Analele Ştiinţifice ale Universităţii „Alexandru Ioan Cuza”, Secţiunea Genetică şi Biologie Moleculară, TOM XIV, 2013
DISTRIBUTION OF CCR2-64I GENE AMONG THE TRIBES AND
CASTE POPULATION OF VIDARBHA, INDIA
CHAVHAN ARVIND1,2, PATIL KISHOR2, JADHAO RAJUSING1,
ZADE SURESH3, PAWAR SANTOSH4*
Keywords: CCR2 gene, Polymorphism, Tribes, Vidarbha, India.
Abstract: Aim: This study was aimed to evaluate the distribution of CCR2-64I gene among the tribal and caste
population of Vidarbha region.
Materials and Methods: Polymerase chain reaction (PCR-RFLP) using specific primers followed by amplicon digestion
by Bse BI restriction enzyme was used for CCR2-64I gene polymorphism analysis. Total of 108 samples from 6 tribes
and a caste were analysed.
Results: The genotyping for the CCR2-64I mutation among the selected tribe and a caste reveal that all of the tribes and a
caste was found to be heterozygous for the CCR2-64I mutation. Among the tribes Gonds showed highest genotype
frequency (29.28%) and (11.76%) for heterozygous (CCR2/64I) and Homozygous (64I/64I) respectively, having an
allelic frequency (0.233). A pooled allelic frequencies of the wild-type allele CCR2 and CCR2 64I the variant were found
to be 0.854 and 0.146, respectively. No significant deviations from the HWE were observed for tribes and a caste
population for the CCR2- 64I mutant χ2=2.76. The study reports the presence of mutant CCR2- 64I gene in tribes and
caste population from Vidarbha region.
INTRODUCTION
HIV-1 infection has spread to all population groups in India and has reached epidemic proportions (Misra et al., 1998).
The rate of progression of HIV-1 disease exhibits a remarkable variation among different individuals. Many host genetic
factors are now known to affect disease progression rates, especially polymorphisms in genes encoding chemokine
receptors (Berger, 1999; O'Brien and Goedert, 1998; Moore, 1997; Fuici, 1996).
The chemokine receptor CCR-2 is identified as a minor HIV1 co-receptor, (Carrington et al., 1997; de Roda et al., 1997).
The mutation within the CCR-2 gene is a replacement of valine to isoleucine at position 64 in the first transmembrane
domain of the CCR-2 receptor (Smith et al., 1997), which is present at an allelic frequency of 10-25% in different
populations (de Roda et al., 1997). The presence of this mutation in either heterozygote or homozygote has no effect on
HIV-1 transmission but is associated with delayed progression to AIDS and death (Kostrikis et al., 1998; Smith et al.,
1997). In contrast with CCR5-Δ-32 mutation, it provides protection against HIV disease progression in races other than
the whites. (Smith et al., 1997; Kostrikis et al., 1998; Mazzucchelli et al., 2001).
The distribution of CCR2-64I varies among different ethnic groups. The frequency of the CCR2-64I allele varies from
10.0% to 25.0% in both African-Americans and Caucasians, and in all other ethnic groups studied. The protective allele
A occurs at a population frequency of 15.0%-17.0% in Chinese, ~12.0% in the North Indians (Kaur et al., 2007), and
3.0%-15.0% in the South Indian populations (Ramana et al., 2001).
India is known for the enormous cultural and genetic diversity of its people (Majumder, 1998). Considering genetic
relationships among casts groups are varying across the geographical region of India (Majumder, 1998; Baig et al., 2004),
we put forth this study among the tribal group of Vidarbha region.
MATERIALS AND METHODS
Population:
The Kolam (Tribes): Besides inhabiting the adjoining state, a substantial number of these people inhabit in few district of
Vidarbha. They speak the Gondi dialect which belongs to the Dravidian linguistic group (Haimendorf, 1982). We
sampled 15 samples from this group Village of Yavatmal district.
The Bhil (Tribes): Bhils are listed as Adivasi residents of the states of Gujarat, Madhya Pradesh, Chhattisgarh,
Maharashtra and Rajasthan in western and central India as well as in Tripura in far-eastern India on the border with
Bangladesh. Bhils are divided into a number of endogamous territorial divisions, which in turn have a number of clans
and lineages. Most Bhils now speak the language of the region they reside in, such as Marathi and Gujarati. We sampled
15 samples from this group Village of Yavatmal district.
