Difference in virus-binding activity of two distinct receptor proteins for

J ° u r n a / . . ° f Gen~'rai(V!r°/°g~' .().996!.'..77~..1.68'.:3Z!692:,,,.l~r![~ted.i.n..G[e.at,B[!tain .........................................................................................................................
Difference in virus-binding activity of two distinct receptor
proteins for mouse hepatitis virus
N o b u h i s a Ohtsuka, 1 Yasuko K. Y a m a d a 2 and Fumihiro TaguchP
1 National Institute of Neuroscience, NCNP, 4-1-10gawahigashi, Kodaira, Tokyo 1871, Japan
2 National Institute of Health, 4-7-1 Gakuen, Musashimurayama, Tokyo 190-122, Japan
The receptor proteins, MHVR1 (Bgp C or splice
variant of mmCGH1 containing two ectodomains)
and HHVR2 (mmCGM2) have been reported to be
functional receptors for MHV, although there was a
significant difference in their virus-binding activity
as determined by virus overlay protein blot assay
(VOPBA). To compare the receptor function of these
proteins, their virus-binding capacities were tested
by using soluble forms of the proteins which lacked
the transmembrane and intracytoplasmic domains.
To estimate the amounts of these proteins expressed, an epitope of influenza HA protein, for
which specific monoclonal antibody was available,
was used as a tag. Recombinant soluble HHVR1 and
MHVR2, expressed in RK 13 cells using recombinant
vaccinia virus were secreted into the culture fluids of
Introduction
The cell surface receptor is the first component with which
a virus interacts and is one of the major determinants of target
cell specificity. Virus receptor proteins have been reported for
several different viruses, including human immunodeficiency
virus (H1V) (Duke et aI., 1995 ; Maddon eta]., 1986), rhinovirus
(Staunton et a]., 1989; Greve eta]., 1989), poliovirus (Mendelsohn et al., 1989), murine leukaemia virus (Kim et al., 1991 ; H.
Wang et al., 1991), Sindbis virus (Ubol & Griffin, 1995; K. S.
Wang et al., 1991) and three different coronaviruses, porcine
transmissible gastroenteritis virus (Delmas et al., 1992), human
coronavirus (Yeager et a]., 1992) and routine coronavirus
(Dveksler et a]., 199i; Williams et al., 1990). Some of these
viruses are known to utilize different types of receptor proteins
in different types of cells. For example, HIV is known to utilize
the CD4 molecule expressed on T cells as a functional receptor
(Maddon et al., I986), but it also utilizes other receptors
Author for correspondence: Fumihiro Taguchi,
Fax +81 423 46 1754. e-mail [email protected]
0001-3855 © 1996 SGM
infected cells expressing these proteins. The inhibitory effect on virus infectivity of HHVR1 was
shown to be about 500-fold higher than that of
HHVR2. A similar disparity was observed in virus
binding by VOPBA. These two proteins worked as
functional receptors when they were expressed on
resistant BHK-21 cells. However, the efficiency of
HHV infection in BHK-21 cells expressing HHVR1
was about 30-fold higher, as compared with those
expressing HHVR2. These data show that the receptor function of HHVR1 was significantly higher
than that of MHVRZ and suggests that the difference
in susceptibility between SJL and BALB/c mice might
be due to the specific receptor protein expressed in
those animals.
expressed on muscle cells and neural cells (Clapham et al.,
1989; Harouse eta]., I991). It has also been shown that the
HIV-binding capacity of these receptor molecules differs
(Harouse et al., 1991). Sindbis virus is reported to utilize
receptors of different molecular mass in different cells or tissues
(UboI e¢ a]., 1991; K. S. Wang et aL, 1991). It is also documented
that mouse hepatitis virus (MHV) utilizes different isoforrns of
the receptor protein expressed in the brain and liver (Yokomori
& Lai, 1992a).
MHV belongs to the family Coronaviridae which is
composed of enveloped, positive-stranded RNA viruses,
associated with various diseases of economic importance in
both animals and humans (Siddell, I995; Spaan eta]., 1988).
MHV has a genome of about 31 kb which encodes four or five
structural proteins as well as several non-structural proteins
(Siddell, 1995; Spaan eta]., 1988). The spike, protruding from
the MHV virion, is composed of the spike (S) protein, which is
a heterodimer or trimer consisting of two non-covalently
bound S protein subunits (Cavanagh, 1995). The $1 protein is
thought to form the globular head of the spike and the $2 its
stalk portion (De Groot et al., 1987). Recently, we have shown
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 18:36:52
68:
that an N-terminal region comprising 330 amino acids of the
$1 of M H V had the receptor-binding activity (Kubo eta].,
1994), whereas the $2 subunit was not able to interact with the
receptor protein by itself (Taguchi, 1995).
Several different isoforms of biliary glycoproteins have
been reported to serve as a functional receptor for M H V
(Dveksler eta]., 1993a; McCuaig eta[., I993; Nedellec eta].,
1994). All of these proteins belong to the carcinoembryonic
antigen family which is classified as a member of the
immunoglobulin superfamily (Dveksler eta]., 1991; Williams et
a]., 1991). Some of these proteins have four ectodomains and
others have two ectodomains (Dveksler eta]., 1993 a; McCuaig
et al., 1993), in which the N domain located in the N-terminal
region has been shown to be necessary for virus binding
(Dveksler eta]., 1993 b). These receptor proteins can be divided
into two major groups, Bgp la and Bgp lb, as recently
proposed by Nedellec et al. (1994). The biggest difference
between these two groups is located in the C-terminal twothirds of the N domain (McCuaig eta[., 1993). The receptor
proteins described in this paper, MHVR1 and MHVR2, both of
which contain two ectodomains, belong to Bgp I a and Bgp I b,
respectively (McCuaig et al., 1993; Nedellec eta[., 1994).
