Differential regulation of centrin genes during
ciliogenesis in human tracheal epithelial cells
MICHEL LEDIZET, JAMES C. BECK, AND WALTER E. FINKBEINER
Cardiovascular Research Institute and Department of Pathology,
University of California, San Francisco, California 94143-0566
cellular differentiation; air-liquid interface; respiratory epithelium
CENTRINS ARE SMALL calcium-binding proteins that belong to the superfamily of calmodulin and yeast CDC31.
Originally identified in Tetraselmis (31), centrins have
since been found in a wide variety of protozoa, plants,
and animals (reviewed in Ref. 20). Immunoreactive
centrin has been detected in many different cellular
structures, suggesting that centrins may have several
distinct functions. Many centrin-containing structures
are microtubule-organizing centers or are attached to
such centers: centrioles or basal bodies, pericentriolar
material, mitotic spindle poles (with or without centrioles), striated contractile fibers extending from one
basal body toward another (‘‘distal fibers’’) or toward
the nucleus (‘‘striated rootlets’’; also known as ‘‘flagellar
rootlets’’) (reviewed in Ref. 20). In addition, centrin is
also encountered in the transition zone, linking a basal
body to the axoneme (32) as a subunit of Chlamydomonas inner dynein arms (17, 29), and in soluble form (28).
In view of the variety of structures containing centrin, it is not surprising that cells may harbor multiple
centrin isoforms. Paoletti et al. (28) showed that 2-dimensional gel electrophoresis can resolve 10 species of
immunoreactive centrins in human cells. A critical
issue is to determine whether individual centrin isoforms have a specific location within the cell and, more
importantly, specific functions.
Many centrin-containing structures are found exclusively in ciliated cells. This prompted us to determine
whether ciliogenesis was accompanied by the appearance of specific centrin species. We chose to study
centrin expression during the in vitro differentiation of
human tracheal epithelial (HTE) cells (43). In this
model system of ciliogenesis, tracheal epithelial cells
are isolated from autopsy specimens and grown on a
collagen layer at an air-liquid interface. The cells
rapidly multiply to form a multilayered cell sheet
composed of nondifferentiated cells. Subsequently, 60–
80% of the apical cells become ciliated. Such a system is
well suited to our purpose because most structures
expected to contain centrins are encountered. Therefore, a large number of centrin isoforms may be synthesized. Moreover, the time at which centrin isoforms
appear during the differentiation process may give us
information regarding their function.
Antibodies specific for individual centrin isoforms
are not generally available. For this reason, we studied
centrin gene expression at the mRNA level. Three
human centrin genes have been identified to date:
centrin-1 was isolated from a testis cDNA library (6),
whereas centrin-2 (originally named caltractin) was
found in libraries derived from umbilical vein endothelial mRNA and from T-cell lymphoblastic leukemia
mRNA (19). Centrin-3 was recently identified among
cDNAs derived from a T-lymphoblastic cell line (24).
The centrin-1 and -2 proteins are 84% identical. Centrin-3 is more closely related to yeast CDC31 and is
54% identical to both centrin-1 and centrin-2 (24).
We found that the three centrin genes have very
different expression patterns during the differentiation
of human tracheal epithelial cells. Centrin-1 is never
expressed. Centrin-2 mRNA is always present, and its
concentration increases as ciliated cells appear. Centrin-3 mRNA is found at a constant concentration
throughout the differentiation process. These results
suggest that the three genes encode proteins with
distinct functions. Furthermore, centrin-2 is the isoform most likely to be found in cilia-associated structures.
MATERIALS AND METHODS
Cell Isolation and Culture
The costs of publication of this article were defrayed in part by the
payment of page charges. The article must therefore be hereby
marked ‘‘advertisement’’ in accordance with 18 U.S.C. Section 1734
solely to indicate this fact.
