours 45
resistance genes. We investigated the hypothesis that AbaR1-like islands were mobile. Many chromosomally integrated elements exhibit
low frequency spontaneous excision. However, use of a highly sensitive PCR assay targeting the hypothesized empty integration site
failed to reveal evidence of excision in any of the island-bearing strains examined, suggesting that if excision was occurring it was extremely rare. Bioinformatics analyses of island termini across multiple strains suggested that these islands had arisen from an ancestral
transposon, distantly related to Tn7, which had accumulated, often in a nested fashion, multiple transposons, integrons and resistance
gene cassettes. Accordingly, we have renamed AbaR1 as TnAbaR1. The first three of the five tandem genes located at the 30 -comM terminus of TnAbaR1 showed marked similarities at a Blastp and/or domain level to their cognate transposition-associated partners in Tn7.
TnAbaR1 also shared other Tn7 features: short imperfect terminal inverted repeats, site-specific insertion, flanking 5 bp (base pair) perfect
direct repeats and rare-to-non-existent spontaneous excision. Tn7-related transposons are highly promiscuous given their ability to
exploit two distinct mobilization pathways—stable integration into a unique chromosomal site or homing onto conjugative plasmids
for onward transfer to a new host. With a single known exception, TnAbaR1-like transposons map uniquely to the comM gene.
However, we have now identified a multidrug-resistant A. baumannii strain harbouring two TnAbaR1-like transposons, both located at
completely novel loci, further substantiating the mobile TnAbaR1 hypothesis. TnAbaR1-like elements have undoubtedly contributed
to the rapid emergence of antibiotic resistance in this increasing important human pathogen. Ominously, like its distant relative Tn7,
TnAbaR1 may exhibit the potential to jump bacterial species readily, thus posing the risk of widespread dissemination of large,
single assemblage repositories of resistance genes and threatening the emergence of a post-antibiotic era.
Key words: Acinetobacter baumannii, antibiotic resistance, transposon, Tn7.
Submitted on 30 September 2009; accepted on 19 January 2010
........................................................................................................................................................................................................................................
Introduction
Acinetobacter baumannii is a Gram-negative, aerobic, nonmotile bacterium of considerable clinical importance1.
A. baumannii strains have been isolated from diverse locations
within the clinical environment including the skin and faecal
microbiota of healthy individuals, a variety of foods and
.........................................................................................................................................................................................................................................
#
The Author 2010. Published by Oxford University Press. This is an Open Access article distributed under the terms of the Creative Commons
Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/2.5), which permits unrestricted non-commercial use, distri40
bution, and reproduction in any medium, provided the original work is properly cited.
Research article
Bioscience Horizons
† Volume 3 † Number 1 † March 2010
.........................................................................................................................................................................................................................................
different hospital surfaces2 – 4. It is an opportunistic pathogen
that has become an increasingly common cause of nosocomial
infections5. Ventilator-associated pneumonia and bloodstream infections are the most serious diseases caused by
A. baumannii and have been associated with mortality rates
as high as 75%6. Recently A. baumannii infections have
emerged as a particularly significant cause of wound infections
in soldiers fighting in Iraq7 – 9. One of the most striking features
of this organism is its ability to acquire and accumulate a wide
repertoire of antibiotic resistance genes rapidly10. This has
resulted in the emergence of numerous distinct multidrugresistant (MDR) A. baumannii strains over a short period.
Strains that are resistant to almost all clinically available antibiotics are being recognized with increasing frequency10. To
tackle this serious and escalating problem we need to deepen
our understanding of the precise mechanisms and factors
that contribute to acquisition and spread of antibiotic resistance in this bacterial species.
Unlike the DNA blueprints of higher organisms, bacterial
genomes exhibit an extraordinary degree of plasticity and
intra-species diversity11. A key feature is the constant mobility
of various segments of the genome both within a single cell and
between cells. This mobility plays a significant role in the evolution of bacteria through fine tuning of genetic architecture
and the lateral acquisition of new genes that may provide a survival advantage, thus further adapting bacteria to new
environments12. Bacterial cells acquire foreign DNA in three
ways: transduction of bacteriophage-encapsidated DNA,
transformation of free DNA and conjugative transfer of plasmids and other replicons. As well as genetic mobility
between cells, particular segments of DNA such as insertion
sequences (IS), transposons, integrons, gene cassettes and integrative islands frequently move within the genome of a single
bacterial cell11.
