Am J Physiol Cell Physiol 300: C496–C505, 2011.
First published December 9, 2010; doi:10.1152/ajpcell.00292.2010.
Reciprocal regulation of the primary sodium absorptive pathways in rat
intestinal epithelial cells
Steven Coon,* Ramesh Kekuda,* Prosenjit Saha, and Uma Sundaram
Section of Digestive Diseases, Clinical and Translational Science Institute, West Virginia University Health Science Center,
Morgantown, West Virginia
Submitted 28 July 2010; accepted in final form 10 November 2010
small interfering RNA; Na-glucose cotransport; Na/H exchanger 3;
intestinal epithelial transport; regulation of sodium absorption
IN THE NORMAL INTESTINE,
water absorption occurs secondary to
electrolyte and nutrient absorption (26). Absorption of electrolytes, nutrients, and fluid by the intestine is essential for the
survival of the organism. The primary electrolyte absorbed in the
mammalian intestine is sodium (13). Na/H exchange (NHE3,
SLC9A3) and Na-glucose cotransport (SGLT1, SLC5A1) are the
two predominant pathways of sodium absorption on the
brush border membrane (BBM) of villus cells in the mammalian intestine. In addition to the critical role SGLT1 plays
in sodium absorption, it is also equally important for the
assimilation of glucose, which is one of the most abundant
nutrients in the diet (33).
Dysregulated increases in sodium absorption contributes to
the development of hypertension (19). In diarrheal diseases
* S. Coon and R. Kekuda contributed equally to this work.
Address for reprint requests and other correspondence: U. Sundaram, One
Medical Center Dr., HSC 5570, West Virginia Univ. School of Medicine,
Morgantown, WV 26506 (e-mail: [email protected]).
C496
such as cholera, the primary cause of infant mortality in
developing countries, sodium absorption via NHE3 is known
to be diminished (31). The most important treatment modality for
these conditions, oral rehydration therapy, is based on the preservation of SGLT1 function (32). So while the importance of these
two BBM transporters in health and disease is unparalleled,
whether these two proteins may affect the function of each other
in physiological or pathophysiological states is unknown.
In the SLC5 family of transporters, SGLT1– 6 exist in
mammals (32). Of these six Na-glucose cotransporters,
SGLT1, SGLT4, and SGLT6 are present in the intestine.
SGLT1 is the most highly expressed in the mucosa of the small
intestine and transports glucose more efficiently than any of the
other Na-glucose cotransporters (32, 34). SGLT1 is a 14
transmembrane protein with a substantial cytoplasmic tail
which is known to be essential for proper activity (34). In the
SLC9 family of proteins, nine Na/H exchanger isoforms are
also known to exist (14, 35). In this family, NHE1, NHE2, and
NHE3 are expressed in the epithelial cells of the intestine.
They are 10 –12 membrane proteins, and NHE3 and NHE2 are
on the brush border of villus cells while NHE1 is present on the
basolateral membrane of both villus and crypt cells (35). The
majority of these Na/H exchangers are specific for sodium and
proton exchange although some, such as NHE8, can transport
other ions (e.g., K⫹). NHE3 is largely responsible for whole
body sodium absorption while NHE1 is more responsible for
cellular pH and volume regulation. In humans, under basal
conditions, the majority of sodium absorption is believed to be
mediated by NHE3 in the intestine and colon (7). Therefore,
NHE3 and SGLT1 are primarily responsible for whole body
sodium absorption. How NHE3 and SGLT1 may together
regulate sodium absorption in the small intestine is not known.
METHODS
Cell culture. Rat small intestinal cells (IEC-18, American Type
Culture Collection), between passages 5 and 30, were routinely
maintained in the laboratory in DMEM [4.5 g/l glucose, 3.7 g/l
sodium bicarbonate, 2 mM L-glutamine, 10% (vol/vol) bovine fetal
serum, 100 U/l human insulin, 0.25 mM ␤-hydroxybutyric acid, 100
U/ml penicillin, and 100 ␮g/ml streptomycin] in a humidified atmosphere of 10% CO2 at 37°C. The cells were fed with fresh medium
every 2 to 3 days, and the cells were passaged with 0.1% trypsin0.04% EDTA in phosphate-buffered saline (PBS).
RNA interference. Silencer predesigned negative control (catalog
no. 4611), SGLT1 (SLC5A1)-specific (ID 197575) and NHE3
(SLC9A3)-specific [small interfering RNA (siRNA) ID 200129] siRNAs (Ambion) were used for siRNA transfections. The siRNAs (1.5
␮g of each) were suspended in nucleofector solution (pH 7.4, 7.1 mM
ATP, 11.6 mM MgCl2.6H2O, 13.6 mM NaHCO3, 84 mM KH2PO4
and 2.1 mM glucose) and were individually nucleofected into IEC-18
cells using a Nucleofector II device (Amaxa) according to the man-
0363-6143/11 Copyright © 2011 the American Physiological Society
http://www.ajpcell.org
Downloaded from http://ajpcell.physiology.org/ by 10.220.33.2 on June 18, 2017
Coon S, Kekuda R, Saha P, Sundaram U. Reciprocal regulation
of the primary sodium absorptive pathways in rat intestinal epithelial
cells. Am J Physiol Cell Physiol 300: C496 –C505, 2011. First published December 9, 2010; doi:10.1152/ajpcell.00292.2010.—Sodium
absorption in the mammalian small intestine occurs predominantly by
two primary pathways that include Na/H exchange (NHE3) and
Na-glucose cotransport (SGLT1) on the brush border membrane
(BBM) of villus cells. However, whether NHE3 and SGLT1 function
together to regulate intestinal sodium absorption is unknown. Nontransformed small intestinal epithelial cells (IEC-18) were transfected
with either NHE3 or SGLT1 small interfering RNAs (siRNAs) and
were grown in confluent monolayers on transwell plates to measure
the effects on Na absorption. Uptake studies were performed as well
as molecular studies to determine the effects on NHE3 and SGLT1
activity. When IEC-18 monolayers were transfected with silencing
NHE3 RNA, the cells demonstrated decreased NHE3 activity as well
as decreased NHE3 mRNA and protein. However, in NHE3 siRNAtransected cells, SGLT1 activity, mRNA, and protein in the BBM
were significantly increased. Thus, inhibition of NHE3 expression
regulates the expression and function of SGLT1 in the BBM of
intestinal epithelial cells. In addition, IEC-18 cells transected with
silencing SGLT1 RNA demonstrated an inhibition of Na-dependent
glucose uptake and a decrease in SGLT1 activity, mRNA, and protein
levels. However, in these cells, Na/H exchange activity was significantly increased. Furthermore, NHE3 mRNA and protein levels were
also increased. Therefore, the inhibition of SGLT1 expression stimulates the transcription and function of NHE3 and vice versa in the
BBM of intestinal epithelial cells. Thus this study demonstrates that
the major sodium absorptive pathways together function to regulate
sodium absorption in epithelial cells.