Tracheae were obtained from patients without chronic
airway disease up to 24 h postmortem. HTE cells were
isolated as previously described (7, 43) and suspended in a 1:1
1040-0605/98 $5.00 Copyright r 1998 the American Physiological Society
L1145
Downloaded from http://ajplung.physiology.org/ by 10.220.33.1 on June 18, 2017
LeDizet, Michel, James C. Beck, and Walter E. Finkbeiner. Differential regulation of centrin genes during ciliogenesis in human tracheal epithelial cells. Am. J. Physiol. 275
(Lung Cell. Mol. Physiol. 19): L1145–L1156, 1998.—Centrins
are small calcium-binding proteins found in a variety of cell
types, often in association with microtubule-organizing centers. Here we present results regarding the expression of
centrins during the in vitro differentiation of human tracheal
epithelial cells. When grown at an air-liquid interface, these
cells differentiate into mucus-secreting cells or undergo ciliogenesis. In immunofluorescence and immunoelectron microscopy experiments, an anti-centrin antibody stained exclusively the basal bodies of the ciliated cells. There was no
staining over the axonemes or the striated rootlets. Northern
blots and RT-PCR analysis of the three known human centrin
genes showed that these genes have distinct patterns of
expression during the growth and differentiation of human
tracheal epithelial cells. Centrin-1 is never transcribed. Centrin-2 mRNA is present at all times, and its concentration
increases when ciliogenesis occurs. Centrin-3 mRNA is found
at a constant level throughout the entire process. This
differential regulation suggests that centrins are not interchangeable but instead have unique functions.
L1146
CILIOGENESIS AND CENTRIN EXPRESSION
mixture of Dulbecco’s modified Eagle’s medium and Ham’s
F-12 nutrient mix containing 2% low-protein serum replacement (LPSR-1, Sigma, St. Louis, MO) supplemented with
penicillin (105 U/l), streptomycin (100 mg/l), gentamicin (50
mg/l), and amphotericin B (2.5 mg/l). Cell counts and estimates of viability were made with trypan blue and a hemocytometer. Cells were plated onto 12-mm Transwell inserts
(0.4-µm pore size; Corning Costar, Cambridge, MA) containing Vitrogen 100 collagen (Celtrix Laboratories, Palo Alto,
CA) at a density of 1.67 3 106 live cells/well. The following
day, the cultures were rinsed with phosphate-buffered saline
(PBS). Throughout the culture period, we maintained the
cells in air-liquid interface cultures with medium (1 ml) only
on the basal side of the filters. Immersed cultures were grown
with medium on both the basal and apical sides of the filters
(1 and 0.7 ml, respectively). All cultures were maintained at
37°C in a humidified atmosphere of 95% air-5% CO2.
Light microscopy. Support membranes with the attached
collagen layer and cell sheet were cut out of the culture
inserts and frozen in TissueTek optimum cutting temperature compound (Sakura Finetek). Ten-micrometer sections
were cut on a cryostat (Leica CryoCut 1800), transferred to
charged glass slides, and stained with toluidine blue or
hematoxylin and eosin.
Scanning electron microscopy. Cultures were fixed with
2.5% glutaraldehyde in 0.1 M sodium cacodylate, pH 7.4, for 1
h at room temperature, followed by two 10-min washes with
0.1 M sodium cacodylate, pH 7.4. Samples were then postfixed at room temperature with 1% osmium tetroxide in 0.1 M
sodium cacodylate, pH 7.4, followed by two 10-min washes
with 0.1 M sodium cacodylate. The samples were then
dehydrated with a graded series of ethanol washes and
infiltrated with Peldri II (Ted Pella, Redding, CA). The last
change of Peldri II was cooled to below 23°C, and the samples
were maintained under vacuum until all Peldri II evaporated.
Samples were subsequently sputter coated with an Anatach
Hummer X with a gold-palladium alloy and then placed onto
scanning electron microscope specimen mounts. The specimens were viewed with a JEOL JSM 840 scanning electron
microscope.
Immunocytochemistry
To identify and localize centrin, we used the anti-centrin
monoclonal antibody 20H5 (35) generously provided by Dr.
Jeffrey L. Salisbury (Department of Biochemistry and Molecular Biology, Mayo Clinic and Foundation, Rochester, MN).
This antibody recognizes the proteins encoded by all three
human centrin genes (24). The antibody was used at a 1:200
dilution.