In 2006, Fournier et al. described an 86 kb resistance
island integrated within an ATPase gene (subsequently
renamed comM) of the MDR A. baumannii strain AYE
which they named AbaR113. The genome sequence of this
bacterium has been determined. AbaR1 contained 45 putative resistance genes and had a significantly higher G-C
content than the rest of the AYE genome, indicating that it
had been acquired horizontally from a foreign source13.
Subsequent studies have identified five further islands with
broadly similar features to AbaR1; all but one is located at
an identical site to AbaR114 – 17. The smaller 18 kb AbaR4
in strain AB0057 was the first, and currently only,
AbaR1-like island described at a locus other than the
comM gene16. Further work demonstrated that 80% of
clinical MDR A. baumannii strains contained AbaR1-like
islands within their comM genes identifying an additional
eight AbaR1-like sequences18. Surprisingly though, besides
the recognition of flanking 5 bp perfect direct repeats (DR)
and the presence of two genes towards the 30 comM end of
the island that have been annotated as putative transposition
genes, no further characterization of the mobility features of
AbaR1 or its relatives has been reported.
Tn7 is a well studied, highly promiscuous cut-and-paste
transposon that is found in a wide variety of bacteria; it
encodes resistance to trimethoprim and streptomycin. The
mobility related regions of Tn7 consists of the five-gene
tnsA-tnsB-tnsC-tnsD-tnsE operon and short imperfect terminal inverted repeats (TIR) that act as substrates for the transposase proteins. Transposition of Tn7 is controlled much
more tightly than that of many other transposons using
two distinct pathways. TnsABC þ D transposition moves
Tn7 at a high frequency into a specific site within the
genome that does not disrupt vital genes, therefore ensuring
its survival within the cell. TnsABC þ E transposition targets
Tn7 towards conjugative plasmids, particularly those that
have just relocated, thus promoting its spread to other
cells. Importantly, the Tn7-specific insertion site, attTn7, is
known to be highly conserved among diverse bacteria.
Through these sophisticated molecular homing mechanisms,
Tn7-related transposons have been able to disseminate,
survive and proliferate within a wide spectrum of the bacterial kingdom19.
This study aimed to examine mobility-associated features
of AbaR1-like islands and in the process identified striking
similarities between the versatile Tn7 and AbaR1. In
addition, our analysis led to the discovery of an entirely
novel insertion sequence that appeared to target
AbaR1-like islands. Given the findings we report, we have
re-designated the resistance island AbaR1 as the T7-related
transposon TnAbaR1 and propose that this mega-resistance
transposon represents the archetypal member of novel class
of highly successful resistance gene vectors that have
already disseminated widely among MDR A. baumannii
strains.
Materials and methods
Bacterial strains and media
The multidrug resistant A. baumannii clinical isolates A1,
A14, A473 and AYE were used in this study. AYE is the
strain in which AbaR1 was first identified13, and it has had
its genome sequence determined. The laboratory
Escherichia coli strain DH5a was used for ligation experiments20. All strains were grown at 378C in LB broth or
LB agar supplemented with ampicillin (100 mg ml21)
where appropriate.
DNA extraction and manipulation
Genomic DNA was extracted using the 5Prime DNA purification kit, and plasmid DNA was extracted using the Omega
Plasmid mini kit (Norcross, USA) according to the manufacturer’s instructions. DNA fragments were retrieved from
agarose gels using the Omega Gel extraction kit according
.........................................................................................................................................................................................................................................
41
Research article
Bioscience Horizons † Volume 3 † Number 1 † March 2010
.........................................................................................................................................................................................................................................
to the manufacturer’s instructions. Ligation into the T-vector
pGEMT-easy (Promega, Madison, USA) was carried out
using T4 DNA ligase (Promega) according to the manufacturer’s instructions.
databases22. Comparisons of related sequences were made
using the same tools. Phylogenetic trees were constructed
using a MEGA 3.1 alignment and the neighbour-joining
method. Bootstrap percent values (1000 replicates) are
shown at the nodes.
PCR assay for spontaneous island excision
Primers 4R (AATCGATGCGGTCGAGTAAC) and 2F
(TCCATTTTACCGCCACTTTC)18 located externally to
the putative AbaR1 island termini were used with Taq
DNA polymerase (Promega) and 50 ng genomic DNA as a
template. Cycling conditions were 60 cycles of 30 s at
948C, 30 s at 578C and 30 s at 728C. Any amplified
product of the expected size (445 bp) was ligated into
pGEMT-easy, its sequence determined and compared with
the expected fusion junction sequence for that strain. Strain
A473, shown to have an unoccupied comM gene was used
as a positive control. The sensitivity of this assay was
tested using a ‘dilution series’ comprising a total 50 ng of
template A. baumannii genomic DNA with varying ratios
of A473 and A1 DNA. A. baumannii A1 harbours an
island within its comM gene. The expected amplicon was
repeatedly detectable with A473 genomic DNA concentrations as low as 1 copy in 106 copies of A1 genomic DNA.