1
Chavhan Arvind et al – Distribution of CCR2-64I gene among the tribes and caste population of Vidarbha,
India
The Korkus (Tribes): The Korkus are typical tribal population from Amravati district and found only in the Satpuda
mountain ranges spanning Maharashtra and Madhya Pradesh. They are mainly concentrated in Melghat a scheduled area
of Korku comprising 89 % of the tribal population. The Korkus speak Korku dialect belonging to Austro-Asiatic
linguistic group. The Austro-Asiatic speakers are considered as the first settler of Indian subcontinent (Russel and
Hiralal, 1975). We sampled 15 samples from this group.
The Paradhi (Tribes): Phase Paradhi or Phasse Paradhi is a tribe in India. The tribe often faces harassment by Indian
law enforcement agencies. The tribe is found mostly in Maharashtra and parts of Madhya Pradesh. The Phasse are a sub
tribe of the Paradhi caste which includes sub-castes like Gav Paradhi Berad-Paradhi, Gay-Paradhi, Chita Paradhi.
Paradhi is the term for "hunter". There are only three surnames among them, Chauhan, Pawar and Solanke. We sampled
15 samples from this group from Akola district.
The Andh (Tribes): A low cultivating caste of Berar, who numbered 52,000 persons in 1911, and belongs to the Yeotmal,
Akola and Buldana Districts. The Andhs appear to be a non-Aryan tribe of the Andhra or Tamil country, from which they
derive their name. There were 8228 Andh in Andhra Pradesh in 1991. According to Singh et al. in their 2004 book People
of India there are over 74,000 Andhs in Maharashtra. We sampled 16 samples from this group.
The Gonds (Tribes): This tribe fall under primitive tribes category and spread much over the central India. Gond
generally speaks „Gondi‟ dialect which belongs to Dravidian linguistic family, after Indo-European, in India
(Haimendorf, 1982). We sample 17 blood samples from this tribe from Village Gadchiroli district.
Brahmin Cast: Brahmin is a class of priests and preachers of ‘Dharma’ and considered as the torch bearer of Hinduism.
Majority of Brahmin in Maharashtra speak Marathi, one of the major languages of Indo-Aryan linguistic group (Kosambi,
1964). The population of Brahmins in Amravati district is 21,500 or 3 percent of the population. We collected 15 samples
of Brahmins living in Amravati district.
Blood sample collection and DNA extraction: We have collected 108 blood samples on Whatman FTA mini cards (GE
Health Care, UK, Ltd) from 6 tribe’s populations and a cast population from District of Vidarbha Region. Every card was
labeled with appropriate code as per tribes/cast and district with informed consent obtained from each volunteer.
Approximately (200 μl (2-5 drop) of blood by veni-puncture were directly spotted on the FTA mini card within printed
circle area and dried at room temperature. Genomic DNA was isolated from each dried blood sample by following
protocol (Sambrook et al., 1989).
Amplification and restriction digestion of DNA: Polymerase chain reaction was performed following previously
prescribed protocol (Magierowska, et al., 1999). Briefly, 100 ng of genomic DNA was denatured at 94 °C for 10 minutes,
following which it was subjected to 30 cycles of denaturation, annealing and extension. The last cycle was followed by
incubation at 72 °C for 10 minutes. The reaction mixture of 50 μL contained, 50 mmol KCl, 10 mmol Tris-HCl, pH 8.3,
800 μmol dNTPs, 100 μg/mL gelatin, 10 pmoles of each of the CCR2-specific primer Forward: CCR21: (5’GGATTGAACAAGGACGCATTTCCCC -3’) and Reverse: CCR23: (5’- TTGCACATTGCATTCCCAAAGACCC -3’)
and 1.5 units of Taq polymerase enzyme (Xcelris Genomics, Ahmedabad, India). The digetion condition was performed
in a 20 µl reaction volume using 6 µl of PCR Product, 1.5 µl of PCR Buffer, 0.6 µl of 10U/ µl of Bse Bi and 6.9 µl of
MilliQ water and incubate at 600C for 2 hrs. The digested product were analysed on a 2% agarose gel and bands were
visualized. A 380 bp product of CCR2 gene was amplified by PCR and RFLP analysis using BseGI restriction enzyme
produced two bands at 215 and 165 bp for homozygous mutants, only when an ATC triplet coding for isoleucine was
present. For heterozygous mutants, three bands at 380, 215, and 165 bp were present. The wild-type showed a single band
at 380 bp.