Light-microscopic immunocytochemistry. Cultured cells
were dissociated in a solution of saline-trypsin-versene (0.05%
trypsin and 0.02% EDTA in 0.9% NaCl, wt /vol). Isolated cells
were spun onto glass slides with a cytocentrifuge. Indirect
immunofluorescence was performed as previously described
(8). Briefly, the antibody was diluted in PBS containing 2%
normal goat serum-0.6% Triton X-100 and applied to the cells
for 2 h at room temperature. Next, the slides were rinsed
three times for 5 min with PBS containing 1% normal goat
serum-0.3% Triton X-100. The slides were incubated (30 min
at room temperature) with goat anti-mouse IgG-fluorescein
isothiocyanate diluted 1:40 in PBS. After a final rinse with
PBS, they were covered with 1,4-diazabicyclo(2.2.2)octane
(DABCO) solution and glass coverslips before examination
with a fluorescence microscope.
Molecular Biology Techniques
Genomic DNA isolation. Genomic DNA was isolated from
fresh human blood with a DNA isolation kit (Boehringer
Mannheim) or with standard procedures.
RNA isolation. Total cellular RNA from the cultured cells
was prepared by homogenizing the entire content of a culture
insert into 2 ml of TRIzol Reagent (Life Technologies). Yields
were 20–50 µg/culture insert. RNA from fresh (uncultured)
cells was prepared by homogenizing strips of native tracheal
epithelium (obtained 16 h or less postmortem) in TRIzol
Reagent.
cDNA synthesis. RNA (2 µg) was reverse transcribed with
Moloney murine leukemia virus reverse transcriptase (Promega, Madison, WI) as recommended by the manufacturer.
Genomic DNA contaminating the total RNA was hydrolyzed
with RNase-free DNase (0.5 unit of enzyme, 15 min, 37°C;
Promega) in RT buffer before the initial denaturation step.
The final reaction volume was 25 µl.
Downloaded from http://ajplung.physiology.org/ by 10.220.33.1 on June 18, 2017
Morphology
Electron-microscopic immunocytochemistry. HTE cells were
cultured as described in Cell Isolation and Culture on Millicell HA filters (Millipore). The filters were washed two times
with PBS and fixed for 60 min with 3% freshly depolymerized
paraformaldehyde and 0.1% glutaraldehyde in 0.1 M sodium
phosphate buffer, pH 7.2. We cut the filters out of their insert
and processed them in glass vials to avoid subsequent crossreaction between the plastic insert and the LR White resin
(London Resin, Basingstoke, UK) (25). After three 10-min
washes in 0.1 M sodium phosphate buffer (pH 7.2), the cells
were dehydrated with a graded series of ethanol washes up to
100% and then slowly infiltrated with increasing concentrations of LR White resin (hard grade) in 100% ethanol up to
100% resin. Next, filters were cut into smaller pieces and
placed in oven-dried gelatin capsules that were then filled
with fresh resin. Polymerization of the resin was performed
at 50°C for 24–48 h to preserve antigenicity (25). Filters were
cross-sectioned to pale gold or silver thickness (80–100 nm)
and picked up onto formvar-coated or carbon-stabilized 100mesh nickel grids.
Immunocytochemistry was performed as previously described (43). At each step, the grids were floated section side
down on drops of the solutions. Residual free aldehydes
remaining from the fixation were inactivated by incubating
the grids on drops of 0.1 M glycine in PBS for 30 min (12).
Nonspecific immunoreactive binding sites were then blocked
with a solution of PBS containing 1% fish gelatin, 1%
globulin-free bovine serum albumin (BSA), and 0.02% sodium
azide, pH 7.2, for 30 min (3). The grids were subsequently
incubated for 60 min with the anti-centrin monoclonal antibody (diluted in PBS-1% BSA-0.02% sodium azide, pH 7.2).
Grids incubated in SP 2/O myeloma culture supernatant were
included as negative controls. The grids were washed three
times for 10 min each in PBS and two times for 10 min each in
the PBS-1% BSA-0.02% sodium azide (pH 7.2). To prevent
aggregation of the secondary antibody, the sections were
brought to pH 8.2 with a 10-min incubation on drops of
PBS-1% BSA (globulin free)-0.02% sodium azide (pH 8.2) (37).