Two-step chromosome walking, sequencing and primers
Two-step chromosome walking was carried out as described
by Pilhofer et al 21. Briefly, a single primer facing into the
unknown region was used in a PCR reaction catalysed by
Taq DNA polymerase. Cycling conditions were 30 cycles
at a suitable annealing temperature (Tm) for the primer, 1
cycle a Tm of 408C and a further 30 cycles at a suitable Tm
for the primer. Extension time for each cycle was 3 min.
The entire PCR product was then sequenced using a nested
primer as the sequencing primer. Reactions to determine
nucleotide sequences were carried out by MWG Biotech
(Ebersberg, Germany). In strain A473, PCR primers PR520
(CCATTGTCTTAAACAGTCGGC) and PR521 (CGTTGT
AAAGCAATCTGCCA) were used with the nested primers
PR519 (CCTGTACGCTGAATAGTCGCT) and PR522
(CCCTCATAACCGACAACCAC), respectively, to amplify
1885 bp of sequence using this technique. A further 999 bp
of sequence was amplified using standard PCR with
primers HYPP1F (GTTTGAATCGACCCTTGAGC) and
PR524 (CCGATCCGTCAAGGGTATTA). Strain A473 was
subsequently interrogated with primers TniAF (CATCCCC
AATCGTTAAATGG), TniAR (TTTTCTTTTRCGCTTTC
GAT) and HYPP1F. Primers PR325 (CAAAGATCCCCTC
AAACTGG) and PR326 (ATCAGGGTCAAGTGGTC
TGG) were designed specifically to target IShypp2.
Bioinformatics analyses
Blastn and Blastp tools were used to search for homology of
obtained DNA sequences at a nucleotide, amino acid and
conserved domain level to anything within the NCBI
Results
AbaR1-like islands do not appear to exhibit
spontaneous excision
Given the large sizes, site-specific location of AbaR1-like
islands and presence of a conserved integrase catalytic
domain within the AbaR1-encoded TniA, we chose to investigate the possibility that these elements behaved in a way
reminiscent of other well-characterized integrative DNA
islands. Integrative islands exhibit three basic traits, integration, precise excision and self-circularization, mediated
by an integrase protein, a possible accessory excisionase
and cognate attP and attC integration sites on the circular
intermediate element and the chromosome, respectively23.
Excision results in the formation of a fusion junction at the
site previously occupied by the element. Spontaneous
AbaR1 excision was tested for using a sensitive PCR assay
to examine three MDR A. baumannii strains, A1, A14 and
AYE, known to harbour AbaR1-like islands within their
comM genes. PCR primers located externally to the island
termini were used to detect the hypothesized fusion junction
fragment (Fig. 1). If the comM-borne islands exhibited a
detectable rate of spontaneous excision, these primers
would amplify a 445 bp product; otherwise amplification
would fail. Despite 60 cycles of amplification, assay optimization to allow for detection of 1 copy of the hypothesized
fusion junction in a background of up to 106 copies of the
island-occupied comM gene, multiple replicate assays and
inclusion of numerous controls, no genuine fusion junctions
were identified. On three occasions weak bands corresponding to putative fusion junction products were obtained;
however, cloning and sequence determination of these amplicons revealed minor but consistent single nucleotide polymorphisms distinguishing these from the targeted loci and
suggesting the likelihood of cross-contamination with positive control DNA or stray Acinetobacter DNA. Our results
demonstrated that if excision of the AbaR1-like island was
occurring in any of the three strains tested, it was doing so
at a rate of less than 1026 per cell per generation, challenging
the integrative island hypothesis.
AbaR1 shows striking similarities to the highly
promiscuous Tn7 transposon
Bioinformatics analysis of the putative island termini of
AbaR1 demonstrated that it clearly originated as a transposon into which additional transposons and integrons have
subsequently integrated. It appears to be distantly related
.........................................................................................................................................................................................................................................
42
Bioscience Horizons
Research article
† Volume 3 † Number 1 † March 2010
.........................................................................................................................................................................................................................................
