JOURNAL OF FOODBORNE AND ZOONOTIC DISEASES
Journal homepage: www.jakraya.com/journal/jfzd
ORIGINAL ARTICLE
Multiplex PCR assay for the simultaneous detection of four common food
pathogens in meat
Latha C*, Anu CJ, Sunil B, Ajaykumar VJ and Deepa Jolly
Department of Veterinary Public Health, College of Veterinary and Animal Sciences, Mannuthy, Thrissur, Kerala,
India.
Abstract
*Corresponding Author:
Latha C
E-mail: [email protected]
Received: 09/06/2014
Revised: 10/07/2014
Accepted: 11/07/2014
The study was carried out to standardize a multiplex PCR assay for
the simultaneous detection of four common food pathogens such as Listeria
monocytogenes, Yersinia enterocolitica, Staphylococcus aureus and
Salmonella enterica Typhimurium. Pathogen-specific DNA primers
targeting hly A, ail, nuc and stm genes were employed for the identification
of L. monocytogenes, Y. enterocolitica, S. aureus and S. enterica
Typhimurium, respectively. Specificity of primers was tested using
reference strains of other bacterial strains including E. coli, E. coli O157:H7
and V. parahaemolyticus. Artificial meat inoculation was carried out to
investigate the sensitivity of multiplex PCR. The results showed that the
standardized multiplex PCR technique is an effective assay having high
specificity for the simultaneous detection of the four target pathogens from
meat. The developed technique successfully detected all four organisms
inoculated together on meat at a detection sensitivity of 1cfu/g.
Keywords: Foodborne pathogens, multiplex PCR, sensitivity, specificity,
meat.
Introduction
Diseases
resulting
from the
bacterial
contamination of food represent one of the major public
health concerns since time immemorial. Listeria
monocytogenes,
Yersinia
enterocolitica,
Staphylococcus aureus and Salmonella enterica
Typhimurium are the predominant bacterial pathogens
involved
in
foodborne
infections.
Listeria
monocytogenes causes listeriosis, a severe infection
which
primarily
affects
immunocompromised
individuals including pregnant women, newborns and
elderly people. The mortality rate of listeriosis can be
as high as 30% (Kathariou, 2002; McLauchlin et al.,
2004). Yersinia enterocolitica is a versatile
enteropathogen that, most commonly, causes
gastroenteritis
in
humans
(Bottone,
1999).
Staphylococcus aureus is one of the most common
bacterial pathogens causing food poisoning outbreaks
(Aydin et al., 2011). Salmonellosis is a major economic
problem for the food industry and a public health
hazard in many countries. All the infected samples
must be quickly identified so that they can be isolated
and spread of contamination can be controlled (Robles
et al., 2008).
Traditional microbiological cultivation and
identification methods are commonly based on preenrichment,
selective
enrichment,
isolation,
identification and serological assay of the target
pathogens. These methods are time-consuming, and the
results may be limited due to poor sensitivity, slowgrowing or poorly viable organisms (Chai et al., 2011).
Recently, with the development of molecular
techniques, polymerase chain reaction (PCR) has
become an important tool for detecting pathogenic
microorganisms in food products (Xu et al., 2012). The
PCR protocol published for detection of different food
pathogens may have different annealing temperatures,
buffer systems and enrichment methods. For routine
laboratory analysis, it would be ideal if PCR method
using the same conditions could be developed (Wang et
al., 1997).
The development of PCR-based methods
including multiplex PCR (m-PCR) has greatly
improved the sensitivity, specificity and speed of
detecting microorganisms. m-PCR is able to amplify
multiplex targets by using several sets of target specific
or degenerated primers in a single tube (Severgini et
al., 2011). Moreover, the method has taken up an
increasingly significant pace in the field of laboratory
diagnostics, allowing the detection of various food
pathogens, such as L. monocytogenes, Y. enterocolitica,
S. aureus and S. enterica Typhimurium in different
kinds of food, such as meat and meat products (Santos
et al., 2001). Hence, the present study was carried out
to standardize a multiplex PCR technique for the
simultaneous detection of L. monocytogenes, Y.
enterocolitica, S. aureus and S. enterica Typhimurium
from meat.
Materials and Methods
Bacterial strains and cultivation conditions
The bacterial strains used in this study are listed
in Table 1. Strains were procured from the Microbial
Journal of Foodborne and Zoonotic Diseases | July-September, 2014 | Vol 2 | Issue 3 | Pages 45-49
© 2014 Jakraya Publications (P) Ltd
Latha et al.....Multiplex PCR for the simultaneous detection of four common food pathogens in meat
Type Culture Collection (MTCC), Institute of
Microbial Technology (IMTECH), Chandigarh as
freeze dried forms.
of DNA was carried out by boiling and snap chilling
method (Lee et al., 2009).