Then the sections were incubated in 10-nm gold-conjugated
goat anti-mouse IgG (Biocell Gold Conjugates, Ted Pella)
diluted 1:75 with PBS-1% BSA-0.02% sodium azide (pH 8.2)
for 60 min. The grids were then washed six times for 5 min
each in a solution of PBS-0.1% BSA (globulin free)-0.02%
sodium azide (pH 7.2) and three times for 5 min in PBS (pH
7.2) and dip washed with double-distilled water. The grids
were then poststained with saturated aqueous uranyl acetate
before they were viewed in the electron microscope.
CILIOGENESIS AND CENTRIN EXPRESSION
Table 1. PCR primers used in this study
Primers used to amplify 38-ends
of cDNAs
Anch1(dT)
GAGTGTCTCGAGGAGCTCTTTTTTTTTTTTTTT
Anch1
GAGTGTCTCGAGGAGCTC
Primers matching specifically
centrin-1 (GenBank accession no. U03270)
C1-88
GCCAAAAGAGAAAGGTGGCA
C1-770
GAGTGTGAATTCGGTACCGGAGCACATGAGGTTAAACA
C1-a587
CTTTAGCTTCTGAACCGACT
C1-a1088
GAGTGTCTCGAGGAGCTCGAATATCTGTCCTGAGCTCC
Primers matching specifically
centrin-2 (GenBank accession no. X72964)
C2-88
CTCAGCGAAAAAGAATGAGC
C2-586
GAGTGTGAATTCGGTACCTACTGCAAGCACATGTAAC
C2-a604
GTTACATGTGCTTGCAGTAG
Primers matching specifically
centrin-3 (GenBank accession no. Y12473)
C3-1
ATGAGTTTAGCTCTGAGAAGTGA
C3-a503
TAAATGTCACCAGTCATAATAGC
Primers matching specifically
GAPDH (GenBank accession no. M33197)
GAP-811
AAACCTGCCAAATATGATGACATCAAGAAGG
GAP-a1198
GGGGTCTACATGGCAACTGTGAGGAGGGGGAG
GAPDH, glyceraldehyde-3-phosphate dehydrogenase. In each
primer name, the number designates position of 58-end of primer in
the sequence (using the numbering of GenBank entry). a means
primer has the sequence of the noncoding strand. Underlined portion
of a primer sequence is not gene specific but was introduced to
facilitate cloning of PCR products.
citrate is 0.15 M NaCl and 0.015 M sodium citrate, pH 7.0).
Detection of the bound probe was performed by autoradiography or with a Molecular Dynamics phosphorimager.
PCR amplification of centrin sequences. The sequences of
human centrin-1, centrin-2, and centrin-3 cDNAs were retrieved from GenBank (accession nos. U03270, X72964, and
Y12473, respectively). The coding regions span nucleotides
49–564 in centrin-1, 48–563 in centrin-2, and 1–504 in
centrin-3. We chose regions of greatest heterogeneity to
design gene-specific primers. Table 1 contains the sequences
of the primers used and their position in the cDNA sequences.
We performed PCR reactions in a volume of 30 µl with
GeneAmp PCR system 2400 (Perkin-Elmer, Emeryville, CA).
Reaction conditions were as recommended by the supplier of
the Taq DNA polymerase (Boehringer Mannheim, Mannheim, Germany). The template consisted of either 1 µl of
cDNA synthesis reaction or 0.2 µg of human genomic DNA.
After an initial denaturation step of 4 min at 94°C, the
samples were subjected to 35 cycles (or less; see Semiquantitative RT-PCR assay for centrin mRNAs) of amplification (20 s
at 94°C, 30 s at 60°C, and 60 s at 72°C). Forty cycles of
amplification were performed to detect centrin-1 cDNA. When
genomic DNA was amplified, we performed 35 cycles with the
following parameters: 30 s at 94°C, 30 s at 55°C, and 2 min at
72°C. Some of the amplifications were performed with a
Perkin-Elmer DNA thermal cycler 480; for these experiments, the durations of the denaturation and hybridization
steps were 45 and 90 s, respectively.