REGULATION OF SODIUM ABSORPTIVE PATHWAYS
AJP-Cell Physiol • VOL
Western blot analysis. Western blot experiments were performed
according to standard protocols, with slight modifications (3). For all
conditions, IEC-18 cells were solubilized in RIPA buffer [50 mM
Tris·HCl pH 7.4, 1% Igepal, 150 mM NaCl, 1 mM EDTA, 1 mM
phenylmethylsulfonyl fluoride, 1 mM Na3VO4, 1 mM NaF, and
protease inhibitor cocktail (SAFC Biosciences)] and separated on a
4 –20% Ready Gel (Bio-Rad). Separated proteins were transferred
onto BioTrace PVDF Transfer Membrane (Pall) for SGLT1 Western
blotting or Amersham Hybond-C Extra nitrocellulose membrane (GE
Healthcare Biosciences) for NHE3 Western blotting. SGLT1 was
probed by a primary rabbit polyclonal antibody raised against a
synthetic peptide, corresponding to amino acids 603– 623 of human
SGLT1 (Abcam). NHE3 was probed by a primary chicken polyclonal
antibody (Alpha Diagnostics) raised against a synthetic peptide corresponding to COOH-terminal 22 amino acid peptide of rat NHE3.
Appropriate horseradish peroxidase-conjugated secondary antibodies
were used to monitor the binding of the primary antibodies. ECL
Western Blotting Detection Reagent (GE Healthcare) was used to
detect the immobilized SGLT1 and NHE3 by chemiluminescence.
The intensity of the bands was quantitated using a densitometric
scanner (Molecular Dynamics).
Immunocytochemistry studies. Transfected IEC-18 cells were
grown on a coverslip for 7 days and fixed in 4% (vol/vol) paraformaldehyde for 20 min. Antigen retrieval was performed by incubating
the cells with 0.5% Triton X-100 (Sigma-Aldrich) in PBS for 2 min
at room temperature. Nonspecific binding sites in the tissue sections
were blocked by incubation with 2% fetal bovine serum in PBS for 30
min. The cells were then incubated overnight with 1:500 diluted goat
anti-rat SGLT1 (Santa Cruz Biotechnology) and 1:250 diluted chicken
anti-rat NHE3 (Alpha Diagnostic) primary polyclonal antibodies.
Tissue sections were washed with PBS to remove excess antibodies
and were incubated with either Alexa Fluor 555 rabbit anti-goat IgG
or Alexa Fluor 488 goat anti-chicken IgG (Invitrogen) to detect
SGLT1 and NHE3, respectively. Excess secondary antibodies were
removed by washing with PBS, and the tissue sections were mounted
using ProLong Gold Antifade Reagent (Invitrogen). Finally, the
fluorescence signals generated were observed under a Zeiss LSM510
confocal microscope, and image files of the mucosal surface were
acquired. In addition, multiple image stacks (4 ␮m) of the xz plane of
the apical side were photographed by Zeiss LSM image software.
Densitometric analyses of the xz plane were performed using MacBiophotonics ImageJ software to compare the expression of SGLT1 and
NHE3 in different conditions (6).
Data presentation. When data were averaged, means ⫾ SE are
shown, except when error bars are inclusive within the symbol. All
uptakes and RTQ-PCR were done in triplicate unless otherwise
specified. The number (n) for any set of experiments refers to uptake
experiments, total RNA, or protein extracts from different sets of
cells. Student’s t-test was used for statistical analysis.
RESULTS
Effect of silencing NHE3 on SGLT1. Na-glucose cotransport
activity (SGLT1) was measured as Na-dependent glucose uptake. Na/H exchange activity (NHE3) was measured as protondependent EIPA-sensitive Na uptake. To determine whether
the inhibition of NHE3 expression regulates SGLT1 activity,
IEC-18 cells were transfected with NHE3 siRNA. In these
cells, NHE3 activity was significantly reduced (Fig. 1A). However, SGLT1 activity was markedly increased (Fig. 1B). Thus
these data indicated that inhibition of NHE3 expression stimulates SGLT1 activity in intestinal epithelial cells.
Effect of silencing NHE3 on alanine, serine, cysteine transporter 1. To determine whether inhibition of NHE3 selectively
regulates SGLT1 rather than just any Na-nutrient cotransport
process in the BBM of IEC-18 cells, we investigated Na-alanine
300 • MARCH 2011 •
www.ajpcell.org
Downloaded from http://ajpcell.physiology.org/ by 10.220.33.2 on June 18, 2017
ufacturer’s recommended protocol. Approximately 200,000 cells were
plated into each transwell [Millicell Hanging Cell Culture Inserts, 24
mm diameter, 1 ␮m pore-size polyethylene terephthalate filter supports (Millipore), placed into six-well cell culture plates]. The cells
were grown for 7 days for transport studies and Western blotting
analyses and 48 h for quantitative RT-PCR (RTQ-PCR) experiments.
Uptake studies in IEC-18 cells. Uptake studies for SGLT1 were
performed using [3H]-3-O-methyl-D-glucose (3-OMG; GE Healthcare
Biosciences) in confluent nucleofected IEC-18 cells. Cells were incubated with Leibovitz’s L-15 medium (Invitrogen) containing supplements (as described for DMEM above) for 1 h at room temperature.
The cells were subsequently washed and incubated for 10 min at room
temperature with 130 mM trimethylammonium chloride (TMA-Cl) in
HEPES buffer (pH 7.4, 4.7 mM KCl, 1 mM MgSO4, 1.2 mM
KH2PO4, 20 mM HEPES, and 1.25 mM CaCl2). Glucose uptake
studies were performed by incubating the cells with 100 ␮M 3-OMG
in 130 mM NaCl or 130 mM TMA-Cl buffer to measure the uptake in
the presence and absence of sodium, respectively. Uptake was arrested by washing the cells with ice-cold HEPES buffer containing
130 mM TMA-Cl as described above. Cells were lysed in 800 ␮l of
1 N NaOH by incubation for 30 min at 70°C and mixed with 5 ml
Ecoscint A (National Diagnostics), and the radioactivity retained by
the cells was determined in a Beckman 6500 scintillation counter.