Oligonucleotide primers
Enrichment and extraction of DNA
Tryptic soy broth with yeast extract (TSBYE)
was selected as the universal enrichment broth for all
the organisms under study based on the previous
research work carried out in the quality control lab for
developing uniform enrichment protocol (Latha et al.,
2014). A single colony from each strain was selected
and inoculated into TSBYE and incubated at 37°C for
18h. Bacterial growth was assessed by the increase in
the turbidity of the solution and confirmed by
enumeration of organisms in selective media. For the
isolation of L. monocytogenes, 0.1 ml of culture was
transferred to Polymyxin- Acriflavin- Lithium
Chloride- Ceftazidime- Aesculin- Mannitol (PALCAM)
agar plates and incubated at 370C for 48 h. After
incubation, colonies with gray-green colour with a
sunken centre and halo were counted. Yersinia
identification agar was used for the isolation of Y.
enterocolitica. After incubation at 370C for 24 h., red,
bull’s eye colonies were counted. For the isolation of S.
aureus, Baird Parker (BP) agar plates were used and
incubated at 370C for 48 h. After incubation, grey black
to jet black colonies with light coloured margin
surrounded by an opaque zone were counted. From
selected dilution, 0.1 ml of the inoculum was
transferred to Brilliant Green Sulpha agar plates for
isolating S. enterica Typhimurium and incubated at
370C for 24 h. After incubation, pink coloured colonies
were counted and isolated colonies were subjected to
series of biochemical tests for confirmation. Extraction
Primer sequences used in this study were
synthesized by Sigma. The target genes were the hly A
(transcriptional activator of the virulence factor) gene
in L. monocytogenes, the ail (chromosomal location)
gene in Y. enterocolitica, the nuc (thermonuclease)
gene in S. aureus and the stm 4495 (putative type II
restriction enzyme) gene in S. enterica Typhimurium,
all of which had been reported as the most specific and
reliable genetic targets for the pathogens. The
sequences of the five primer pairs for the m-PCR, their
corresponding gene targets and size of amplification
products are shown in Table 2.
Multiplex PCR conditions
Multiplex PCR amplifications were conducted
in a reaction mixture containing 2.0µl PCR buffer (10x,
Sigma), 2.0µl MgCl2 (2.5mM, Sigma), 1.0µl dNTPs
(2mM each, Fermentas), 0.5µl of each primer (10pM,
Sigma), 0.2µl Taq Polymerase (5U/µl, Sigma) and 2µl
of template DNA, in a final volume of 25µl.
Amplification conditions were 2 min. at 950C, 35
cycles of 15sec. at 950C, 30sec. at 600C and 60sec. at
720C and a final extension of 10 min. at 720C.
After PCR reaction, 3µl of the PCR product was
resolved on 1.5% agarose gel. The gels were stained
with Ethidium bromide (0.2µg/ml) and photographed
under UV transillumination in gel documentation
system (Synoptics, UK).
Table 1: Bacterial strains used in study
Sl. No.
1.
2.
3.
4.
5.
6.
7.
Organisms
Listeria monocytogenes
Yersinia enterocolitica
Staphylococcus aureus
Salmonella enterica Typhimurium
Vibrio parahaemolyticus
E.coli
E.coli O157:H7
Strain Designation
MTCC 1143
MTCC 859
MTCC 1144
MTCC 98
MTCC 451
MTCC 3231
Lab strain in quality
control lab
Table 2: List of Primers used in study
Product
size (bp)
Organism
Target gene
Primer sequence
L. monocytogenes
hly A
F- GCAGTTGCAAGCGCTTGGAGTGAA
R- GCAACGTATCCTCCAGAGTGATCG
456
Y. enterocolitica
ail
F- TAATGTGTACGCTGCGAG
R- GACGTCTTACTTGCACTG
351
F- GCGATTGATGGTGATACGGTT
R- AGCCAAGCCTTGACGAACTAAAGC
270
F - GGTGGCAAGGGAATGAA
R - CGCAGCGTAAAGCAACT
915
S. aureus
S.enterica
Typhimurium
nuc
stm
Journal of Foodborne and Zoonotic Diseases | July-September, 2014 | Vol 2 | Issue 3 | Pages 45-49
© 2014 Jakraya Publications (P) Ltd
46
Latha et al.....Multiplex PCR for the simultaneous detection of four common food pathogens in meat
Standard conventional culture techniques for the
isolation and identification of organisms were also
carried out, in parallel not only to confirm the method
of m-PCR system but also to evaluate its performance
(APHA, 2001).