After amplification, aliquots of the PCR reactions (typically
6 µl) were analyzed by electrophoresis on 13 Tris-borateEDTA agarose gels containing 0.4 µg/ml of ethidium bromide.
The gels were photographed under ultraviolet transillumination.
Semiquantitative RT-PCR assay for centrin mRNAs. To
compare the abundance of centrin-2 and centrin-3 mRNAs in
different samples, we introduced several modifications to our
basic protocol. 1) The amount of specific product in a PCR
reaction typically increases with the number of cycles until a
plateau phase is reached. We found that the plateau phase
was reached after 33 cycles for both centrin-2-specific and
centrin-3-specific reactions. We therefore only performed 30
cycles of amplification so as to remain within the phase of
exponential accumulation of PCR product. 2) We used high
initial concentrations of nucleotides (200 µM each) and
primers (0.5 µM each) to ensure that they did not become
limiting. 3) We lowered the influence of tube-to-tube variation
in the PCR product yield by performing each amplification in
duplicate, using, if possible, cDNAs synthesized in independent RT reactions. This precaution may also correct possible
unequal efficiencies in the RT of individual mRNAs. The data
presented here represent the average of two or more independent PCR amplifications. The individual data points are
usually within 10% (or less) of the average value. 4) Gel
images were recorded and quantitated with an AlphaImager
digital-imaging system (Alpha Innotech, San Leandro, CA).
The volume of PCR analyzed and the exposure times were
chosen to remain within the range of linear response of the
charge-coupled device camera. Control experiments showed
that, under our conditions, the signal recorded by the imaging
system is directly proportional to the amount of DNA being
visualized (data not shown).
RT-PCR amplification of glyceraldehyde-3-phosphate dehydrogenase mRNA. Table 1 shows the sequences of primers
GAP-811 and GAP-a1198 that are based on the human
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA
sequence (GenBank accession no. M33197). The template
consisted of 1 µl of cDNA synthesis reaction. After an initial
Downloaded from http://ajplung.physiology.org/ by 10.220.33.1 on June 18, 2017
Gene-specific DNA probes. The 38-untranslated region of
the centrin-1 gene was amplified from genomic DNA with the
primers C1-770 and C1-a1088 (see Table 1). The PCR product
was purified from an agarose gel with GeneClean (Bio101),
digested with EcoR I and Xho I, and cloned into pBluescript
SK(1) (Stratagene). The nucleotide sequence of the subcloned
fragment was determined to confirm the identity of the probe.
To subclone the 38-untranslated region of the centrin-2
gene, RNA isolated from HTE cells grown at an air-liquid
interface for 21 days was reverse transcribed with Anch1(dT)
as a primer (see Table 1). An aliquot of the cDNAs was then
amplified with the primers Anch1 and C2-586. The PCR
product was subcloned as above.
Northern blot hybridization. At each time point, total RNA
was isolated as described in RNA isolation. Polyadenylated
RNA was selected by oligo(dT) cellulose chromatography with
a rapid mRNA purification kit (Amresco), separated on a
formaldehyde-containing agarose gel, and transferred to a
GeneScreen membrane (NEN Research Products) with standard procedures. Each lane contained the polyadenylated
RNA obtained from five culture inserts (100–150 µg of total
RNA). For one experiment (see Fig. 7A), each lane contained
20 µg of total RNA. To produce radiolabeled probes, the
inserts of the plasmids described in Gene-specific DNA probes
were purified and used in random-primed labeling reactions.
The hybridization was performed for 1 h at 68°C in QuickHyb
solution (Stratagene). The blots were washed to a final
stringency in 0.13 saline-sodium citrate (13 saline-sodium
L1147
L1148
CILIOGENESIS AND CENTRIN EXPRESSION
denaturation step of 4 min at 94°C, the samples were
subjected to 24 cycles of amplification (30 s at 94°C, 30 s at
65°C, and 45 s at 72°C). The plateau phase of amplification
was reached after 28 cycles. Quantitation of the specific PCR
product was performed as described for the centrin transcripts.