Proteins of 110 to 120 kDa isolated from the intestine or
liver of susceptible BALB/c mice were first reported to interact
with M H V particles in a virus overlay protein blot assay
(VOPBA). Such proteins were not detected in resistant SJL
mice (Boyle et al., 1987). This protein was thereafter identified
as mmCGM1, a protein with four ectodomains (classified as
Bgp I a) and also occurs as a splice variant of mmCGM1
containing two ectodomains (Bgp C; designated MHVR1 in
this paper). These proteins were shown to function as receptor
proteins for MHV-A59 (Dveksler et aI., 1991). This finding
could imply that the difference in susceptibility of SJL and
BALB/c mouse strains to M H V infection may be due to the
presence or absence of a functional receptor. In SJL mice
however, the homologous protein to MHVR1, named
m m C G M 2 with two ectodomains (classified in Bgp I b and
called MHVR2 in this paper), was also found and shown to be
a functional receptor (Yokomori & Lai, 1992 a, b). From these
results, the difference in susceptibility to M H V was not
therefore explainable by the presence or absence of functional
receptors. Interestingly, it was observed that MHVR1, but not
MHVR2, was detected by VOPBA (Boyle et al., 1987; Williams
et aI., 1990). This may suggest that there is a significant,
functional difference in virus-binding properties between these
two receptor proteins. In the present study, we compared the
virus-binding capacities of these proteins by using recombinant, soluble forms of these proteins. We demonstrated by
VOPBA and virus neutralization that MHVR1 retained a very
high virus-binding capacity as compared with MHVR2. Also,
BHK-21 cells expressing M H V R I (BHK-MHVR1) are more
sensitive to M H V infection than BHK cells expressing MHVR2
(BHK-MHVR2). The difference in receptor function observed
between these two types of cells may account for the
;8,
differential susceptibility to M H V infection observed between
SJL mice expressing MHVR2 and BALB/c mice expressing
MHVR1.
Methods
• Viruses and cells. The MHV strains JHMV cl-2 (Taguchi et at.,
I985) and JHMV sp-4 (Taguchi & Fleming, I989), both of which were
shown to interact with MHVR1 (Taguchi, 1995), were used in the present
study. These viruses were propagated and plaque assayed on DBT cells
as previously reported (Taguchi el a]., 1980). The recombinant vaccinia
virus (VV) vTF7.3 encoding the T7 RNA polymerase (Fuerst et at., 1986,
1987), kindly provided by B. Moss, was used to express MHV-specific
receptor proteins in a VV transient expression system, vTF7.3 was
propagated and plaque-assayed on RK 13 cells. These cells were grown
in Dulbecco's modified Eagle's minimal essential medium (DMEM,
Nissui, Tokyo) supplemented with 7% calf serum (Gibco) and 10%
tryptose phosphate broth (TPB; Difco). BHK-21 cells, used to express
MHV receptors with transmembrane and intracytoplasmic domains,
were cultured in DMEM supplemented with 10% fetal calf serum (FCS;
Gibco).
• Construction of the vectors to express soluble receptor
proteins. Two different isoforms of MHV receptor protein were
expressed using the VV transient expression system: the gene product of
mL900 (designated in this paper as MHVRI), which is identical to
MHVR1 (2d) (Dveksler et al., 1993 a) or Bgp C (McCuaig et al., 1993), and
that of SLmL900 (Yamada et al., 1993), which is designated in this paper
as MHVR2 and is almost identical to mmCGM2 (Yokomori & Lai,
1992a) (Fig. 1). The genes, originally cloned into pT7 Blue vector (pT7;
Novagen), were manipulated to delete their transmembrane and
intracytoplasmic domains by PCR. The genes were also manipulated to
incorporate at the C terminus a linear epitope found in the haemagglutinin
of influenza virus (amino acid sequence YPYDVPDYA) which can be
detected using a monoclonaI antibody (MAb) specific for this epitope
(Fig. 1). The genes mL900 and SLmL900were used as template for PCR
with a pair of primers, oligonucIeotide 1 corresponding the initiation
codon of these genes (5' AGCAGAGACATGGAGCTGGC 3') and
oligonucleotide 2 corresponding to nucleotides 701-720 from the first
nucleotide of the initiation codon coupled with the nucleotide sequence
encoding the influenza HA epitope and termination codon (5' TTAA
GCATAATCTGGAACATCATATGGATAGCCTCCTTGTGTTGGGTCAA 3') (Fig. 1). The amplified DNA fragment (approximately 750 bp)
was again cloned into the T7 vector and the correct clones for expression
under the T7 promoter were selected. These vectors were designated
pT7-soMHVR1-HA and pT7-soMHVR2-HA. Sequencing (Sanger et al.,
1977) showed that the MHVR1 and MHVR2 genes were exactly
the same as mL900 and mmCGM2 (Yokomori & Lai, 1992b),
respectively.
• Transfection and isolation of the soluble forms of receptor
proteins. RK 13 cells were used for the transient expression of soluble
forms of two different receptor proteins. The subconfluent RK 13 cells
grown in 10 cm dishes (Falcon) were trypsinized and suspended in
DMEM containing 10 mM-dextrose and 0"1 mM-DTT at a concentration
of 5 x 106-1 x 10v cells/mL The mixture of 0"5 ml of cell suspension and
5-101~g of recombinant plasmid, pT7-soMHVR1-HA or pT7soMHVR2-HA, was kept on ice for 10 min and then electroporated using
a Gent Pulser (Bio-Rad). The treated ceils were cultured in 6 cm dishes
(Falcon) with DMEM supplemented with I0% FCS for 6 to I2 h. The
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 18:36:52
oligonucleotide I
L
•
A2a
N1
MHVR1
: ....
•
II
........ "
••
Li T M
: ;
iL
NI
A2a
ilia
L
>
N2
A2b
Li T M
Cyt
i
oligonucleotide 2
soMHVR 1 -HA
oligonucleotide 1
MHVR2
II
"
~
:i ;
Cyt
--
oligonucleotide 2
i
i
i
m
|
i
l
|
soMHVR2-HA
:L
'
N2
A2b
'HA
|
I~I
Fig. 1. Schematic structure of the constructs for expression of soluble MHVR1 and MHVR2. MHVR1 and MHVR2 are
composed of two major domains, N and A2. Labels L, Li, TM, and Cyt indicate leader sequence, linker region, transmembrane
domain and intracytoplasmic domain, respectively. The genes encodin 9 soluble proteins without transmembrane and
intracytoplasmic domains and tagged with HA epitope were constructed by PCR usin 9 MHVR1 and MHVR2 as templates and
oligonueleotides 1 and 2 as primers. The major difference between MHVR1 and MHVR2 is located in the N domain.
cells were infected with vTF7.3 at a multiplicity of 5-10 p.f.u./cell and
incubated for I h at 37 °C. After removing the inoculated virus material,
cells were fed with PM-IO00 medium (Eiken, Tokyo) for 15-24 h. Since
both proteins lacked the transmembrane domain and were mostly
secreted in the culture fluids, we made use of only the culture fluids for
the experiments. From culture fluids of cells isolated at 15 to 24 h after
vTF7.3 infection, VV was removed by centrifugation at 20 000 r.p.m, for
2 h. These materials were concentrated, when needed, by ultrafiltration
with Ultra-free PF or PFL (Millipore).