Na/H exchange activity measurements for all conditions were
performed in a similar fashion using 1 mM 22Na chloride as substrate
added to 130 mM TMA in HEPES buffer as described above.
5-(N-ethyl-N-isopropyl) amiloride (EIPA)-sensitive Na/H exchange
was measured by deducting the Na/H exchange activity in the presence of 50 ␮M EIPA (Sigma-Aldrich) from the total Na/H exchange
activity of the IEC-18 cells. EIPA inhibits only NHE3 since this is
added only to the BBM (which would not inhibit NHE1 on the
basolateral membrane, and not NHE2 either since it is not detectable
in these cells).
Na-alanine uptake measurements for all conditions were performed
as described above for Na-glucose cotransport, except using 200 ␮M
[3H]-L-alanine in 130 mM NaCl or TMA-Cl in HEPES buffer.
Protein determination. Total protein was measured by the Lowry
method, using the Bio-Rad protein assay kit (Hercules, CA). BSA was
used as a standard.
Isolation of total RNA and mRNA expression analysis by RTQ-PCR.
For all conditions, total RNA was isolated form IEC-18 cells using
RNeasy Plus total RNA purification mini kits (Qiagen). First-strand
cDNA synthesis was performed using SuperScript III (Invitrogen Life
Technologies). The cDNAs synthesized were used as templates for
RTQ-PCR using the TaqMan Universal PCR Master Mix (Applied
Biosystems) according to the manufacturer’s protocol. RTQ-PCR
experiments for rat ␤-actin were performed using TaqMan Gene
Expression Assay (assay ID 4352931E; Applied Biosystems). RTQPCR primers for rat SGLT1 and NHE3 were custom-synthesized
using the oligonucleotide synthesis service provided by Applied
Biosystems.
The primer and probe sequences used for rat SGLT1 RTQ-PCR
were as follows: forward primer, 5=-TTGTGGAGGACAGTGGTGAA-3=; reverse primer, 5=-AAAATAGGCGTGGCAGAAGA-3=;
TaqMan probe, 5=-FAM CATCAACGGCATCATCCTCCTGG
TAMRA-3=.
The primer and probe sequences used for rat NHE3 RTQ-PCR
were as follows: forward primer, 5=-CTCTGGGGCAGGAATTGATA-3=; reverse primer, 5=-CACCCTGGATAGGATGCTTG-3=;
TaqMan probe, 5=-FAM TGTGTTCTCCCCTGACGAGGATCTG
TAMRA-3=.
The expression of ␤-actin RTQ-PCR was run along with the
SGLT1 and NHE3-specific RTQ-PCR as an endogenous control
under similar conditions to normalize the expression levels of SGLT1
and NHE3 between individual samples. RTQ-PCR analyses were
performed in triplicate and repeated three times using RNA isolated
from three sets of IEC-18 cells.
C497
C498
REGULATION OF SODIUM ABSORPTIVE PATHWAYS
cotransport that is mediated by alanine, serine, cysteine transporter
1 (ASCT1; 25). In NHE3 siRNA-transfected IEC-18 cells, alanine
transport was unaffected (Fig. 3 of Ref. 25; Na-dependent alanine
uptake was 5.9 ⫾ 0.8 nmol·mg protein⫺1·2 min⫺1 in control and
6.1 ⫾ 0.3 in NHE3 siRNA-transfected cells, n ⫽ 4). These data
indicated that stimulation of SGLT1 by NHE3 siRNA may be
specific for SGLT1.
SGLT1 kinetic studies in NHE3 siRNA-transfected cells. To
determine the mechanism of regulation of SGLT1 by NHE3
silencing, kinetic studies were performed. In NHE3 siRNAtransfected cells, Na-dependent glucose uptake was stimulated
and subsequently became saturated as the extracellular concentration of glucose was increased (Fig. 1C). The affinity for
Fig. 1. Effect of Na/H exchanger 3 (NHE3) silencing on Na-glucose cotransporter 1 (SGLT1) in small intestinal epithelial cells (IEC-18). A: in NHE3silenced cells, NHE3 activity was significantly reduced compared with IEC-18
cells transfected with negative control small interfering RNA (siRNA).
B: However, in NHE3-silenced cells, SGLT1 activity was increased significantly compared with IEC-18 cells transfected with negative control siRNA.
Thus, silencing NHE3 stimulates SGLT1 activity. C: kinetics of SGLT1
stimulation of Na-dependent [3H]-3-O-methyl-D-glucose (OMG) uptake is
shown as a function of varying concentrations of extracellular glucose in
NHE3-silenced cells. Uptake for all concentrations was determined at 30 s. A
representative kinetics plot shows that as the concentration of extracellular
glucose was increased, uptake of glucose was stimulated and subsequently
became saturated in IEC-18 cells in the negative control siRNA and NHE3
siRNA-transfected cells. Analysis of the data provided kinetic parameters. The
affinity for glucose was not affected in NHE3 siRNA-treated cells (Km was
12.4 ⫾ 2.3 mM in control and 11.6 ⫾ 1.3 in NHE3 siRNA-transfected cells;
n ⫽ 5). However, the Vmax or maximal rate of uptake of glucose was increased
in cells transfected with NHE3 siRNA (Vmax was 4.2 ⫾ 0.2 nmol/mg protein
for 30 s in control and 10.3 ⫾ 0.3 in NHE3 siRNA-transfected cells, P ⬍ 0.01,
n ⫽ 5). Thus, the mechanism of stimulation of SGLT1 when NHE3 is silenced
is due to increased transporter numbers.
AJP-Cell Physiol • VOL
300 • MARCH 2011 •
www.ajpcell.org
Downloaded from http://ajpcell.physiology.org/ by 10.220.33.2 on June 18, 2017
glucose was not significantly altered in NHE3 siRNA-treated
cells (Km was 12.4 ⫾ 2.3 mM in control and 11.6 ⫾ 1.3 in
NHE3 siRNA-transfected cells; n ⫽ 5). However, the Vmax or
maximal rate of uptake of glucose was significantly increased
in cells transfected with NHE3 siRNA (Vmax was 4.2 ⫾ 0.2
nmol·mg protein⫺1·30 s⫺1 in control and 10.3 ⫾ 0.3 in NHE3
siRNA-transfected cells; P ⬍ 0.01, n ⫽ 5). These studies
indicated that the mechanism of stimulation of SGLT1 activity
by NHE3 siRNA transfection in IEC-18 cells was due to an
increase in the number of cotransporters rather than an alteration in the affinity of the cotransporter for glucose.