Figure 1. PCR assay testing for spontaneous island excision. (A) Expected failure of PCR amplification using primers 2F and 4R across the 86,693 bp
TnAbaR1 which is located within the comM gene; no PCR product is expected to be amplified. (B) If TnAbaR1 spontaneously excised a 445 bp product
would be amplified. (C) PCR products on agarose gel. Marker in lane 1, AYE template in lanes 2, 5 and 8, negative control DH5a template in lanes 3,
6 and 9, negative control water template in lanes 4, 7 and 10, and positive control A473 template in lane 11. Primers marked with blue kinked arrows
and genes with solid green arrows, 5 bp direct repeats and fusion junction represented by vertical red lines.
to the replicative and highly promiscuous transposon Tn7.
Accordingly, we have renamed AbaR1 as TnAbaR1. As previously reported, TnAbaR1 is flanked by perfect 5 bp DR
and imperfect (19/26 bp) TIR which are classical features
of transposons13,17. Further analysis shows that all of the
TnAbaR1-like sequences reported to date contain 5 bp DR
and identical TIR, including AbaR4, which is located at a
site other than the comM gene.
The five genes located in the same orientation at the
30 -comM end of TnAbaR1, namely orf1, tniA, tniB, orf2
and orf3, have the appearance of an operon. As shown in
Fig. 219 the arrangement of these genes is reminiscent of
the five gene Tn7 operon shown to mediate the mobility of
this highly promiscuous transposon. Despite little amino
acid homology to Tn7 proteins, the TnAbaR1 encoded
Orf1 contains a predicted TnsA N terminal conserved
domain. At an amino acid level there is also considerable
similarity of the TnAbaR1 proteins TniA and TniB to their
congnate partners TnsB and TnsC, respectively, found in
Tn7. TniA and TniB also have highly similar sequences at
an amino acid level to the corresponding proteins in other
reported Tn7-related transposons Tn5090, Tn5053 and
Tn5468 24 – 26. The final two proteins, Orf2 and Orf3 have
no apparent homology to proteins of Tn7.
In addition to the structural similarities, the behaviour of
TnAbaR1 has major parallels with that of Tn7. One of the
Tn7 transposition mechanisms, TnsABC þ D transposition,
promotes integration into a specific site, attTn7, within the
genome19. The presence of the TnAbaR1-like sequences at
an identical position within the comM gene of so many
A. baumannii strains suggests highly specific integration.
Furthermore, these sequences are always found in the same
orientation at this site, another feature of Tn7 transposition.
The multidrug resistant A. baumannii strain A473
contains two distinct TnAbaR1-like sequences that
map to two entirely novel loci
To date, with the single exception of AbaR4 from AB0057
which has been shown to be located at a second site, all
TnAbaR1-like sequences have been reported to be integrated
into a single locus, the comM gene13 – 18. Not only do these
sequences target the same gene, in all cases the
TnAbaR1-like elements integrate into an identical site
within the comM gene and are consequently flanked by the
same 5 bp ‘ACCGC’ DR sequence. PCR screening using
the primers TniAF and TniAR demonstrated that the MDR
A. baumannii strain A473 harboured a TnAbaR1-like tniA
gene but that the A473 tniA gene did not map to either of
the previously reported TnAbaR1-like integration loci as
both sites were shown to be ‘empty’ in A473 by PCR analysis. As expected, PCR-based chromosome walking revealed
that the A473 tniA gene was located within a
TnAbaR1-like transposon in an identical position and orientation as the other related elements (Fig. 3). Additionally,
this TnAbaR1-like transposon harboured a novel insertion
sequence, which we have named IShypp2 (see below for
details).
Surprisingly, PCR analysis of A473 genomic DNA with
primers HYPP1 and TniAR which were designed to amplify
across IShypp2 produced two distinct bands (Fig. 3). The
larger 3.2 kb band was the expected size for a TnAbaR1-like
sequence containing IShypp2, while the smaller 2.1 kb
product suggested a TnAbaR1-like transposon lacking
IShypp2. Sequence determination of the 2.1 kb PCR product
clearly demonstrated that it was part a TnAbaR1-like transposon but that on the basis of substantial sequence divergence
(only 1588/1647 bp were identical over matching regions) it
.........................................................................................................................................................................................................................................
43
Research article
Bioscience Horizons † Volume 3 † Number 1 † March 2010
.........................................................................................................................................................................................................................................
Figure 2. Similarities of TnAbaR1 to Tn7 and Tn5090 (A) Schematic comparing predicted transposition associated genes of TnAbaR1 to well-characterized
putative homologues in Tn7 and Tn5090. Percentages shown represent primary amino acid sequence identity and similarity in that order, respectively.