•
Western and dot blotting. The size and amounts of the soluble
forms of MHVR1 and MHVR2 proteins produced in the VV transient
expression system were analysed by Western blotting as reported
previously (Kubo et aL, 1993; Taguchi, 1993). For Western blotting,
aliquots of culture fluids were electrophoresed in a 10% SDSpolyacrylamide gel and the proteins were transferred onto Immobilon
transfer membrane paper (Millipore). For dot blotting, 2-fold serially
diluted culture fluids were prepared on membrane using vacuum
apparatus (ATTO, Tokyo). The membrane paper with proteins was
blocked with Block Ace (Yukijirushi, Sapporo, Japan) before incubation
with antibodies. In order to detect proteins anti-HA MAb (mouse MAb
clone 12CA5; Boehringer Mannheim) was used at a concentration of
400 pg/ml. After incubation with the MAb, the membrane papers were
washed with PBS pH 7"2 containing 0'05 % Tween 20 (PBS-Tw) and
reacted with 5000- to lO000-fold diluted anti-mouse IgG conjugated
with horseradish peroxidase (Cappel Organon Teknica). The reaction was
detected by enhanced chemiluminescence (ECL; Amersham).
• Virus binding to MHV receptors. This was determined by
VOPBA as described previously {Kubo et aI., 1994; Taguchi, 1995).
Briefly, soluble receptor proteins were prepared on the membrane paper
by Western blotting or dot blotting as described above. The paper was
then incubated in culture fluid of DBT cells containing I x 1065 x 108 p.f.u./ml of JHMV at room temperature (22 to 24 °C) for 1 h.
The binding of virus particles to the receptor proteins was monitored
with MAbs specific for the S proteins of JHMV (Kubo et al., 1993) as
primary antibody and anti-mouse IgG conjugated with peroxidase as a
secondary antibody. Peroxidase activity was detected by ECL.
• Inhibition of virus infectivity (neutralization) by receptor
proteins. The inhibitory effects of soluble receptor proteins on virus
infectivity were tested as follows. The culture fluids containing MHVR1
and MHVR2 concentrated by ultrafiltration were serially 2-fold diluted
with DMEM containing 10% TPB. Of each dilution, 100 ,l was mixed
with an equal volume of JHMV suspension containing 200-300 p.f.u.
The mixture was incubated at room temperature for 50 to 60 min. The
mixture was then inoculated onto DBT cells prepared in 6-well plates
(Falcon) and the number of plaques produced by the remaining infectious
virus was counted I to 2 days after virus inoculation. The degree of
inhibition of each dilution was estimated as compared with the same virus
titre when mixed with DMEM containing 10% TPB.
• Transient expression of MHV receptor proteins in BHK-21
cells and infection with JHMV. The M H V receptor genes, mL900
(Kubo et al., 1994) and SLmL900, isolated from BALB/c and SJL mouse
liver, respectively, were inserted in the expression vector pKS336
modified from pSV2bsr (kindly provided by K. Sakai & M. Tastumi) in the
correct orientation for expression (pKS-MHVR1 and pKS-MHVR2). The
recombinant plasmid was transfected into BHK-21 cells by electroporation and the cells were cultured with DMEM supplemented with
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 18:36:52
;8!
10% FCS for 1 to 2 days before virus inoculation. The expression of
MHV receptor protein in cells was confirmed by indirect immunofluorescence with rabbit anti-CEA antibodies (DAKO Japan, Kyoto) and
anti-rabbit IgG labelled with FITC (Cappel). To determine the susceptibility of these cells to JHMV, cells expressing MHVR1 (BHKMHVR1) and those expressing MHVR2 (BHK-MHVR2) were prepared
in 12-well plates (Falcon) and infected with JHMV at various multiplicities
of infection (105 to 10 p.f.u.). After 1 h incubation at 37 °C for virus
adsorption, cells were washed with DMEM and then incubated with
DMEM containing 10% FCS. To quantify the number of infected cells,
cells were fixed with acetone at 9 to i0 h post-inoculation and the
number of fused cells with MHV antigen was determined by immunofluorescence. Virus growth in these cells was also examined by the
titration of infectious viruses in the culture fluids at I2 and 2,4 h postinoculation as previously reported (Taguchi eta]., 19~0),
• Immunofluorescence. RK i3 ceils transfected with pT7soMHVR1 or pT7-soMHVR2 were fixed with acetone at room
temperaturefor 2 rain and the expressionof these proteins was examined
with anti-influenzaHA MAb as primary antibody and anti-mouse lgG
conjugated with FITC as secondary antibody. BHK-21 cells transfected
with pKS-MHVR1or pKS-MHVR2were fixedin a similarmannerbefore
or after JHMV infection.The expressedreceptor proteins were detected
with anti-CEA antibody and the viral antigen was detected with anti~cl2 S MAbs (Kubo et al., I993). They were then reacted with anti-rabbit
IgG and anti-mouse fgG conjugated with FITC, respectively. The
fluorescencewas observed by UV microscopy.
Results
Expression of soluble forms of MHVR1 and HHVR2
and their virus-binding capacity
Recombinant soluble receptor proteins MHVR1 and
MHVR2 were expressed in RK 13 cells after transfection with
pTT-soMHVR1-HA and pT7-soMHVR2-HA, followed by
infection with recombinant VV harbouring the T7 RNA
polymerase gene, vTFT.3. In most cases, 60 to 80% of cells
were shown to express the receptor proteins by immunofluorescence (data not shown). Since the proteins lacked the
anchor signal and most of the proteins were expected to be
secreted into the culture fluid, we examined the proteins in the
culture fluids by Western blotting. The culture fluids were spun
at 20000 r.p.m, for 2 h to remove VV and the supernatants
were concentrated 10-fold by ultrafiltration. Ten,1 of the
sample diluted 2-, 4-, 8-, 16- or 32-fold was electrophoresed in
an SDS-polyacrylamide gel and transferred onto membrane.