NHE3 and SGLT1 mRNA expression in IEC-18 cells transfected with NHE3 siRNA. To determine the molecular mechanism of stimulation of SGLT1 by NHE3 siRNA in IEC-18
cells, mRNA levels were determined by RTQ-PCR. Transfection of IEC-18 cells with NHE3 siRNA decreased NHE3
mRNA levels in these cells (Fig. 2A). However, in these cells,
SGLT1 mRNA levels increased significantly (Fig. 2B). These
data indicated that inhibition of NHE3 with NHE3 siRNA
results in the stimulation of SGLT1 activity due to an increase
in the message for SGLT1. Thus, inhibition of NHE3 expression appears to regulate the expression of SGLT1 at the
transcriptional level in IEC-18 cells.
NHE3 and SGLT1 protein expression in IEC-18 cells transfected with NHE3 siRNA. Since mRNA levels do not necessarily correlate with functional protein levels on the BBM, to
further decipher the molecular mechanism of regulation of
SGLT1 by NHE3 in IEC-18 cells Western blot studies were
performed. In IEC-18 cells transfected with the NHE3 siRNA,
NHE3 protein levels were decreased significantly in the BBM
(Fig. 2C). However, in these cells SGLT1 protein levels were
increased significantly (Fig. 2D). These data in conjunction
with the kinetic studies and the mRNA RTQ-PCR studies
clearly indicates that when NHE3 expression is inhibited in
IEC-18 cells, it stimulates SGLT1 by increasing the synthesis
and the number of SGLT1 transporters in the BBM.
Immunocytochemistry of NHE3 silencing on SGLT1 expression.
To demonstrate the effect of NHE3 siRNA at the cellular level,
immunocytochemistry experiments were performed using
NHE3 and SGLT1-specific primary antibodies. As seen in Fig. 3,
after transfection of NHE3 siRNA, NHE3 protein is decreased
REGULATION OF SODIUM ABSORPTIVE PATHWAYS
C499
(compare Fig. 3B with Fig. 3A) while SGLT1 protein levels are
increased (compare Fig. 3D with Fig. 3C). To more accurately
measure BBM protein expression levels of both NHE3 and
SGLT1, side view images (xz projections) were generated (data
not shown) and the fluorescence intensity of the proteins of
several tissues was measured. The fluorescent intensity in the
negative control siRNA-transfected cells was given an arbitrary value of 1, and the intensities obtained after NHE3 siRNA
transfection were plotted and compared. NHE3 flourescence
decreased significantly (Fig. 3E) while SGLT1 protein fluorescence increased significantly (Fig. 3F). Thus, these data demonstrated that siRNA-mediated reduction in NHE3 in IEC-18
cells enhances SGLT1 expression on the BBM.
Effect of silencing SGLT1 on NHE3. To determine whether
the inhibition of SGLT1 expression regulates NHE3, Na/H
exchange activity was measured as proton-dependent EIPAsensitive Na uptake. In SGLT1 siRNA-transfected IEC-18
cells, SGLT1 was significantly reduced (Fig. 4A). On transwell
AJP-Cell Physiol • VOL
plates, only NHE3 is present on the BBM while NHE2 expression is undetectable (data not shown). In cells transfected with
SGLT1 siRNA, NHE3 activity was markedly increased (Fig.
4B). These data indicated that inhibition of SGLT1 stimulates
NHE3 activity in intestinal epithelial cells.
NHE3 kinetic studies in SGLT1 siRNA-transfected cells. To
determine the mechanism of regulation of NHE3 by the inhibition of SGLT1 expression, kinetic studies were performed. In
SGLT1 siRNA-transfected IEC-18 cells, the uptake of protondependent EIPA-sensitive Na uptake was stimulated and subsequently became saturated as the extracellular concentration
of Na was increased (Fig. 4C). The affinity for sodium was not
altered significantly by SGLT1 siRNA transfection (Km was
4.70 ⫾ 0.3 mM in control and 7.20 ⫾ 0.1 in SGLT1 siRNAtransfected cells; n ⫽ 4). However, the Vmax or maximal rate of
uptake of sodium was significantly increased in cells transfected with SGLT1 siRNA (Vmax was 1.4 ⫾ 0.1 nmol·mg
protein⫺1·30 s⫺1 in control and 4.2 ⫾ 0.1 in SGLT1 siRNA-
300 • MARCH 2011 •
www.ajpcell.org
Downloaded from http://ajpcell.physiology.org/ by 10.220.33.2 on June 18, 2017
Fig. 2. Effect of NHE3 silencing on SGLT1 message and protein expression in IEC-18 cells. Quantitative RT-PCR (RTQ-PCR) analysis of NHE3 and SGLT1
in NHE3 siRNA-transfected IEC-18 cells is shown. A: as expected, in NHE3-silenced cells, NHE3 message was significantly reduced compared with control
IEC-18 cells transfected with negative control siRNA. B: however, in NHE3-silenced cells, SGLT1 message was increased significantly compared with control
IEC-18 cells. Thus, silencing NHE3 stimulates SGLT1 mRNA levels. C: in NHE3-silenced cells, NHE3 protein was significantly reduced compared with IEC-18
cells transfected with negative control siRNA. D: however, in NHE3-silenced cells, SGLT1 protein was increased significantly compared with IEC-18 cells
transfected with negative control siRNA. Ezrin control is for both blots. Thus, silencing NHE3 stimulates SGLT1 at the protein level.
C500
REGULATION OF SODIUM ABSORPTIVE PATHWAYS
transfected cells; P ⬍ 0.01, n ⫽ 4). These studies indicated that
the mechanism of NHE3 stimulation by SGLT1 siRNA transfection in IEC-18 cells was the result of an increase in NHE3
exchanger expression in the BBM rather than an alteration in
the affinity of the exchangers for sodium.