Genes are represented by solid arrows. NSH, no significant homology. Although TniA and TniB are more similar to the analogous proteins of the
Tn7-like transposon Tn5090, the predicted TnAbaR1 transposition-associated operon as a whole strongly resembled the five-gene operon of Tn7.
(B) –(G) Predicted conserved domains of the proteins coded for by the three proximal-most genes of TnAbaR1 and Tn7 as shown in the schematic
above. Orf2, Orf3, TnsD and TnsE have no predicted conserved domains. Scale represents the amino acid positions of the identified domains. TnsA superfamily responsible for DNA breakage, rve superfamily is an integrase core domain, Mu-transposases found in various integrases and transposases while
the P-loop NTPase superfamily is involved in a wide variety of cellular activities.
Figure 3. PCR-based interrogation of the TnAbaR1-like orf1 gene in strain A473 that was found to harbour two distinct TnAbaR1-like transposons.
(A) Sequence data relevant to this locus obtained by chromosome walking from strain A473 are indicated a purple lines aligned with genetic maps
from the sequenced strains AYE (containing TnAbaR1) and ATCC 17978 (containing IShypp2). Insertion site and DR of IShypp2 are shown as vertical red
lines. Primers are represented as kinked blue arrows and genes shown as solid green arrows. (B) PCR products obtained using primers HYPP1F and
TniAR as resolved on an agarose gel: Lane 1, DNA size ladder; Lane 2, AYE template DNA; Lane 3, A473 template DNA. Predicted amplicon sizes are
2121 bp and 3226 bp with template DNA lacking IShypp2 (such AYE) and harbouring IShypp2 (such as ATCC 17978), respectively. A473 appears to
harbour both forms of the interrogated TnAbaR1-like region (orf1-tniA).
.........................................................................................................................................................................................................................................
44
Bioscience Horizons
Research article
† Volume 3 † Number 1 † March 2010
.........................................................................................................................................................................................................................................
was distinct from the IShypp2-associated TnAbaR1-like transposon in A473 that we had first recognized. Thus, A473
became only the second know strain to harbour two copies
of TnAbaR1-like transposons. Furthermore, unlike AB0057
neither copy mapped to the comM gene.
The novel IS4– related insertional sequence IShypp2 is
found at an identical site in two TnAbaR1-like sequences
Chromosome walking in strain A473 identified the presence of
a transposase gene which we have demonstrated is a component
of a rare, 1.1 kb IS4-related IS element flanked by perfect 5 bp
DR and 13 bp TIR. We have named this element IShypp2. In
strain A473 IShypp2 interrupts the orf1 reading frame
(Fig. 3). The hypp2 gene borne on this element has only been
reported once before, within the TnAbaR1-like sequence of
the sequenced strain ATCC 17978 where it is annotated as
coding for a hypothetical protein15; ATCC 17978 also possesses the remaining parts of the IShypp2 element. In this
latter strain IShypp2 is located in the same orientation at an
identical location interrupting orf1 as in strain A473.
Furthermore the nucleotide sequence of IShypp2 in these two
strains is identical (1101/1101 bp). Nineteen further clinical
A. baumannii strains were screened for the presence of
IShypp2 using primers PR325 and PR326. Two of these
strains gave positive PCR results although IShypp2 could not
be linked to TnAbaR1-like sequences in either of these strains.
Discussion
The multiple similarities between TnAbaR1 and Tn7 identified in this study allowed us to state confidently that the
two transposons are distant relatives. The core transposition
machinery of Tn7, TnsA, TnsB and TnsC, showed significant
similarity at an amino acid level to the homologous proteins
of TnAbaR1 (Fig. 2). The remaining two proteins TnsD and
TnsE are involved in targeting Tn7 to its new insertion site19.
Since TnAbaR1 appeared to target an alternative, sequencedistinct site (comM), it would be logical for the TnAbaR1
proteins involved to be divergent from the analogous proteins of Tn7. Furthermore, three 21 bp imperfect repeat
sequences which may represent transposase-binding sites
similar to those identified in Tn7 have been identified at
the 30 comM-end of TnAbaR1 (Fig. 4A).
Tn7-like transposons are known to insert, via TnsABC þ
D transposition, at a high frequency specifically into a single
site (attTn7) downstream of the glmS gene that is highly conserved across many bacteria. Integration into this site does
not appear to have any negative effects on the cell, providing
the transposon with a ‘safe haven’ and allowing it to survive
vertically within the resultant bacterial lineage19. The fact
that 13 of the 16 known TnAbaR1-like sequences have
been found at a single precise-to-the base pair specific site
within the A. baumannii genome (comM) was strongly reminiscent of the behaviour of Tn7. However, it should be noted
that the apparent dominant predilection of these sequences
for comM may be partly explained by the fact that Shaikh
et al. only interrogated the comM site for TnAbaR1-like
elements18.