The soluble receptor proteins were reacted with MAb specific
for the influenza HA epitope. As shown in Fig. 2 (a, b), major
bands of 40 kDa and 36 kDa corresponding to MHVR1 or
MHVR2, respectively, were detected in the culture fluids of RK
13 cells. Since the core proteins of soluble MHVR1 and
MHVR2 encoded in the corresponding genes constructed in
this study were 27 756 and 27386 Da, respectively, the soluble
MHV receptor proteins produced in RK I3 cells were
presumably heavily glycosylated. A minor band with a slightly
higher molecular mass was also found in both preparations.
From the result shown in Fig. 2 (a), the amount of MHVR1 was
calculated to be one-sixth of the amount of MHVR2.
68(
It has been documented that MHVR1 but not MHVR2
reacts with MHV by VOPBA when these proteins are
denatured by 2-mercaptoethanol and SDS (Boyle eta]., 1987;
WilIiams et at., 1990) and we have confirmed this observation.
The same amounts of MHVR1 and MHVR2 prepared on the
membrane paper by Western blotting as shown in Fig. 2 (b)
were reacted with 100 gl of JHMV (1 x I0 v p.f.u./ml)for i h at
room temperature. The binding of virus particles was monitored by JHMV-specific MAbs. As shown in Fig. 2(c), a
remarkable difference in virus binding was observed; JHMV
bound to MHVRI very efficiently but not at all to MHVR2. To
estimate the difference of virus-binding capacity of MHVRI
and MHVR2, we did VOPBA with a slightly modified method.
We prepared soluble receptor proteins on membrane (in this
case, receptor proteins were not denatured) and they were
tested as to whether or not they bound the virus particles. The
undiluted sample shown in lane I for MHVR2 contained &fold
more receptor than that of MHVR1. As shown in Fig, 2 (d),
there was an apparent difference in the virus-binding capacity
between these receptor proteins. The intensity of lane 1 of
MHVR2 was calculated to be almost the same as lane 7 of
MHVR1. This showed that MHVRI bound to the virus
particles with more than 350-fold higher efficiency than
MHVR2. These results indicated that the virus-binding
capacity of MHVR1 was more than 350-fold higher than that
of MHVR2 by VOPBA.
Inhibition of virus infectivity (neutralization) by soluble
receptors
The virus-binding capacities of these soluble receptor
proteins were examined by neutralization of virus infectivity.
The concentrated soluble MHVR1 and MHVR2, whose
concentrations were estimated by Western blotting as shown
in Fig, 2 (a), were serially 2-fold diluted with DMEM containing
10 % TPB and 100 I~l of each dilution was mixed with an equal
volume of JHMV containing 200-300 p.f.u. After incubation
at room temperature for 60 min, the remaining infectivity was
estimated by plaque assay using DBT cells. As shown in Fig. 3,
there was a striking difference between these two receptors
with respect to the concentration that neutralized virus
infectivity, Undiluted MHVR2 neutralized more than 50% of
infectivity, whereas MHVR1 completely neutralized JHMV at
a dilution of more than I:64. Even 512-fold diluted MHVR1
neutralized JHMV infectivity to the same extent as undiluted
MHVR2, This showed that MHVR1 had a 500-fold higher
affinity for the virus than MHVR2. The control culture fluid
showed no neutralizing activity, even when undiluted.
Sensitivity to MHV infection of BHK-21 cells
expressing HHVR1 or MHVR2
MHVR1 and MHVR2 were reported to be functional
receptors for MHV, since BHK-21 and COS-7 cells expressing
these proteins were susceptible to MHV infection (Dveksler et
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 18:36:52
(a)
soMHVR1-HA
kDa
1
84.0 - I ~
~
2
soMHVR2-HA
3
1
2
3
4
5
6
~" .........
-
,
.
: ::[
41.7 " ! ~ ~ : :
'ii:!-:
?
32.0
•
(b)
kDa
(c)
1
2
3
:
2: "
"
5:" •
(d)
1
2
3
1
2
3
4
5
6
7
8
A
• .:...
32.0 ~
::
Fig. 2. (a) Western blot analysis of soluble MHV receptor proteins. Soluble MHVR1 and MHVR2 secreted in the culture fluids
of RK 13 ceils transfected with pT7-soNIHVRI -HA or pT7-soMHVR2-HA were concentrated by ultrafiltration and I 0 gI of
MHVR1 and MHVR2 undiluted (lane 1 ) or diluted 2- (lane 2), 4- (lane 3), 8- (lane 4), 16- (lane 5) or 32-fold (lane 6) were
electrophoresed in a 1 0 % SDS-polyacrylamide gel. The proteins were transferred onto membrane paper and MHVR1 and
MHVR2 were detected by anti-HA NAb. (b) Undiluted soluble MHVR1 (lane 1 ) and 6-fold diluted MHVR2 (lane 2) as well as
undiluted culture fluid of RK 13 cells mock-transfected and infected with vTF7.3 were prepared by Western blotting and
reacted with anti-HA NAb. (c) VOPBA with soluble MHVR1 and MHVR2. The soluble MHVR1 (lane 1), MHVR2 (lane 2) and
culture fluid (lane 3) prepared as shown in Fig. 1 (b) were reacted with JHMV and the binding of the viruses to the receptor
protein was monitored by anti-JHMV NAbs. (d) Quantitative VOPBA by dot blotting. Soluble MHVR1 (A), MHVR2 (B) and
culture fluid from mock-transfected cells (C) were diluted in 2-fold steps and transferred to the paper by dot blotting. They
were then reacted with JHMV and the binding of the virus was examined by anti-JHMV MAbs. The amounts of MHVR1 and
MHVR2 in lane 1 (undiluted materials) are in the ratio 1:6 by the Western blotting analysis.
al., 1991; Yokomori & Lai, 1992a) We have performed
experiments to confirm this observation. MHVR1 and MHVR2
were transiently expressed in BHK-21 cells by transfecting
with pKS-MHVRI and pKS-MHVR2, respectively, by electroporation. These proteins were shown to be expressed on 60 to
80 % of transfected cells and no apparent difference of intensity
in expression was observed by immunofluorescence with antiCEA antibodies (data not shown) between cells expressing
MHVR1 and MHVR2. These cells were infected with various
amounts of JHMV (105, i0 a and 10 p.f.u, in 0"1 ml). The cells
were fixed with acetone at 9 h after ]HMV infection and
numbers of fused cells with MHV antigen were compared
between BHK-MHVR1- and gHK-MHVR2-expressing cells,
respectively. Both types of BHK-21 cells were shown to be
susceptible to JHMV infection as demonstrated by the presence
of MHV-specific antigens in fused cells after infection with
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 18:36:52
68;
100
\
60 ~'X
l
m
1
\1
2°I
",d
o0-----'
0
1
2
3
4
5
6
7
8
9
Dilution of receptor protein (fold)
10
11
12
Fig. 3. Neutralization kinetics of JHMV by soluble MHVR1, MHVR2 or culture fluid from mock-transfected cells. Soluble MHVR1
and MHVR2 as well as control culture fluids diluted 2-fold were mixed with JHMV and incubated at room temperature for 1 h.