NHE3 and SGLT1 mRNA expression in IEC-18 cells transfected with NHE3 siRNA. To determine the molecular mechanism of stimulation of NHE3 activity by SGLT1 siRNA
transfection in IEC-18 cells, mRNA levels were determined
by RTQ-PCR. Transfection of IEC-18 cells with SGLT1
siRNA decreased SGLT1 mRNA levels (Fig. 5A). However,
in these cells, NHE3 mRNA increased significantly (Fig.
5B). These data indicated that inhibition of SGLT1 with
AJP-Cell Physiol • VOL
siRNA results in the stimulation of NHE3 activity due to an
increase in the message for NHE3. Thus, the inhibition of
SGLT1 expression stimulates NHE3 at the transcriptional
level in IEC-18 cells.
SGLT1 on NHE3 protein expression in IEC-18 cells transfected with SGLT1 siRNA. Since mRNA levels do not necessarily correlate with functional protein levels in epithelial cells,
Western blot analysis was performed. In IEC-18 cells transfected with the SGLT1 siRNA, SGLT1 protein levels were
decreased (Fig. 5C). However, in these cells, NHE3 protein
levels were increased significantly (Fig. 5D). These data in
conjunction with the kinetic and RTQ-PCR studies clearly
indicate that when SGLT1 expression is inhibited in IEC-18
300 • MARCH 2011 •
www.ajpcell.org
Downloaded from http://ajpcell.physiology.org/ by 10.220.33.2 on June 18, 2017
Fig. 3. Immunocytochemical analysis of the effect of NHE3 silencing on SGLT1 protein in IEC-18 cells. IEC-18 cells transfected with negative control or NHE3
siRNA were subjected to immunocytochemical analysis using NHE3 and SGLT1-specific primary antibodies. A and C: top views of IEC-18 cells treated with
negative control siRNA expressing NHE3 (A) and SGLT1 (C). B and D: top views of IEC-18 cells expressing NHE3 (B) and SGLT1 (D) after transfection with
NHE3 siRNA. E and F: quantitative data of the fluorescence intensities of negative control and NHE3 siRNA-transfected cells (n ⫽ 4, *P ⬍ 0.05). These data
demonstrated that siRNA-mediated reduction in NHE3 in IEC-18 cells enhances SGLT1 expression.
REGULATION OF SODIUM ABSORPTIVE PATHWAYS
C501
DISCUSSION
Fig. 4. Effect of SGLT1 silencing on NHE3 in IEC-18 cells. A: in SGLT1silenced cells, SGLT1 activity was significantly reduced compared with
IEC-18 cells transfected with negative control siRNA. B: however, in SGLT1silenced cells, NHE3 activity was increased significantly compared with
IEC-18 cells transfected with negative control siRNA. Thus, silencing SGLT1
stimulates NHE3 activity. C: a representative kinetics plot of NHE3 stimulation of EIPA-sensitive proton-dependent 22Na uptake is shown as a function of
varying concentrations of extracellular sodium in SGLT1-silenced cells. Uptake for all concentrations was determined at 30 s. As the concentration of
extracellular sodium was increased, uptake of sodium was stimulated and
subsequently became saturated in IEC-18 cells in the negative control siRNA
and SGLT1 siRNA-transfected cells. Analysis of the data provided kinetic
parameters. The affinity for sodium was not affected statistically by SGLT1
siRNA transfection (Km was 4.70 ⫾ 0.3 mM in control and 7.20 ⫾ 0.1 in
SGLT1 siRNA-transfected cells;, n ⫽ 4). However, the Vmax or maximal rate
of uptake of sodium was significantly increased in cells transfected with
SGLT1 siRNA (Vmax was 1.4 ⫾ 0.1 nmol·mg protein⫺1·30 s⫺1 in control and
4.2 ⫾ 0.1 in SGLT1 siRNA-transfected cells; P ⬍ 0.01, n ⫽ 4). Thus, the
mechanism of stimulation of NHE3 when SGLT1 is silenced is due to
increased transporter numbers.
AJP-Cell Physiol • VOL
Because sodium is one of the primary electrolytes absorbed,
its assimilation is critical for the maintenance of health. When
sodium homeostasis is disrupted, water balance is also affected, contributing to hypertension and diseases that promote
diarrhea. In the mammalian intestine the predominant sodium
absorptive pathways are Na/H exchange and Na-glucose
cotransport found on the BBM of villus cells (13, 31, 32). Na/H
exchange in conjunction with Cl/HCO3 exchange is the means
by which coupled NaCl absorption occurs in the mammalian
small intestine (23).
In view of the significance of these two transport proteins in
mammalian intestinal physiology, many studies have been
conducted involving their regulation in health and in disease
(21, 32). However, no study has been undertaken to determine
whether the expression and activity of these two transporters
found on the BBM of the villus cells function together to
regulate sodium absorption. This study for the first time demonstrates that sodium absorption is regulated by the primary
absorptive pathways in epithelial cells.
Intestinal mucosal electrolyte transport proteins have been
shown to affect one another. It has been suggested that HCO3
secretion by intestinal crypt cells may occur as a result of
stimulation of the Na/H exchange on the basolateral membrane
which then alkalinizes the cell, resulting in the stimulation of
BBM Cl/HCO3 exchange (22). It has also been demonstrated
that coupled NaCl absorption occurs in the BBM of intestinal
villus cells via the dual operation of Na/H and Cl/HCO3
exchange and that this coupling is mediated by intracellular pH
(23). In support of this hypothesis, in the NHE3 knockout mouse
the expression of a Cl/HCO3 exchanger (downregulated in adenoma, DRA) is upregulated (18), whereas in the DRA knockout
mouse, NHE3 is upregulated in the colon (20). Others have
speculated that inhibition of BBM Na/H exchange may increase
bicarbonate secretion by activating anion exchangers in the BBM
(7). The cystic fibrosis transmembrane regulator (CFTR) and
Cl/HCO3 exchangers have also been shown to regulate one
another (10, 15–17, 30) as well as indirectly increasing Na/H
exchange activity by altering cell volume (8).
300 • MARCH 2011 •
www.ajpcell.org
Downloaded from http://ajpcell.physiology.org/ by 10.220.33.2 on June 18, 2017
cells it stimulates NHE3 activity by increasing the expression
of NHE3 transporters in epithelial cells.
Immunocytochemistry of SGLT1 silencing on NHE3 expression.
To determine whether there are changes in the brush border
expression of NHE3 protein, immunocytochemistry experiments of IEC-18 cells were performed (Fig. 6). With the
transfection of SGLT1 siRNA, the levels of SGLT1 expression
on the BBM decreased (Fig. 6B) compared with control (Fig.