Optimization of the m-PCR amplification
The concentration of reagents for the m-PCR
(MgCl2, Taq DNA polymerase, dNTPs, primers and
Buffer) were from the published literature (Swetha et
al., 2012). Optimization of the annealing temperature
was carried out at different temperatures viz., 58, 60, 62
and 640C respectively.
Specificity of multiplex PCR
To evaluate the specificity of primers used in the
study, each DNA template prepared from the reference
strains was tested using a mixture of all pairs of
primers. Also, DNA extracts of commonly prevalent
and competing bacterial species such as E. coli, E. coli
O157:H7 and V. parahaemolyticus were tested by the
m-PCR assay.
results showed an
temperature of 600C.
optimal
multiplex
annealing
Specificity of PCR
The specificity of primers used in study was
assessed by carrying out m-PCR using the DNA
extracted from commonly prevalent and competing
bacterial species such as E. coli, E. coli O157:H7 and
V. parahaemolyticus. The results indicated that each
primer pair was specific for the corresponding target
organisms and there was no cross-reactivity to other
bacteria. The explicit detection of pathogen specific
genes (L. monocytogenes hly A gene: 456 bp; Y.
Enterocolitica ail gene: 351 bp; S. aureus nuc gene:
270 bp and Salmonella enteric Typhimurium stm gene:
915 bp) is evident in Fig 1.
L1 L2 L3 L4 L5 L6 L7
915bp
Sensitivity of multiplex PCR
The sensitivity of m-PCR assay was carried out
by artificial inoculation of meat. Meat samples were
purchased from retail market and ascetically transferred
to the laboratory in sterilized polythene bags and kept
frozen at -200C. The samples were tested
microbiologically for the presence of organisms under
study. After ensuring the absence of the organisms,
twenty five grams of meat was weighed and different
concentrations of L. monocytogenes, Y. enterocolitica,
S. aureus and S. enterica Typhimurium i.e.,1 cfu, 10
cfu, 102 cfu and 103cfu/g were inoculated together with
225ml of sterile Tryptic Soy Yeast extract broth
(TSBYE) and pummelled in a stomacher (AES
Chemiuex, France) for two minutes. An uninoculated
sample was also included as control to ensure the
sterility. Samples were then incubated at 37°C for 18h.
After enrichment, one millilitre aliquot was collected
from each sample for DNA extraction. Each sample
was analyzed in duplicate and the experiment was
independently repeated three times.
Results
In the present study, multiplex PCR method for
the simultaneous detection of L. monocytogenes, Y.
enterocolitica, S. aureus and S. enterica Typhimurium
was standardized using the primers targeting hly A, ail,
nuc and stm respectively. The organisms under study
were enriched in TSBYE at 370C for 18 h and DNA
was extracted by boiling and snap chilling method.
Optimization of PCR conditions
In the study, the reaction conditions (MgCl2,
Taq DNA polymerase, dNTPs, primers and Buffer)
were based on previous studies. The annealing
temperature for PCR was optimized in the study and
456bp
351bp
270bp
Fig 1: Specificity of multiplex PCR using
(L1-Marker, L2-S. enterica Typhimurium, L3-L.
monocytogenes, L4-Y. enterocolitica, L5-S. aureus,
L6-m-PCR using mixture of four organisms, L7-mPCR using mixture of E. coli, E. coli O157:H7, V.
parahaemolyticus)
Sensitivity of PCR
Sensitivity of standardised multiplex PCR
protocol was checked using four different
concentrations of mixed culture of L. monocytogenes,
Y. enterocolitica, S. aureus and S. enterica
Typhimurium i.e., 103, 102, 10 and 1cfu/g. The low
level of detection of the organism was found to be
1cfu/g as shown in the Fig 2.