The virus titres in the mixtures were plaque assayed on DBT cells. Symbols: II, MHVR1 ; FI, MHVR2; 0 , mock.
various titres of JHMV (Fig. 4). However, it was also clearly
shown in Fig. 4 that there was a striking difference in the
number of fused cells with JHMV antigen between BHKMHVR1 and BHK-MHVR2 cells infected with JHMV. JHMV
produced more than 30-fold greater numbers of fusions (40fold greater in MHV-positive ceils) in BHK-MHVR1 cells as
compared with BHK-MHVR2 after infection with 10 a p.f.u.
When infected with a higher m.o.i., 105 p.f.u., the difference
was less remarkable; about 10-fold (Fig. 4). This showed that
JHMV infection was 30-fold more efficient in BHK-MHVR1
cells than BHK-MHVR2 cells. The difference in sensitivity to
MHV infection between BHK-MHVR1 and BHK-MHVR2
cells was also demonstrated by the amount of virus detected in
the culture fluids of these cells, as shown in Table 1. The titres
of the virus in the culture fluids of BHK-MHVR1 were 6- to 60fold higher than those of BHK-MHVR2. Also in this case, a
higher m.o.i, resulted in a less remarkable difference in virus
growth (Table 1). The low titre of virus detected in the culture
fluids of BHK-21 cells without MHV receptor protein may
have resulted from c]-2 virus infection in BHK cells by the
receptor-independent infection reported by Gallagher et al.
(1992), since a minority of BHK ceils without receptor protein
infected with cl-2 were revealed to be antigen-positive by
immunofluorescence (data not shown).
Discussion
We have compared the virus-binding capacity of two
different MHV receptors, MHVR1 (mmCGM1) expressed in
BALB/c mice susceptible to MHV infection and MHVR2
(mmCGM2) expressed in MHV-resistant SJL mice (Knobler et
at., 1981, 1982; Smith eta[., 1984; Stohlman & Frelinger, 1978).
These two receptor proteins were shown in different ]abora-
68~
tories to serve as functional MHV receptors (Dveksler et al.,
1991, 1993 a; Yokomori & Lai, 1992 a, b). In the present study,
however, a striking difference in the virus-binding capacity was
shown between these proteins. By virus neutralization and
direct virus-binding tests, MHVR1 was demonstrated to have
350- to 500-fold higher virus affinity as compared with
MHVR2. This result is in agreement with the previous
observation that MHVR1 but not MHVR2 bound to virus
particles by VOPBA (BoyIe et aL, 1987; Williams et al., I990).
We have further shown in the present study that BHK-21 cells
expressing MHVR1 were more sensitive to JHMV infection
than those expressing MHVR2. The differences in JHMV
sensitivity of these BHK-21 cells were quantitatively analysed
and a 30-fold difference was demonstrated. This is the first
observation that there is a difference in receptor function
between M H V R 1 and MHVR2. This observation is compatible
with the finding that the rate of MHV infection in cultured
macrophages from resistant SJL mice expressing MHVR2 was
extremely low as compared with that for macrophages from
other susceptible mouse strains with MHVR1 (Smith et aL,
1984). However, our results on the difference of susceptibility
of BHK-MHVRI and BHK-MHVR2 ceils do not agree with
the previous observations by Yokomori & Lai (1992a, b) and
Dveksler et al. (1993a).
There have been two previous reports on the nature of
MHVR1 and MHVR2 expressed in MHV-resistant cells
(Dveksler et aL, 1993 a; Yokomori & Lai, 1992 a, b). Yokomori
& Lai (1992a, b) compared receptor function by expressing
these receptor proteins in COS-7 cells. They used lipofectin for
the expression of receptor proteins (by which method normally
less than 10% of cells express the protein) and they infected
cells with MHVs at an m.o.i, of 20 or 50. They could not find
significant differences in JHMV growth in cells expressing
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 18:36:52
MHVR1 and those with MHVR2 (Yokomori & Lai, 1992a, b).
They also described that the transfection of the MHVR1 gene
into cells from SJL mice could not render the cells susceptible
to MHV infection, which led them to speculate that another
host cell factor was necessary for the resistance of SJL mice to
JHMV infection (Yokomori & Lai, 1992b). Dveksler et a].
(1993 a) used an immunofluorescence method to examine the
MHV-A59 sensitivity of BHK-21 cells expressing MHVR1
and those expressing MHVR2 and reported no substantial
difference in MHV sensitivity between those cells. They also
expressed MHVR1 in cells derived from SJL mice and
demonstrated that such SJL cells were susceptible to MHV
(Dveksler eta]., 1993a), suggesting the non-involvement of
SJL-specific host factors in resistance of SJL cells to MHV.
We have expressed MHV receptor proteins in BHK-21 cells
and found significant differences in virus infection as well as in
virus growth between those cells, as shown in the present
study. The differences in experimental conditions between
Yokomori & Lai (1992 a, b) and ourselves are the proportion of
cells in culture which express receptor proteins. In our case,
more than 60 % of cells expressed the receptor protein. Another
difference resides in the multiplicity of infection, namely they
infected at an m.o.i, of 20 to 50 whereas we infected at an m.o.i.
of less than 0'2. When we compared the susceptibility of BHKMHVR1 and BHK-MHVR2 after infection at the highest
multiplicity, m.o.i. 0"2, less remarkable differences were found
as compared with the infection with a low multiplicity, m.o.i.
0'002, both by immunofluorescence and by titration of
infectious virus (Table i).