6A). However, in these cells, BBM NHE3 expression is increased (Fig. 6D) compared with control cells (Fig. 6C). To
accurately quantitate BBM expression of SGLT1 and NHE3,
an xz projection of the cells was generated (data not shown).
The fluorescence intensity in negative control siRNA-treated
cells was given an arbitrary value of 1. The intensities measured after transfection of SGLT1 siRNA into IEC18 cells
show that SGLT1-specific fluorescence decreased (Fig. 6E)
while NHE3-specific fluorescence increased (Fig. 6F). These
results indicated a significant reduction in BBM SGLT1 expression after transfection with SGLT1 siRNA while it enhances BBM NHE3 expression.
C502
REGULATION OF SODIUM ABSORPTIVE PATHWAYS
Na-nutrient cotransporters are also affected by other transporter proteins. For example, Na-K-ATPase on the basolateral
membrane of villus cells, by maintaining low steady-state
intracellular sodium levels, provides the favorable electrochemical gradient necessary for the functioning of BBM Nasolute cotransport processes including SGLT1 (24). Studies
using diabetic patients have also shown a link of SGLT1 to
glucose transporter 2 (GLUT2) in intestinal villus cells and that
SGLT1 function stimulates the expression of GLUT2 in the
BBM of intestinal epithelia. Indirect linkage between NHE3
and SGLT1 mediated by intracellular sodium was also postulated as a result of the in vivo studies to inhibit constitutive
nitric oxide production in the rabbit small intestine (4, 5).
There have been some reports of nutrient transporters affecting electrolyte transport. It has been reported that PEPT1, a
AJP-Cell Physiol • VOL
proton-dependent dipeptide transporter, is linked to Na/H exchange in mammalian intestinal epithelial cells to regulate
cellular pH (1, 2, 11, 12, 28) as well as the activation of other
proton-solute cotransporter processes to stimulate Na/H exchange in intestinal epithelial cells (27). Interestingly, colon
cancer cells (Caco-2) transfected with SGLT1 immediately
upon activation have been suggested to stimulate Na/H exchange. Such activation alkalinized these cells and would have
been expected to inhibit, not stimulate, Na/H exchange (29).
This type of regulation is also a very short-term interaction
between the two transporters unlike the more stable clinical
condition of this study.
Analogous to the NHE3 siRNA-transfected IEC-18 cells,
mouse models of NHE3 knockout exist and have been shown
to have impaired Na absorption. However, unlike in IEC-18
300 • MARCH 2011 •
www.ajpcell.org
Downloaded from http://ajpcell.physiology.org/ by 10.220.33.2 on June 18, 2017
Fig. 5. Effect of SGLT1 silencing on NHE3 message and protein expression in IEC-18 cells. RTQ-PCR analysis of NHE3 and SGLT1 in SGLT1
siRNA-transfected IEC-18 cells is shown. A: as expected, in SGLT1-silenced cells, SGLT1 message was significantly reduced compared with control IEC-18
cells transfected with negative control siRNA. B: however, in SGLT1-silenced cells, NHE3 message was increased significantly compared with control IEC-18
cells. Thus, silencing SGLT1 stimulates NHE3 mRNA levels. C: in SGLT1-silenced cells, SGLT1 protein was significantly reduced compared with IEC-18 cells
transfected with negative control siRNA. D: however, in SGLT1-silenced cells, NHE3 protein was increased significantly compared with IEC-18 cells transfected
with negative control siRNA. A representive blot for each condition and densitometric analysis of four blots are given. Ezrin control is for both blots. Thus,
silencing NHE3 stimulates SGLT1 at the protein level.
REGULATION OF SODIUM ABSORPTIVE PATHWAYS
C503
cells where the compensation appears to be mediated by
SGLT1, in mice the compensation appears to be mediated by
an amiloride-sensitive mechanism, likely NHE2 (9). This isoform of Na/H exchange is not present in IEC-18 cells. Nevertheless, with this compensation it would have been interesting
to see whether the compensatory change in SGLT1 was present. However, in that article, the mucosal incubation media
specifically had no glucose, thus removing its effects on Na
transport. Therefore, the effect of NHE3 knockout on SGLT1
compensation if any was not known. Since there are no SGLT1
knockouts, likely owing to the fact that this may be a lethal
knockout, our findings in vitro with SGLT1 siRNA-transfected
IEC-18 cells cannot be correlated with in vivo studies.
AJP-Cell Physiol • VOL
However, in none of these studies has it been shown that
sodium absorption is regulated by the two primary BBM
sodium absorptive pathways in what may be a compensatory
fashion in intestinal epithelial cells. Thus, while existing evidence suggests that some transporters do affect one another,
there are currently no reports of major villus BBM sodiumabsorbing transporters affecting one another to presumably
maintain sodium homeostasis. In this present study, inhibition
of NHE3 expression with NHE3 siRNA stimulated SGLT1
activity. Kinetic studies demonstrated that the mechanism of
stimulation of SGLT1 was secondary to an increase in Vmax
without a change in the affinity of the transporter for sodium
(Fig. 1C). Molecular studies using RTQ-PCR showed that the
300 • MARCH 2011 •
www.ajpcell.org
Downloaded from http://ajpcell.physiology.org/ by 10.220.33.2 on June 18, 2017
Fig. 6. Immunocytochemical analysis of the effect of SGLT1 silencing on NHE3 protein in IEC-18 cells. IEC-18 cells transfected with negative control or SGLT1
siRNA were subjected to immunocytochemical analysis using NHE3 and SGLT1-specific primary antibodies. A and C: top views of IEC-18 cells treated with
negative control siRNA expressing SGLT1 (A) and NHE3 (C). B and D: top views of IEC-18 cells expressing SGLT1 (B) and NHE3 (D) after transfection with
SGLT1 siRNA. E and F: quantitative data of the fluorescence intensities of negative control and SGLT1 siRNA-transfected cells (n ⫽ 4, *P ⬍ 0.05). These data
demonstrated that siRNA-mediated reduction in NHE3 in IEC-18 cells enhances SGLT1 expression.
C504
REGULATION OF SODIUM ABSORPTIVE PATHWAYS
ACKNOWLEDGMENTS
The authors acknowledge Palanikumar Manoharan, Jamil Talukder, and
Subha Arthur for involvement in a few aspects of this project as part of
postdoctoral education and training in the lab, albeit no data generated by them
are included in this article.