Discussion
The foodborne pathogens are likely to cause
serious public health problems, especially in
developing countries where they lead to high level of
morbidity and mortality rates. Quick, sensitive, specific
and easy techniques for detection of the foodborne
pathogens are needed for the effective implementation
of food safety. Since its advent in the 1980s,
polymerase chain reaction (PCR) has become an
indispensible tool in molecular diagnostics and can be
very efficiently used in rapid detection of food-borne
pathogens (Pinto et al., 2005). Though PCR protocols
for individual organisms are common, protocols for the
Journal of Foodborne and Zoonotic Diseases | July-September, 2014 | Vol 2 | Issue 3 | Pages 45-49
© 2014 Jakraya Publications (P) Ltd
47
Latha et al.....Multiplex PCR for the simultaneous detection of four common food pathogens in meat
simultaneous detection of more than one organism are
rare.
L1
L2
L3
L4
L5
Fig 2: Sensitivity of multiplex PCR
(L1-Marker, L2-1cfu/g, L3-10cfu/g, L4-102cfu/g and
L5-103cfu/g)
In this study, a multiplex PCR assay was
developed that used four sets of primers to
simultaneously detect
L.
monocytogenes, Y.
enterocolitica, Salmonella enterica Typhimurium and
S. aureus from meat. The major improvement of the
current method from the previously reported methods is
use of multi pathogen enrichment media TSBYE for the
simultaneous growth of four organisms combined with
multiple target DNA identification to reliably and
effectively detect these pathogens in food.
For development of the m-PCR assay, the
selection of specific target genes for each of the four
target pathogens is very important. The hly A gene is
most commonly used for detecting L. monocytogenes,
and the gene is unique to that species (Rantsiou et al.,
2012). The ail gene in Y. enterocolitica has been
implicated as a more reliable target in the detection of
virulent strains (Lambertz et al., 2008). The nuc gene in
S. aureus strains is used as the major targets for the
identification of S. aureus isolates (Aprodu et al.,
2011). Liu et al. (2012) reported that primer targeting
stm 4495 gene is highly specific for Salmonella
enterica Typhimurium. In this study, primer
specificities were thoroughly tested by the m-PCR
method which demonstrated their suitability for
detecting these four major pathogens.
A potential advantage of the m-PCR is that it
has a high level of sensitivity. In artificially
contaminated meat, the multiplex PCR was able to
simultaneously detect the four pathogens in the
presence of background microflora, which were
determined by plating enriched samples on selective
plates for respective organisms. Detection limit was
achieved up to 1 cfu/g (initial inoculum level) of meat
after enrichment. Suo et al. (2010) reported that the
sensitivity of multiplex polymerase chain reaction for
simultaneous detection of Salmonella spp., E. coli
O157 and L. monocytogenes in meat products as 18
cfu/10g of meat. According to Guan et al. (2013) the
experiments showed a detection limit of 103 cfu/ml for
the simultaneous detection of Salmonella, E. coli
O157:H7, S. aureus, Y. enterocolitica and L.
monocytogenes.
Conclusion
In the present study, a rapid and sensitive
multiplex assay was developed for simultaneous
detection of L. monocytogenes, Y. enterocolitica, S.
aureus and S. enterica Typhimuriumin in meat by
combining a multi-pathogen enrichment strategy with a
multiplex PCR detection. Considering the sensitivity
and specificity, the multiplex PCR technique developed
appears to be a promising tool for the food industry for
the large scale screening of a large number of meat
samples that require either single or multiple pathogen
detection.
Acknowledgement
Kerala State Council for Science Technology
and Environment (KSCSTE) is duly acknowledged for
the financial support extended for this work.
References
APHA (2001). Compendium of methods for the
Microbiological examination of foods (4th Ed.).
Washington DC, pp 343-428.
Aprodu I, Walcher G, Schelin J, Hein I, Norling B,
Radstrom P, Nicolau A and Wagner M (2011).
Advanced sample preparation for the molecular
quantification of Staphylococcus aureus in
artificially and naturally contaminated milk.
International Journal of Food Microbiology, 145:
S61-S65.
Aydin A, Sudagidan M and Muratoglu K (2011).
Prevalence of Staphylococcal enterotoxins, toxin
genes and genetic-relatedness of foodborne S.
aureus strains isolated in the Marmara Region of
Turkey. International Journal of Food Microbiology,
148: 99-106.
Bottone EJ (1999). Yersinia enterocolitica: Overview and
epidemiologic correlates. Microbes and Infection, 1:
323-333.
Chai FP, Woan CW, Lay CC, Elexson N, Farinazleen MG,
Yoke KC, Yoshitsugu N, Mitsuaki N, Son R (2011).
Simultaneous detection of Salmonella spp.,
Salmonella typhi and Salmonella typhimurium in
sliced fruits using multiplex PCR. Food Control, 22:
337-342.