The present study showed a quantitative difference of
MHVR1 and MHVR2 in virus-binding ability, which could
account for the difference of sensitivity of cells to MHV
infection. The finding that BHK-MHVR1 was 30-fold more
sensitive than BHK-MHVR2 cells may favour the idea that the
resistance of SJL mice to MHV could be accounted for by the
low virus affinity of MHVR2 as compared with MHVR1 of
other susceptible mouse strains. A 30-fold difference in virus
affinity would be amplified into a huge difference in virus
growth after repeated cycles of infection during the few days
after initial infection, which could result in fatal disease in
susceptible BALB/c mice and the survival of SJL mice. This
hypothesis can be tested by interchanging these receptor
genes between BALB/c and SJL mice by gene targeting
(Mansour et al., 1988).
It has been documented that the resistance of SJL mice is
controlled by a single recessive gene (Smith et al., 1984).
MHVR2 could be the product of this recessive gene. The
resistance of SJL mice to MHV infection is not absolute, since
SJL mice younger than 6 weeks of age were shown to be
susceptible to MHV (Stohlman & Frelinger, 1978). Further-
@)
(c)
Fig. 4. Immunofluorescence analysis of BHK-IVlHVR1 and BHK-MHVR2
cells infected with JHMV, BHK-MHVR1 (a), BHK-MHVR2 (h) and control
BHK (c) cells infected with 105 p.f,u, of JHMV were fixed with acetone at
10 h post-inoculation and examined for the presence of JHiVIV antigen
with JHMV-specific NIAbs.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 18:36:52
6 8 c.
Table I . Virus growths in BHK-MHVRI and BHK-MHVR2 cells
BHK-MHVR1 and BHK-MHVR2 cells expressing MHVR1 and MHVR2 as well as BHK cells transfected with
vector only (BHK-mock)were infected with various amounts of JHMV and infectivity in the culture fluids
was estimated by plaque assay.
Virus titre
inoculated
(p.f.u.)
105
103
10
Virus titres (p.f.u.lml)
Time after
infection (h)
12
24
12
24
12
24
BHK-MHVR1
3.9 x
4"8 x
8"5 x
3"2 x
3'0 x
2"5 x
BHK-MHVR2
BHK-21
6.6 X 1 0 3
5.6 × 104
5-0 x 101
6"0 x 10'~
< 10
< I0
6"5 X 101
4"5 × I0 R
< 10
< 10
< 10
< 10
104
105
102
104
101
102
more, adult SJL mice inoculated with a high dose of virus could
not resist M H V infection (Knobler eta]., 1982). These facts
would suggest that some other factors may be important for
the full resistance of SJL mice to M H V infections. The host
immune reactions may play an important role in resistance to
M H V infection, as shown in the resistance of mice to infection
with other strains of M H V (Dupuy et al., 1975 ; Taguchi et al.,
1980). Alternatively, it could be that the MHVR2 proteins are
highly expressed in the young SJL mice as compared with adult
mice, which may account for the higher susceptibility of young
mice to JHMV and susceptibility of adult mice to infection
with higher doses of virus.
MHVR1 (mmCGM1) and MHVR2 (mmCGM2) have been
reported to exhibit cell adhesion activity, though the properties
of this activity are different between these two proteins; the
adhesion activity of mmCGM1 works in a calcium- and
temperature-dependent manner, while that of m m C G M 2 is
calcium- and temperature-independent (McCuaig eta]., 1992;
Turbide eta]., 1992). The adhesion activity of m m C G M 1 and
m m C G M 2 could be mediated by the N domain located at the
N terminal region of the molecules as shown in human BGP
(Stanners et al., 1995; Teixeira eta]., 1994). The same domain
of the molecule interacts with the N-terminal region of the
M H V S protein (Dveksler eta[., 1993 b; Kubo eta[., 1994).
Between MHVR1 and MHVR2, one4hird of the N-terminal
region of the N domain is identical, while the rest of the Cterminal regions are highly distinct, where the most striking
difference between MHVR1 and MHVR2 molecules exists
(McCuaig eta]., 1993). The biological differences of these two
proteins as cell adhesion protein and receptor protein for M H V
could be located in the two-thirds of the C-terminal region of
the N domain. Experiments to examine this possibility are
currently in progress.
It is of interest that the proteinaceous receptors for some
viruses, i.e. HIV (Landau et al., 1988), poliovirus (Mendelsohn
et al., 1989), rhinovirus (Staunton et al., 1989) and M H V
(Dveksler et a]., 1991; Williams eta]., 1991) belong to the
;9(
immunoglobulin superfamily and hence their structures are
very similar. The virus-binding sites of these receptor proteins
are known to be located in the N-terminal domain (Dveksler et
a]., 1993a; Koike eta]., 1991; Landau eta[., 1988; Peterson &
Seed, 1988; Selinka et al, 1991; Staunton eta[., 1990). The
virus-binding site of M H V receptor should be a linear structure,
since MHVR1 denatured by 2-mercaptoetbanol and SDS was
shown to still be functional for virus binding (Boyle et al., 1987;
Williams et aI., 1990). It is interesting and worthwhile for the
possible prevention of virus infection to identify the precise
amino acid sequence which serves as the active virus-binding
site.
We thank Hideka Suzuki for her helpful discussions. This work was
financially supported by grants from the Science and Technology
Agency and the Ministry of Education, Science and Culture of Japan.
References
Boyle, J.F., Weismiller, D.G. & Holmes, K.V. (1987). Genetic
difference to mouse hepatitis virus correlates with absence of virusbinding activity on target tissues. Journal of Virology 61, 185-189,
Cavanagh, D. (1995). The coronavirus surface glycoprotein. In
Coronaviridae, pp. 73-II3. Edited by S. G. SiddeU. New York: Plenum
Press.
Clapham, P. R., Weber, J. N., Whitby, D., Mclntosh, K., Dalgleish , A. G.,
Maddon, P. J., Deen, K. C., Sweet, R. W. & Weiss, R. A. (1989). Soluble
CD4 blocks the infectivity of diverse strains of HIV and SIV for T cells
and monocytes but not for brain and muscle cells. Nature 337, 368-370.
De Groot, R. J., Luytjes, W., Horzinek, M. C., Van Der Zeijst, B. A. M.,
Spaan, W.J.M. & Lenstra, J.A. (1987). Evidence for a coiled-coil
structure in the spike of coronaviruses. Journal of Molecular Biology 196,
963-960.