GRANTS
This work was supported by National Institute of Diabetes and Digestive
and Kidney Diseases Grants DK45062 and DK58034 (to U. Sundaram).
DISCLOSURES
No conflicts of interest, financial or otherwise, are declared by the author(s).
AJP-Cell Physiol • VOL
REFERENCES
1. Anderson CM, Mendoza ME, Kennedy DJ, Raldua D, Thwaites DT.
Inhibition of intestinal dipeptide transport by the neuropeptide VIP is an
anti-absorptive effect via the VPAC1 receptor in a human enterocyte-like
cell line (Caco-2). Br J Pharmacol 138: 564 –573, 2003.
2. Anderson CM, Thwaites DT. Regulation of intestinal hPepT1
(SLC15A1) activity by phosphodiesterase inhibitors is via inhibition of
NHE3 (SLC9A3). Biochim Biophys Acta 1768: 1822–1829, 2007.
3. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith
JA, Stuhl K. Current Protocols in Molecular Biology. New York: Wiley,
1995.
4. Coon S, Kim J, Shao G, Sundaram U. Na-glucose and Na-neutral amino
acid cotransport are uniquely regulated by constitutive nitric oxide in
rabbit small intestinal villus cells. Am J Physiol Gastrointest Liver Physiol
289: G1030 –G1035, 2005.
5. Coon S, Shao G, Wisel S, Vulaupalli R, Sundaram U. Mechanism of
regulation of rabbit intestinal villus cell brush border membrane Na/H
exchange by nitric oxide. Am J Physiol Gastrointest Liver Physiol 292:
G475–G481, 2007.
6. Di Iorio E, Barbaro V, Ferrari S, Ortolani C, De Luca M, Pellegrini
G. Q-FIHC: quantification of fluorescence immunohistochemistry to analyse p63 isoforms and cell cycle phases in human limbal stem cells.
Microsc Res Tech 69: 983–991, 2006.
7. Furukawa O, Luke CB, Guth PH, Engel E, Hirokawa M, Kaunitz JD.
NHE3 inhibition activates duodenal bicarbonate secretion in the rat. Am J
Physiol Gastrointest Liver Physiol 286: G102–G109, 2004.
8. Gawenis LR, Franklin CL, Simpson JE, Palmer BA, Walker NM,
Wiggins TM, Clark LL. cAMP inhibition of murine intestinal Na⫹/H⫹
exchange requires CFTR-mediated cell shrinkage of villus epithelium.
Gastroenterology 125: 1148 –1163, 2003.
9. Gawenis LR, Stien X, Shull GE, Schultheis PJ, Woo AL, Walker NM,
Clarke LL. Intestinal NaCl transport in NHE2 and NHE3 knockout mice.
Am J Physiol Gastrointest Liver Physiol 282: G776 –G784, 2002.
10. Greeley T, Shumaker H, Wang Z, Schweinfest CW, Soleimani M.
Downregulated in adenoma and putative anion transporter are regulated by
CFTR in cultured pancreatic duct cells. Am J Physiol Gastrointest Liver
Physiol 281: G1301–G1308, 2001.
11. Kennedy DJ, Leibach FH, Ganapathy V, Thwaites DT. Optimal absorptive transport of the dipeptide glycylsarcosine is dependent on functional Na⫹/H⫹ exchange activity. Pflügers Arch 445: 139 –146, 2002.
12. Kennedy DJ, Raldua D, Thwaites DT. Dual modes of 5-(N-ethyl-Nisopropyl)amiloride modulation of apical dipeptide uptake in the human
small intestinal epithelial cell line Caco-2. Cell Mol Life Sci 62: 1621–
1631, 2005.
13. Kiela PR, Ghishan FK. Na⫹-H⫹ exchange in the mammalian digestive
tract. In: Physiology of the Gastrointestinal Tract (4th ed.). New York:
Elseiver, 2006, p. 1847–1880.
14. Kiela PR, Xu H, Ghishan FK. Apical Na⫹/H⫹ exchangers in the
mammalian gastrointestinal tract. J Physiol Pharmacol 57, Suppl 7:
51–79, 2006.
15. Ko SB, Shcheynikov N, Choi JY, Luo X, Ishibashi K, Thomas PJ, Kim
JY, Kim KH, Lee MG, Naruse S, Muallem S. A molecular mechanism
for aberrant CFTR-dependent HCO(3)(-) transport in cystic fibrosis.
EMBO J 21: 5662–5672, 2002.
16. Ko SB, Zeng W, Dorwart MR, Luo X, Kim KH, Millen L, Goto H,
Naruse S, Soyombo A, Thomas PJ, Muallem S. Gating of CFTR by the
STAS domain of SLC26 transporters. Nat Cell Biol 6: 343–350, 2004.
17. Lamprecht G, Heil A, Baisch S, Lin-Wu E, Yun CC, Kalbacher H,
Gregor M, Seidler U. The down regulated in adenoma (dra) gene product
binds to the second PDZ domain of the NHE3 kinase A regulatory protein
⫹
⫹
(E3KARP), potentially linking intestinal Cl⫺/HCO⫺
3 exchange to Na /H
exchange. Biochemistry 41: 12336 –12342, 2002.
18. Melvin JE, Park K, Richardson L, Schultheis PJ, Shull GE. Mouse
down-regulated in adenoma (DRA) is an intestinal Cl(⫺)/HCO(3)(⫺)
exchanger and is up-regulated in colon of mice lacking the NHE3
Na(⫹)/H(⫹) exchanger. J Biol Chem 274: 22855–22861, 1999.
19. Orlov SN, Mongin AA. Salt-sensing mechanisms in blood pressure
regulation and hypertention. Am J Physiol Heart Circ Physiol 293:
H2039 –H2053, 2007.
20. Schweinfest CW, Spyropoulos DD, Henderson KW, Kim JH, Chapman JM, Barone S, Worrell RT, Wang Z, Soleimani M. slc26a3
(dra)-deficient mice display chloride-losing diarrhea, enhanced colonic
300 • MARCH 2011 •
www.ajpcell.org
Downloaded from http://ajpcell.physiology.org/ by 10.220.33.2 on June 18, 2017
mechanism of stimulation was secondary to an increase in
SGLT1 BBM expression as reflected by an increase in the
message for SGLT1 (Fig. 2B). Finally, Western blot and
immunocytochemistry studies indicated that the mechanism of
stimulation of SGLT1 when NHE3 expression is inhibited in
intestinal epithelial cells is due to an increase in the expression
of SGLT1 on the BBM (Fig. 2, C and D, and Fig. 3). This
clearly indicates that inhibition of NHE3 expression regulates
SGLT1 in intestinal epithelial cells.