2
Analele Ştiinţifice ale Universităţii „Alexandru Ioan Cuza”, Secţiunea Genetică şi Biologie Moleculară, TOM XIV, 2013
Fig. 1: A 380 bp product of CCR2 gene was amplified by PCR and RFLP with Bse GI enzyme produced two bands at
215 and 165 bp for homozygous mutants (lane 6). For heterozygous mutants, three bands at 380, 215, and 165 bp were
present, lane 3 and 5. The wild-type showed a single band at 380 bp lane 1, 2, 4, and 7, Lane 8 represent 100 bp
molecular marker.
Table 1: Distribution of CCR-2 64I allele and genotype frequencies of the selected Tribes of Vidarbha region.
Allelic Frequency
Genotype of CCR2-64I
No. of
P-value
(λ)
χ2
Population
Sample
(1 df)
2
2
wt/wt
wt/mt
mt/mt
P
q
Kolam
15
12 (80)
2 (13.33)
1 (06.67)
0.894
0.106
2.68
0.101
Bhil
15
11(73.33)
3 (20)
1 (06.67)
0.833
0.167
1.18
0.278
Korku
15
11(73.33)
4 (26.67)
0
0.867
0.133
0.35
0.551
Paradhi
15
13 (86.67)
2 (13.33)
0
0.931
0.069
0.08
0.782
Andh
15
12 (80)
3 (20)
0
0.894
0.106
0.19
0.667
Gond
17
10 (58.82)
5 (29.28)
2 (11.76)
0.764
0.233
1.02
0.313
Brahmin
15
9 (53.33)
5(33.34)
1 (06.67)
0.733
0.277
0.07
0.791
Pooled
107
78 (72.9)
24 (22.43)
5 (04.67)
0.854
0.146
2.76
0.096
Note- wt/wt- represent wild type allele; wt/mt- heterozygous mutant; mt/mt-homozygous mutant
RESULTS AND DISCUSSIONS
The genotyping for the CCR2-64I mutation among the selected tribe and a caste reveal that all of
the tribes and a caste was found to be heterozygous for the CCR2-64I mutation, while the Kolam,
Bhil and Gond tribes and a caste Brahmin sample shows the rare homozygous for the CCR2-64I
mutation. A pooled genotype frequency for wild gene (wt/wt), Heterozygous (wt/mt) and
3
Chavhan Arvind et al – Distribution of CCR2-64I gene among the tribes and caste population of Vidarbha,
India
homozygous mutant (mt/mt) are 78.9%, 24.43%, and 4.67% respectively. The Allelic frequencies
of the wild-type allele CCR2 and CCR2 64I the variant were found to be 0.854 and 0.146,
respectively. No significant deviations from the HWE were observed for tribes and a caste
population for the CCR2- 64I I mutant (χ2=2.76; p=0.09) (p=0.05, Chi-squared goodness of fit).
The values obtained are consistent with the Hardy-Weinberg equilibrium. The heterozygous
CCR2-64I genotypes were present in all tribes sample, and the homozygous CCR2-64I genotype
was found in Kolam, Bhil, Gond tribes as well as in a caste Brahmin. Among the tribes Gonds
showed highest genotype frequency (29.28%) and (11.76%) for heterozygous (CCR2/64I) and
Homozygous (64I/64I) respectively, having an allelic frequency (0.233), followed by Korkus
(26.67%) having allele frequency 0.144 for heterozygous CCR2 64I gene. The lowest genotype
frequency for heterozygous were shown in the Kolam and Paradhi sample (13.33%) each, while
the lowest allelic frequency was found in Paradhi (0.064) as the Kolam population sample
having one homozygous mutant genotype for the 64I/ 64I, having an allelic frequency (0.106).
The distribution of genotype was in agreement with HWE expectation (χ2 =2.68, p=0.05). The
caste Brahmin showed genotype frequency (33.34%) and allelic frequency (0.277) for the
heterozygous 64I, which is quite higher than the Gond tribes. The Variation in the 64I allelic
frequency is moderate in Gonds tribe sample (0.26) having Chi-squared goodness of fit χ2= 1.02,
p= 0.313) as compare to all the study tribe and a caste Brahmin (0.23) having Chi-squared
goodness of fit χ2= 0.07 p= 0.791), the Paradhi sample shows less variation in 64I allelic
frequency among all the tribe (0.07) having Chi-squared goodness of fit χ2= 0.08, p= 0.782).