Guan ZP, Jiang Y, Gao F, Zhang L, Zhou GH and Guan
ZH (2013). Rapid and simultaneous analysis of five
foodborne pathogenic bacteria using multiplex PCR.
European Food Research and Technology, 237: 627637.
Kathariou S (2002). Listeria monocytogenes virulence and
pathogenicity, a food safety perspective. Journal of
Food Protection, 65: 1811-1829.
Journal of Foodborne and Zoonotic Diseases | July-September, 2014 | Vol 2 | Issue 3 | Pages 45-49
© 2014 Jakraya Publications (P) Ltd
48
Latha et al.....Multiplex PCR for the simultaneous detection of four common food pathogens in meat
Lambertz ST, Nilsson C, Hallanvuo S and Lindblad M
(2008). Real time PCR method for detection of
pathogenic Yersinia enterocolitica in food. Applied
Environmental Microbiology, 10: 6060-6067.
Latha C, Sunil B, Ajay Kumar VJ, Anu CJ and Deepa J
(2014). Evaluation of various cultural enrichment
methods for the isolation of selected bacterial food
borne pathogens. Veterinary World, 7(3): 172-176.
Lee SH, Jung BY, Rayamahji N, Lee HS, Jeon WJ, Choi
KS, Kweon CH and Yoo HS (2009). A multiplex
real time PCR for differential detection and
quantification of Salmonella spp., Salmonella enteric
serovar Typhimurium and Enteritidis in meats.
Journal of Veterinary Science, 10: 43-51.
Liu B, Zhou X, Zhang L, Liu W, Dan X, Shi C and Shi X
(2012). Development of a novel multiplex PCR
assay for the identification of Salmonella enteric
Typhimuurium and Enteritidis. Food Control, 27:
87-93.
McLauchlin J, Mitchell RT and Smerdon WJ (2004).
Listeria monocytogenes and listeriosis: a review of
hazard characterisation for use in microbiological
risk assessment of foods. International Journal of
Food Microbiology, 92:15-33.
Pinto B, Chenoll E and Aznar R (2005). Identification and
typing of foodborne Staphylococcus aureus by PCRbased techniques. Systematic and Applied
Microbiology, 28: 340-352.
Rantsiou K, Greppi A, Garosi M, Acquadro A, Mataragas
M and Cocolin L (2012). Strain dependent
expression of stress response and virulence genes of
Listeria monocytogenes in meat juices as determined
by microarray. International Journal of Food
Microbiology, 152: 116-122.
Robles GM, Loredo A, Ojeda G, Vega A, Chew Y,
Velarde S and Fratamico P (2008). Identification of
Salmonella serovars isolated from Cantaloupe and
Chile pepper production systems in Mexico by PCRRFLP. Journal of Food Protection, 71(11): 22172222.
Santos LR, Nascimento VP, Oliveira SD, Flores ML,
Pontes AP, Ribeiro AR, Salle CTP and Lopes RFF
(2001). Polymerase chain reaction (PCR) for the
detection of Salmonella in artificially inoculated
chicken meat. Revista do Instituto de Medicina
Tropical de Sao Paulo, 43(5): 247-250.
Severgnini M, Cremonesi P, Consolandi C, DeBellis G
and Castiglioni B (2011). Advances in DNA
microarray technology for the detection of foodborne
pathogens. Food and Bioprocess Technology, 4:
936-953.
Suo B, He Y, Tu SI and Shi X (2012). A multiplex realtime polymerase chain reaction for simultaneous
detection of Salmonella spp., Escherichia coli O157,
and Listeria monocytogenes in meat products.
Foodborne Pathogens and Diseases, 7(6): 619-628.
Swetha CS, Madhava Rao T, Krishnaiah N and Vijaya
Kumar A (2012). Detection of Listeria
monocytogenes in fish samples by PCR assay.
Annals of Biological Research, 3(4): 1880-1884.
Wang RF, Cao WW and Cerniglia CE (1997). A universal
protocol for PCR detection of 13 species of food
borne pathogens in foods. Journal of Applied
Microbiology, 83: 727-738.
Xu YG, Cui LC, Tian CY, Li SL, Cao JJ, Liu ZM and
Zhang GC (2012). A multiplex polymerase chain
reaction coupled with high performance liquid
chromatography assay for simultaneous detection of
six foodborne pathogens. Food Control, 25: 778783.
Journal of Foodborne and Zoonotic Diseases | July-September, 2014 | Vol 2 | Issue 3 | Pages 45-49
© 2014 Jakraya Publications (P) Ltd
49