In addition to site-specificity, Tn7-like transposons are
known to integrate in an orientation specific manner. This is
thought to be due to the unique transposase-binding sites
found at each end of the transposon. All 13 TnAbaR1-like
sequences known to lie within the comM gene are present in
the same orientation, further reinforcing similarities to Tn7.
Tn7 also utilizes a second transposition pathway,
TnsABC þ E transposition, to promote its widespread dissemination. This mechanism targets an aspect of lagging strand
DNA synthesis, thus favouring insertion into actively conjugating plasmids, particularly those that have just entered the
recipient cell27. Transposition via this pathway also exhibits
orientational bias. In addition, Tn7 is very occasionally
found at chromosomal sites other than attTn7 as a result
of low level ‘mis-directed’ TnsABC þ E transposition. Yet
again, these errant Tn7 transposons are found with an orientational bias and are preferentially located within regions
close to the site of termination of chromosomal replication19.
We hypothesize that the three TnAbaR1-like sequences now
available at sites in A. baumannii other than comM. (AbaR4
and the two non-comM-associated sequences identified in
this study) represented insertion via a similar mechanism.
Despite being a cut-and-paste transposon, Tn7 does not
demonstrate spontaneous excision as the donor DNA is
repaired by homologous recombination with its sister
chromosome28. The donor DNA is therefore left genetically
identical once transposition of the ‘pseudo-replicative’ Tn7
has occurred, hence explaining the finding that our highly
sensitive PCR assay failed to demonstrate spontaneous excision of the TnAbaR1-like transposons.
The presence of two TnAbaR1-like transposons at entirely
novel loci in strain A473 also supports the mobile TnAbaR1
theory. Furthermore like the previously isolated equivalent
finding with AB0057, this result demonstrates that some
MDR A. baumannii strains harbour more than one
TnAbaR1-like transposon, suggesting a potential capacity
for resistance gene copy number amplification and/or
accumulation of larger resistance gene repertoires distributed
between two TnAbaR1-like gene vectors.
Tn7 is a highly versatile and promiscuous transposon
capable of wide cross-species dissemination. It is also one
of the few mobile elements capable of ‘transposition immunity’, which minimizes the risk of excessive intra-bacterial
transposition and consequent deleterious damage to host
DNA19. TnAbaR1 contains 45 putative antibiotic resistance
genes encoding resistance to a large proportion of clinically
available antibiotics13. Acquisition of TnAbaR1 in its
entirety could transform a highly susceptible bacterium
into an MDR strain in a single genetic quantum event29.
Given its carriage of large numbers of potent resistance
.........................................................................................................................................................................................................................................
45
Research article
Bioscience Horizons † Volume 3 † Number 1 † March 2010
.........................................................................................................................................................................................................................................
Figure 4. Key features of TnAbaR1 and IShypp2. (A) Schematic indicating characteristic features common to the family of TnAbaR1-like transposons.
Nucleotides comprising the direct repeat (DR) sequences are shown in red, while terminal inverted repeats (TIR) are indicated in blue. Genes are
shown as solid green arrows. The three imperfect 21 bp repeat sequences identified that we postulate may serve as transposase binding sites are underlined. The variable TnAbaR1-like cargo region that often harbours numerous resistance genes is represented as ‘x’. (B) Schematic features of IShypp2. The
putative transposase gene is shown as a solid yellow arrow, TIR are indicated in blue and flanking DR in red. The predicted promoter sequences of IShypp2
are underlined and the start and stop codons of the predicted transposase gene are marked in bold. (C) Inferred phylogenetic relationship of twenty-four
Tn7-like elements. Concatenated amino acid sequences of TnsABC for each element were used to construct the tree. Bootstrap percent values (1000 replicates) are shown at the nodes. The scale at the base represents inferred evolutionary distance. Host names of Tn7-like elements are as indicated.
.........................................................................................................................................................................................................................................
46
Research article
Bioscience Horizons
† Volume 3 † Number 1 † March 2010
.........................................................................................................................................................................................................................................
genes targeting the currently available spectrum of antimicrobial agents, the idea that TnAbaR1 may have the potential to mobilize in a similar fashion to Tn7 is particularly
alarming. Furthermore, should it be proven that TnAbaR1
behaved similarly to its distant relative Tn7, the possibility
would be substantially strengthened that the large number
of Tn7-like transposons that lie between these two poles of
the Tn7 family (Fig. 4C) also exhibited equivalent properties.