Overall sample Significant deviations from the HWE were observed (p=0.05, Chi-squared
goodness of fit χ2= 2.76 p= 0.09). The frequency of the CCR2 64I allele in the six tribes and a
caste Brahmin population along with the exact test for Hardy-Weinberg Equilibrium (HWE) and
contingent Chi-square test values.
In the present investigation the genotype frequency of the CCR2-64I allele in studied six tribal
population from district of Vidarbha region is (13.33- 29.28%) quit higher as compared to
southern Indian and Northern Indian (<10%). This could be explained by some evolutionary
forces, such as the founder effect, as well as by a genetic drift, and the most important factor, the
interethnic admixture, which could change gene frequencies. The allelic frequencies found in the
studied tribal populations are similar to those previously reported in populations of Asian origin
(Smith et al. 1997; Su et al. 1999; Voevodin et al. 1999; Iyer et al. 2001; Hong et al. 2001;
Ramana et al. 2001). This observation is in accordance with the prevailing theory regarding the
Asian origin of Tribes (Majumder 1998), as well as with the theory that CCR2-64I is an ancient
mutation, since it is both common in Asians and present in other ethnic groups. Chemokine
receptor on CCR2-64I polymorphism, a G to A transition at position 190 which changes Valine
to Isoleucine at position 64, causes a conservative amino acid change in the first domain.
Recently, Vieira et al., (2011) observed the CCR2-64I was associated with a reduction in the risk
for developing AIDS.
REFERENCES
Baig M.M., Khan A.A. and Kulkarni K.M. 2004. Mitochondrial DNA diversity in tribal and caste groups of
Maharashtra (India) and its implication on their genetic origins. Annals of Human Genetics, 68, 453-460. Doi:
10.1046/j1529-8817.2004.00108x.
Berger E.A., Murphy P.M., Farber J.M. 1999. Chemokine receptors as HIV-1 coreceptors: roles in viral entry, tropism,
and disease. Annual Review of Immunology, 17:657-700.
Carrington M., Kissner T., Gerrard B., Ivanov S., O’brien S.J., Dean M. 1997. Novel alleles of the chemokinereceptor gene CCR5. American Journal of Human Genetics, 61:1261-7.
4
Analele Ştiinţifice ale Universităţii „Alexandru Ioan Cuza”, Secţiunea Genetică şi Biologie Moleculară, TOM XIV, 2013
de Roda Husman A.M., Koot M., Cornelissen M., Keet I.P., Brouwer M., Broersen S.M., Bakker M, Roos M.T.,
Prins M., de Wolf F., Coutinho R.A., Miedema F., Goudsmit J., Schuitemaker H. 1997. Association between CCR5
genotype and the clinical course of HIV-1 infection. Annals of Internal Medicine, 127:882-890.
Fauci A.S. 1996. Resistance to HIV-1 infection: it’s in the genes. Nature Medicine, 2: 966–967.
Haimendorf von F.C. 1982. Tribes of India: The Struggle for Survival. Berkeley:University of California Press, c1982
http://ark.cdlib.org/ark:/13030/ft8r29p2r8/
Hong W., Wang F., Jin L., Xing L., Liu M., Du Q., Lei Z. and Li J. 2001. Genotyping of HIV resistant alleles in
indigenous Tibetan ethnic group of China: low frequency of CCR5Δ32 and high frequency of CCR2b-64I alleles.
Zhonghua Yi Xue Yi Chuan Xue Za Zhi, 18:268-271.
Iyer R.K., Kim P.S., Bando J.M., Lu K.V., Gregg J.P. and Grody W.W. 2001. A multiethnic study of Delta32CCR5
and CCR2b-V64I allele distribution in four Los Angeles populations. Diagnostic Molecular Pathology, 10(2):105-110.
Kaur G., Singh P., Kumar N., Rapthap C.C., Sharma G., Vajpayee M., Wig N., Sharma S.K., Mehra N.K. 2007.
Distribution of CCR2 polymorphism in HIV-1 infected and healthy subjects in North India. International Journal of
Immunogenetics, 34 (3): 153-156. ISSN 1744-3121.
Kosambi D.D. 1964. The culture and civilization of ancient India in historical outline. Vikas, New Delhi.