Delmas, B., Gelfi J., Haridon, R. L., Vogel, L. K., Sjostrom, H., Noren,
O. &Laude, H. (199Z). Aminopeptidase N is a major receptor for the
entero-pathogenic coronavirus TGEV. Nature 357, 417-420.
Duke, C. S., Yu, Y., Rivadeneira, E. D., Sauls, D. L., Liao, H., Haynes, B.
F. & Weinberg, J. B. (1995). Cellular CD44S as a determinant of human
immunodeficiency virus type 1 infection and cellular tropism. Journal of
Viro]ogy 69, 4000-4005.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 18:36:52
Dupuy, J.M., Levy-Leblond, E. & Leprovost, C. (1975). Immunopathology of mouse hepatitis virus type 3 infection. II. Effect of immunosuppression in resistant mice. Journal of Immunology 114, 226-230.
Dveksler, G.S., Pensiero, M. N., Cardellichio, C. B., Williams, R. K.,
Jiang, G., Holmes, K. V. & Diffenbach, C. W. (1991). Cloning of the
mouse hepatitis virus (MHV) receptor: expression in human and hamster
ceil lines confers susceptibility to MHV. Journal of Virology 65,
6881-6891.
Dveksler, G.S., Diffenbach, C.W., Cardellichio, C. B., McCuaig, K.,
Pensiero, M. N., Jiang, G. S., Beauchemin, N. & Holmes, K. V. (1993 o).
Several members of the mouse carcinoembryonic antigen-related glycoprotein family are functional receptors for the coronavirus mouse
hepatitis virus-AS9. Journal of Virology 67, 1-8.
Dveksler, G. S., Pensiero, M. N., Diffenbach, C. W., Cardellichio, C. B.,
Basile, A. A., Ella, P. E. & Holmes, K. V. (1993 b). Mouse hepatitis virus
strain A59 and blocking antireceptor monoclonal antibody bind to the Nterminal domain of cellular receptor. Proceedings of the National Academy
of Sciences, USA 90, 1716-1720.
Fuerst, T. R., Niles, E. G., Studier, F. W. & Moss, B. (1986). Eukaryotic
transient expression system based on recombinant vaccinia virus that
synthesizes T7 RNA polymerase. Proceedings of the National Academy of
Sciences, USA 83, 8122-8126. '
Fuerst, T, R., Earl, P, L. & Moss, B. (1987). Use of hybrid vaccinia virusT7 RNA polymerase system for the expression of target genes. Molecular
and Cellular Biology 7, 2538-2544.
Gallagher, T., Buchmeier, M.J. & Perlman, S. (1992). Cell-receptor
independent infection by a neurotropic murine coronavirus. Virology
191, 517-522.
Greve, J. M., Davis, G., Meyer, A. M., Forte, C. P., Yost, S. C., Marlor, C.
W., Kamarck, M.F. & HcClelland, A. (1989). The major human
rhinovirus receptor is ICAM-1. Cell 56, 839-843.
Harouse, J. M., Bhat, S., Spitlnik, S.L., Laughlin, M., Stefano, K.,
Silberger, D. H. & Gonzalez-Scarano, F. (1991). Inhibition of entry of
HIV-1 in neural ceil lines by antibodies against galactosyl ceramide.
Science 253, 320-323.
Kim, J. W., Closs, E. I., Albritton, L. M. & Cunningham, J. M. C. (1991).
Transport of cationic amino acids by the mouse ecotropic retrovirus
receptor. Nature 352, 725-728.
Knobler, R.L., Haspel, M.V. & Oldstone, M. B. A. (1981). Mouse
hepatitis virus type 4 (JHM strain)-induced fatal central nervous system
disease. I. Genetic control and the murine neuron as the susceptible site
of disease. Journal of Experimental Medicine 153, 832-843.
Knobler, R. L., Tunison, L.A., Lampert, P.W. & Oldstone, M. B. A.
(1982). Selected mutants of mouse hepatitis virus type 4 (JHM strain)
induce different CNS diseases. Pathobiology of disease induced by wild
type and mutant ts8 and ts15 in BALB/c and SJL/J mice. American Journal
of Pathology 109, 157-I68.
Koike, S., Ise, I. & Nomoto, A. (1991). Functional domains of the
poliovirus receptor. Proceedings of the National Academy of Sciences, USA
88, 4104-4108.
Kubo, H., Takase, S. Y. & Taguchi, F. (1993). Neutralization and fusion
inhibition activities of monoclonal antibodies specific for the $1 subunit
of the spike protein of neurovirulent murine coronavirus JHMV cl-2
variant. Journal of General Virology 74, 1421-1425.
Kubo, H., Yamada, Y.K. & Taguchi, F. (1994). Localization of
neutralizing epitopes and the receptor-binding site within the aminoterminal 330 amino acids of the murine coronavirus spike protein. Journal
of Virology 68, 5403-5410.
Landau, N.R., Warton, M. & Littman, D.R. (1988). The envelope
glycoprotein of the human immunodeficiency virus binds to the
immunoglobulin-like domain of CD4, Nature 334, 159-162.
Haddon, P. J., Dalgleish, A. G., MeDougal, J. S., Clapham, P. R., Weiss,
R. A. & Axel, R. (1986). The T4 gene encodes the AIDS virus receptor
and is expressed in the immune system and the brain. Ceil 47, 333-348.
Mansour, S. L., Thomas, K. R. & Capecchi, M. R. (1988). Disruption of
the proto-oncogene int-2 in mouse embryo-derived stem cells: a general
strategy for targeting mutations to non-selectable genes. Nature 336,
348-352.
McCuaig, K., Rosenberg, M., Nedellec, P., Turbide, C. & Beauchemin,
N. (1993). Expression of the Bgp gene and characterization of mouse
colon biIiary glycoprotein isoforms. Gene 127, 173-I83.
McCuaig, K., Turbide, C. & Beauchemin, N. (1992). mmCGMla: a
mouse carcinoembryonic antigen gene family member, generated by
alternative splicing, functions as an adhesion molecule. Cell Growth and
Differentiation 3, 165-174.
Mendelsohn, C. L., Wimmer, E. & Racaniello, V. R. (1989). Cellular
receptor for poliovirus: molecular cloning, nucleotide sequence, and
expression of a new member of the immunoglobulin superfamily. Cell 56,
855-865.