This study has also identified IShypp2, an extremely novel
IS4-like element that seems to be unique to A. baumannii
(Fig. 4B). Previously identified IS elements in A. baumannii,
including the well-characterized ISAba1, have been shown to
be play crucial roles in antibiotic resistance by providing
powerful promoters to native resistance genes30. IShypp2
may well be capable of playing such a role. The presence of
IShypp2 at an identical site interrupting orf1 within two separate TnAbaR1-like transposons is also intriguing. TnsA, the
analogous protein to Orf1 in Tn7, is crucial for transposition.
Although it is unlikely that the transposase protein of IShypp2
is involved directly in mobilization of TnAbaR1 since its TIR
are different to those of TnAbaR1, it is quite possible that
IShypp2 has a role to play in up-regulation or down-regulation
of TnAbaR1 transposition since it interrupts the crucial
orf1 gene.
Further investigations into the potential mobility and
impact of TnAbaR1-like transposons are clearly warranted.
We are currently generating a ‘mini-TnAbaR1-like’ element,
that will contain all features thought to be involved in
TnAbaR1 transposition and will use this mini-transposon construct to test for the hypothesized transposition and sitespecific integration event. TnAbaR1-like elements have
undoubtedly contributed to the rapid emergence of antibiotic
resistance in this increasing important human pathogen.
Ominously, like its distant relative Tn7, TnAbaR1 may
exhibit the potential to jump bacterial species readily, thus
posing the risk of widespread dissemination of large, single
assemblage repositories of resistance genes and threatening
the emergence of a post-antibiotic era.
Acknowledgements
We thank Hong-Yu Ou, Shanghai Jiaotong University (SJTU),
for his considerable support with bioinformatics analyses and
phylogenetic tree construction. We thank Xinyi He, SJTU, for
his previous work and guidance which laid the foundations of
this project. We thank Kevin Towner, Queen’s Medical
Centre, Nottingham, for providing clinical strains used in
this study. Finally, we thank all members of Lab 212 for
their support and advice throughout this project.
Bursary for Project work. This study was funded by British
Society for Antimicrobial Chemotherapy grant to KR.
Author biography
Alexander Rose is a medical student who undertook an
Intercalated BSc in bacterial genetics after his third year of
medical studies. This year-long research project allowed
him to develop his interest and knowledge in this clinically
important field significantly and tackle the challenges of
research work. After completing his medical studies he
intends to combine clinical and research work.
References
1. Vallenet D, Nordmann P, Barbe V et al. (2008) Comparative analysis of
acinetobacters: three genomes for three lifestyles. PLoS ONE 3: e1805.
doi:10.1371/journal.pone.0001805.
2. Berlau J, Aucken H, Malnick H et al. (1999) Distribution of Acinetobacter
species on skin of healthy humans. Eur J Clin Microbiol Infect Dis 18:
179 –183.
3. Berlau J, Aucken HM, Houang E et al. (1999) Isolation of Acinetobocter spp
including A. baumannii from vegetables: implications for hospital-acquired
infections. J Hosp Infect 42: 201 –204.
4. Catalano M, Quelle LS, Jeric PE et al. (1999) Survival of Acinetobacter baumannii on bed rails during an outbreak and during sporadic cases. J Hosp
Infect 42: 27– 35.
5. Dijkshoorn L, Nemec A, Seifert H (2007) An increasing threat in hospitals:
multidrug-resistant Acinetobacter baumannii. Nat Rev Microbiol 5: 939 –951.
6. Chastre J, Trouillet J (2000) Problem pathogens (Pseudomonas aerugı̀nosa
and Acı̀netobacter). Semin Respir Infect 15: 287 –298.
7. Scott PT, Petersen K, Fishbain J et al. (2004) Acinetobacter baumannii infections among patients at military medical facilities treating injured U.S.
Service members, 2002 –2004. J Am Med Assoc 292: 2964 –2966.
8. Calhoun JH, Murray CK, Manring MM (2008) Multidrug-resistant organisms in
military wounds from Iraq and Afghanistan. Clin Orthop 466: 1356 –1362.
9. Davis KA, Moran KA, McAllister CK et al. (2005) Multidrug-resistant
Acinetobacter extremity infections in soldiers. Emerg Infect Dis 11: 1218– 1224.