Kostrikis L.G., Huang Y., Moore J.P., Wolinsky S.M., Zhang L., Guo Y., Deutsch L., Phair J., Neumann A.U., Ho
D.D. 1998. A chemokine receptor CCR2 allele delays HIV-1 disease progression and is associated with a CCR5 promoter
mutation. Nature Medicine, 4: 350-353.
Magierowska M., Theodorou L., Debre P., Sanson F., Autran B., Riviere Y., Charron D. and Castoglolia D. 1999.
Combined Genotype of CCR5, CCR2 SDF1 and HLA Genes can predict the Long-term Non-progressor Status in Human
Immunodeficiency Virus-1 Infected Individuals. Blood, 93:936-938.
Majumder P.P. 1998. People of India: Biological diversity and affinities. Evolutionary Anthropology, 6 (3):100-110.
Mazzucchelli R., Corvasce S., Violin M., Riva C., Bianchi R., Deho L., et al. 2001. Role of CCR5, CCR2 and SDF-1
gene polymorphisms in a population of HIV-1 infected individuals. Journal of Biological Regulators & Homeostatic
Agents, 15:265-271.
Misra S. N., Sengupta D. and Sathpathy S. K. 1998. AIDS in India: recent trends in opportunistic infections. Southeast
Asian J. Trop. Med. Public Health 29, 373–376.
Moore J.P. 1997. Coreceptors: implications for HIV pathogenesis and therapy. Science, 276:51-52.
O'Brien T.R. and Goedert J.J. 1998. Chemokine receptors and genetic variability: another leap in HIV research. The
Journal of the American Medical Association, 279(4):317-318.
Ramana G V, Vasanthi A, Khaja M, Su B, Govindaiah V, Jin L, Singh L and Chakraborty R, 2001. Distribution of
HIV-1 resistance-conferring polymorphic alleles SDF-1-3¢A, CCR2-64I and CCR5-D32 in diverse populations of Andhra
Pradesh, South India. Journal of Genetics. 80, 137–140.
Russell, R.V. and Hiralal 1975. “Tribes and Castes of the Central Provinces of India”, Vol.III.
Sambrook, J., Fritsch, E. F. and Maniatis, T. 1989. Molecular Cloning: A Laboratory Manual, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, NY.
Singh S. and Bhanu B. 2004. Anthropological Survey of India. Maharashtra. Popular Prakashan. pp. 65. ISBN 978-817991-100-6.
Smith, M. W., M. Carrington, C. Winkler, D. Lomb, M. Dean, G. Huttley and S. J. O’Brien. 1997. CCR2
chemokine receptor and AIDS progression. Nature Medicine. 3:1052–1053.
Su B., Jin L., Hu F., Xiao J., Luo J., Lu D., Zhang W., Chu J., Du R., Geng Z., Qiu X., Tan J., O’Brien S. J. and
Chakraborty R. 1999. Distribution of two HIV-1 resistant polymorphisms (SDF1-3¢A and CCR2-64I) in East Asia and
world populations and its implication in AIDS epidemiology. American Journal of Human Genetics. 65, 1047–1053.
Vieira V.C., Barral M.F.M., Mendoza-Sassi R.A., Silveira J.M., Soares M.A. and Martínez A.M.B. 2011. The effect
of combined polymorphisms in chemokines and chemokine receptors on the clinical course of HIV-1 infection in a
Brazilian population. Memórias do Instituto Oswaldo Cruz, Rio de Janeiro, 106(4): 408-414.
Voevodin A., Samilchuk E., and Dashti S. 1999. Frequencies of SDF-1 chemokine, CCR-5, and CCR-2 chemokine
receptor gene alleles conferring resistance to human immunodeficiency virus type 1 and AIDS in Kuwaitis. Journal of
Medical Virology. 58:54–58.
*) [email protected]
1) Department of Zoology, Shri Shivaji Science College, Morshi Road Amravati- 444603
2) Department of Zoology, Institute of Science, R.T. Road, Civil Line, Nagpur-440001
3) Department of Zoology, RSTM, Nagpur University, Nagpur- 440033
4) Department of Zoology, Govt. Vidarbha Institute of Science and Humanities, Amravati-444603
5
Analele Ştiinţifice ale Universităţii „Alexandru Ioan Cuza”, Secţiunea Genetică şi Biologie Moleculară, TOM XIV, 2013
6