In addition, inhibition of SGLT1 expression with SGLT1
siRNA also stimulated NHE3 activity. Kinetic studies established that, in SGLT1 siRNA-transfected cells, the mechanism
of stimulation of Na/H exchange was the result of an increase
in the NHE3 expression on the BBM (Fig. 4B). RTQ-PCR
studies showed that the stimulation of NHE3 is due to an
increase in message (Figs. 5B). Western blot studies showed
that the mechanism of stimulation of the increase in NHE3
expression when SGLT1 expression is inhibited in intestinal
epithelial cells is due to an increase in the number of exchangers in the cells (Fig. 5, C and D). Finally, results of immunocytochemistry experiments showed that when SGLT1 BBM
expression is inhibited, NHE3 expression on the BBM of
IEC-18 cells is stimulated (Fig. 6). These studies together show
that sodium absorption is regulated and that when SGLT1 expression is inhibited, NHE3 is stimulated. Therefore all of this data
taken together shows that when the expression of either of these
two transporters is inhibited the expression of the other increases
on the BBM of intestinal villus cells, presumably to maintain the
proper absorption of sodium. This likely occurs by transcriptional regulation of these transporters by transcription factors
and second messenger pathways.
In conclusion, this unique regulation of the two primary
sodium absorptive pathways could provide valuable insights
into how electrolyte and water balance is regulated. It is
important to note that sodium dysregulation leads to changes in
water balance as well, which leads to diseases such as hypertension and diarrhea. Alterations in glucose absorption may
also contribute to diseases such as diabetes and obesity. Therefore a better understanding of how these two major sodium
pathways regulate sodium and glucose absorption may lead to
better efficacious treatments for these diseases. For example,
oral rehydration therapy itself is a treatment that supplies
sodium and glucose in order for SGLT1 to compensate in
diarrheal diseases such as cholera where NHE3 is significantly
inhibited (32). Thus this unique regulation of the two primary
sodium absorptive pathways could form the basis for developing strategies to promote electrolyte and nutrient absorption
when necessary and inhibit the same in diseases where it would
be advantageous.
REGULATION OF SODIUM ABSORPTIVE PATHWAYS
21.
22.
23.
24.
25.
27.
AJP-Cell Physiol • VOL
28. Thwaites DT, Kennedy DJ, Raldua D, Anderson CM, Mendoza ME,
Bladen CL, Simmons NL. H/dipeptide absorption across the human
intestinal epithelium is controlled indirectly via a functional Na/H exchanger. Gastroenterology 122: 1322–1333, 2002.
29. Turner JR, Black ED. NHE3-dependent cytoplasmic alkalinization is
triggered by Na⫹-glucose cotransport in intestinal epithelia. Am J Physiol
Cell Physiol 281: C1533–C1541, 2001.
30. Wheat VJ, Shumaker H, Burnham C, Shull GE, Yankaskas JR,
Soleimani M. CFTR induces the expression of DRA along with Cl⫺/
HCO⫺
3 exchange activity in tracheal epithelial cells. Am J Physiol Cell
Physiol 279: C62–C71, 2000.
31. Wright EM, Hirayama B, Loo D, Turk E, Hager K. Intestinal sugar
transport. In: Physiology of the Gastrointestinal Tract. New York: Raven,
1994, p. 1751–1772.
32. Wright EM, Hirayama BA, Loo DF. Active sugar transport in health and
disease. J Intern Med 261: 32–43, 2007.
33. Wright EM, Loo D, Hirayama B, Turk E. Sugar absorption. In:
Physiology of the Gastrointestinal Tract (4th ed.). New York: Elsevier,
2006, p. 1653–1666.
34. Wright EM, Loo DD, Hirayama BA, Turk E. Surprising versatility of
Na⫹-glucose cotransporters: SLC5. Physiology (Bethesda) 19: 370 –376,
2004.
35. Yun CH, Tse CM, Nath SK, Levine SA, Brant SR, Donowitz M.
Mammalian Na⫹/H⫹ exchanger gene family: structure and function studies. Am J Physiol Gastrointest Liver Physiol 269: G1–G11, 1995.
300 • MARCH 2011 •
www.ajpcell.org
Downloaded from http://ajpcell.physiology.org/ by 10.220.33.2 on June 18, 2017
26.
proliferation, and distinct up-regulation of ion transporters in the colon. J
Biol Chem 281: 37962–37971, 2006.
Seidler U, Lenzen H, Cinar A, Tessema T, Bleich A, Riederer B.
Molecular mechanisms of disturbed electrolyte transport in intestinal
inflammation. Ann NY Acad Sci 1072: 262–275, 2006.
Sundaram U, Knickelbein RG, Dobbins JW. Mechanism of intestinal
secretion. Effect of serotonin on rabbit ileal crypt and villus cells. J Clin
Invest 87: 743–746, 1991.
Sundaram U, Knickelbein RG, Dobbins JW. pH regulation in ileum:
Na(⫹)-H⫹ and Cl(⫺)-HCO⫺
3 exchange in isolated crypt and villus cells.
Am J Physiol Gastrointest Liver Physiol 260: G440 –G449, 1991.
Sundaram U, Wisel S, Rajendren VM, West AB. Mechanism of
inhibition of Na⫹-glucose cotransport in the chronically inflamed rabbit
ileum. Am J Physiol Gastrointest Liver Physiol 273: G913–G919, 1997.
Talukder JR, Kekuda R, Saha P, Sundaram U. Mechanism of leukotriene D4 inhibition of Na-alanine cotransport in intestinal epithelial cells.
Am J Physiol Gastrointest Liver Physiol 295: G1–G6, 2008.
Thiagarajah JR, Verkman AS. Water transport in the gastrointestinal
tract. In: Physiology of the Gastrointestinal Tract (4th ed.). New York:
Elsevier, 2006, p. 877–894.
Thwaites DT, Ford D, Glanville M, Simmons NL. H⫹/solute induced
intracellular acidification leads to selective activation of apical Na⫹/H⫹
exchange in human intestinal epithelial cells. J Clin Invest 104: 629 –635,
1999.
C505