10. Bergogne-Bérézin E, Towner KJ (1996) Acinetobacter spp. as nosocomial
pathogens: microbiological, clinical, and epidemiological features. Clin
Microbiol Rev 9: 148– 165.
11. Bushman F (2002) Lateral DNA Transfer, 1st ed. Cold Spring Harbor, NY: Cold
Spring Harbor Laboratory Press.
12. Frost LS, Leplae R, Summers AO et al. (2005) Mobile genetic elements: the
agents of open source evolution. Nat Rev Microbiol 3: 722 –732.
13. Fournier P, Vallenet D, Barbe V et al. (2006) Comparative genomics of multidrug resistance in Acinetobacter baumannii. PLoS Genet 2: 62–72.
14. Iacono M, Villa L, Fortini D et al. (2008) Whole-genome pyrosequencing of an
epidemic multidrug-resistant Acinetobacter baumannii strain belonging to
the European clone II group. Antimicrob Agents Chemother 52: 2616 –2625.
15. Smith MG, Gianoulis TA, Pukatzki S et al. (2007) New insights into
Acinetobacter baumannii pathogenesis revealed by high-density pyrosequencing and transposon mutagenesis. Genes Develop 21: 601–614.
Funding
16. Adams MD, Goglin K, Molyneaux N et al. (2008) Comparative genome
sequence analysis of multidrug-resistant Acinetobacter baumannii.
J Bacteriol 190: 8053– 8064.
The author was supported by the Charles Lawson Bursary
for Intercalated Studies and a University of Leicester
17. Post V, Hall RM (2009) AbaR5, a large multiple-antibiotic resistance region
found in Acinetobacter baumannii. Antimicrob Agents Chemother 53:
2667 –2667-71.
.........................................................................................................................................................................................................................................
47
Research article
Bioscience Horizons † Volume 3 † Number 1 † March 2010
.........................................................................................................................................................................................................................................
18. Shaikh F, Spence RP, Levi K et al. (2009) ATPase genes of diverse
multidrug-resistant Acinetobacter baumannii isolates frequently harbour
integrated DNA. J Antimicrob Chemother 63: 260 –264.
19. Peters JE, Craig NL (2001) Tn7: smarter than we thought. Nat Rev Mol Cell Biol
2: 806– 814.
20. Ausubel FM (1987) Current Protocols in Molecular Biology. New York: Wiley.
21. Pilhofer M, Bauer AP, Schrallhammer M et al. (2007) Characterization of
bacterial operons consisting of two tubulins and a kinesin-like gene by
the novel two-step gene walking method. Nucleic Acids Res 35: e135.
doi:10.1093/nar/gkm836.
22. Altschul SF, Madden TL, Schäffer AA et al. (1997) Gapped BLAST and
PSI-BLAST: a new generation of protein database search programs. Nucleic
Acids Res 25: 3389 –3402.
23. Burrus V, Pavlovic G, Decaris B et al. (2002) Conjugative transposons: the tip
of the iceberg. Mol Microbiol 46: 601– 610.
24. Radstrom P, Skold O, Swedberg G et al. (1994) Transposon Tn5090 of plasmid
R751, which carries an integron, is related to Tn7, Mu, and the retroelements.
J Bacteriol 176: 3257 –3268.
25. Kholodii Ya G, Mindlin SZ, Bass IA et al. (1995) Four genes, two ends, and a
res region are involved in transposition of Tn5053: a paradigm for a novel
family of transposons carrying either a mer operon or an integron. Mol
Microbiol 17: 1189 –1200.
26. Oppon JC, Sarnovsky RJ, Craig NL et al. (1998) A Tn7-like transposon is
present in the glmUS region of the obligately chemoautolithotrophic bacterium Thiobacillus ferrooxidans. J Bacteriol 180: 3007 –3012.
27. Wolkow CA, DeBoy RT, Craig NL (1996) Conjugating plasmids are preferred
targets for Tn7. Genes Develop 10: 2145 –2157.
28. May EW, Craig NL (1996) Switching from cut-and-paste to replicative Tn7
transposition. Science 272: 401 –404.
29. Groisman EA, Ochman H (1996) Pathogenicity islands: bacterial evolution in
quantum leaps. Cell 87: 791 –794.
30. He’ritier C, Poirel L, Nordmann P (2006) Cephalosporinase over-expression
resulting from insertion of ISAba1 in Acinetobacter baumannii. Clin
Microbiol Infect 12: 123– 130.
........................................................................................................................................................................................................................................
.........................................................................................................................................................................................................................................
48