Nedellec, P., Dveksler, G. S., Daniels, E., Turbide, C., Chow, B., Basile,
A. A., Holmes, K. V. & Beauchemin, N. (1994). Bgp2. a new member of
the carcinoembryonic antigen-related gene family, encodes an alternative
receptor for mouse hepatitis virus. Journal of Virology 68, 4525-4537.
Peterson, A. & Seed, B. (1988). Genetic analysis of monoclonal
antibody and HIV binding sites on the human lymphocyte antigen CD4.
Cell 54, 65-72.
Sanger, F., Nicklen, S. & Coulson, A. R. (1977). DNA sequencingwith
chain-terminating inhibitors. Proceedings of the National Academy of
Sciences, USA 74, 5463-5467.
Selinka, H. C., Zibert, A. & Wimmer, E. (1991 ). Poliovirus can enter and
infect mammalian cells by way of an intercellular adhesion molecule 1
pathway. Proceedings of the National Academy of Sciences, USA 88,
3598-3602 .
Siddell, S.G. (1995). The Coronaviridae, an introduction. In Coronaviridae, pp. 1-10. Edited by S. G. SiddelI. New York: Plenum Press.
Smith, M.S., Click, R. E. & Plagemann, P. G. W. (1984). Control of
mouse hepatitis virus replication in macrophagesby a recessivegene on
chromosome 7. Journal of Immunology 133, 428-432.
Spaan, W., Cavanagh, D. & Horzinek, M.C. (1988). Coronaviruses:
structure and genome expression. Journal of General Virology 69,
2939-2952.
Stanners, C. P., Demarte, L., Rojas, M. & Fuks, A. (1995). Opposite
functions for two classes of genes of the human carcinoembryonic
antigen family. Tumor Biology 16, 23-31.
Staunton, D. E., Dustin, H. L., Erickson, H. P. & Springer, T. A. (1990).
The arrangement of the immunoglobulin-like domains of ICAM-1 and
the binding sites for LFA-1 and rhinovirus, Ceil 61, 243-254,
Staunton, D. E., Meriuzzi, V. J., Rothlein, R., Barton, R., Marlin, S. D. &
Springer, T. A. (1989). A cell adhesion molecule, ICAM-1, is the major
surface receptor for rhinoviruses. Cell 56, 849-853.
Stohlman, S.A. & Frelinger, J.A. (1978). Resistance to fatal central
nervous system disease by mouse hepatitis virus, strain JHM. 1. Genetic
analysis. Immunogenetics 6, 277-281.
Taguchi, F. (1993). Fusion formation by uncleaved spike protein of
murine coronavirus JHMV variant el-2. Journal of Virology 6 7,1195-1202.
Taguchi, F. (1995). The $2 subunit of the murine coronavirus spike
protein is not involved in receptor binding. Journal of Virology 69,
7260-7263.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 18:36:52
69
Taguchi, F. & Fleming, J. O, (1989). Comparison of six different murine
coronavirus JHM variants by monoclonaI antibodies against the E2
glycoprotein. Virology 169, 233-235.
Taguchi, F., Yamada, A. & Fujiwara, K. (1980). Resistance to highly
virulent mouse hepatitis virus acquired by mice after low-virulence
infection: enhanced antiviral activity of macrophages. Infection and
Immunity 29, 42-49.
Taguchi, F., Siddell, S.G., Wege, H. & ter Heulen, V. (1985).
Characterization of a variant virus selected in rat brain after infection by
coronavirus mouse hepatitis virus JHM. Journal of Virology 54, 429-435.
Teixeira, A. M.~ Fawcett, l., Simmons, D. L. & Watt, S. M. (1994). The
N-domain of the biliary glycoprotein (BGP) adhesion molecule mediates
homotypic binding: domain interactions and epitope analysis of BGPc.
Blood 84, 211-219.
Turbide, C., Rojas, M., Stanners, C. P. & Beauchemin, N. (1992). A
mouse carcinoembryonic antigen gene family member is a calciumdependent cell adhesion molecule. Journal of Biological Chemistry 266,
Williams, R. K., Jiang, G. S. & Holmes, K. V. (1991). Receptor for mouse
hepatitis virus is a member of the careinoembryonic antigen family of
glycoproteins. Proceedings of the National Academy of Sciences, USA 88,
5533-5536.
Williams, R. K., Jiang, G., Synder, S. W., Frana, H. F. & Holmes, K. V.
(1990), Purification of the ilO-kilodalton glycoprotein receptor for
mouse hepatitis virus (MHV)-A59 from mouse liver and identification of
a nonfunctional, homologous protein in MHV-resistant SJL/J mice.
Journal of Virology 64, 3817-3823.
Yamada, Y. K., Abe, M., Yamada, A. & Taguchi, F. (1993). Detection of
mouse hepatitis virus by the polymerase chain reaction and its application
to the rapid diagnosis of infection. Laboratory Animal Science43,285-290.
Yeager, C.L., Ashmun, R.A., Williams, R.K., Cardellichio~ C.B.,
Shapiro, L. H., Look, A.T. & Holmes, K.V. (1992). Human amino°
peptidase N is a receptor for human coronavirus 229e. Nature 357,
420-422.
Ubol, S. & Gri~n, E. (1991). Identification of a putative alphavirus
receptor on mouse neural cells. Journal of Virology 65, 6913--6921.
Yokomori, K. & kai, N. M. C. (1992o). Mouse hepatitis virus utilizes
two carcinoembryonic antigens as alternative receptors. Journal of
Virology 66, 6194-6199.
Yokomori, K. & Lai, bt. M. (2. (1992 b). The receptor for mouse hepatitis
Wang, H., Kavanaugh, M. P., North, R. A. & Kabat, D. (1991). Cellsurface receptor for ecotropic murine retroviruses is a basic am/no-acid
transporter. Nature 352, 729-731.
virus in the resistant mouse strain SJL is functional: implications for the
requirement of a second factor for viral infection. Journal of Virology 66,
6931--6938.
Wang, K. S., Schmaljohn, A. L., Kuhn, R.J. & Strauss, J. H. (1991).
Anti-idiotypic antibodies as probes for the Sindbis virus receptor.
Virology 181, 694-702.
Received I I January 1996; Accepted 23 February 1996
309-315.
69;
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 18:36:52