RESULTS
Morphological Differentiation of HTE Cells
Fig. 1. Scanning electron micrographs
of cultured human tracheal epithelial
cells. Cells were grown at an air-liquid
interface (A–C) or immersed (D).
A: day 3. No ciliated cells are present.
B: day 12. Scattered ciliated cells are
present. C: day 20. Luminal surface of
cell sheet is composed predominantly of
ciliated cells. D: day 20. No ciliogenesis
occurs if cells are grown immersed. Bar,
10 µm.
Immunolocalization of Centrin
We used the monoclonal antibody 20H5 raised against
Chlamydomonas centrin (35) to determine the location
of centrin in cultured HTE cells. This antibody recognizes the proteins encoded by all three human centrin
genes (24). Immunoperoxidase labeling of cells grown
at an air-liquid interface showed staining limited to the
apical portion of the ciliated luminal cells (data not
shown). No staining was detected in cells grown immersed.
Using immunofluorescence microscopy, we observed
an intense punctate staining directly underneath the
apical membrane of the ciliated cells (Fig. 2A), a
distribution consistent with labeling of the basal bodies. The staining was punctate and in a narrow plane of
Downloaded from http://ajplung.physiology.org/ by 10.220.33.1 on June 18, 2017
Yamaya et al. (43) previously described the basic
culture conditions allowing growth and differentiation
of HTE cells. For this study, we wanted to correlate
levels of centrin gene expression with cellular differentiation and, in particular, with ciliogenesis. We therefore monitored the appearance of cilia as a function of
time in culture and isolated RNA from the cells at
various time points.
In a typical experiment, isolated epithelial cells
obtained from a single trachea were seeded in 50–200
culture inserts containing a layer of collagen. They
were then grown at an air-liquid interface as described
in MATERIALS AND METHODS. After various lengths of
time in culture (4–21 days), RNA was prepared from
two to five culture inserts while cells from other inserts
were fixed and examined microscopically. Because differentiation appears to occur synchronously in all
cultures, the cells from which RNA was isolated can be
expected to be identical to those that were examined
microscopically.
After the cells are plated, they rapidly multiply and
form a thin multilayered pseudoepithelium consisting
of undifferentiated cells. Figure 1A shows the luminal
surface of cells grown for 3 days at an air-liquid
interface. No ciliated cells are present. Over the next
few days, the cell sheet becomes progressively thicker.
Figure 1B shows the luminal surface of a cell sheet
where the first ciliated cells are visible together with
secretory cells. The length of time preceding the onset
of ciliogenesis in the cultured cells varies from trachea
to trachea and is typically 13–15 days. Over the 3–4
days after the appearance of the first cilia, the number
of ciliated cells increases dramatically. After 18–21
days in culture, transmission electron microscopy shows
that the pseudostratified cell sheet is composed of a
range of cell types, with taller columnar cells at the
luminal surface. Transmission electron micrographs of
similar cell sheets have been previously published (43).
The columnar cells at the luminal surface are either
ciliated epithelial cells or secretory goblet cells. Figure
1C shows that ciliated cells account for 60–80% of the
apical surface in fully differentiated cell sheets.
The presence of an air-liquid interface is critical to
the appearance of ciliated cells. Figure 1D shows the
luminal surface of cells grown immersed for 21 days. No
ciliated cells are visible.
CILIOGENESIS AND CENTRIN EXPRESSION
L1149
focus, indicating that axonemes and striated fibers
were not stained.
Immunoelectron microscopy confirmed that staining
is limited to the basal bodies; although the staining was
sparse, gold particles were clearly concentrated over
the basal bodies and in the transition zone between
basal body and axoneme (Fig. 2B). A similar staining
pattern was observed in native tracheal epithelial cells
(Fig. 2C). There was no staining on the striated fibers
that are clearly visible in Fig. 2B. A small number (5) of
gold grains can be seen over the axonemes in Fig. 2C.
However, their concentration is clearly much lower
than that over the basal bodies and transition zones,
and they probably represent background staining.
The Centrin-1 Gene Is Not Transcribed in Cultured
HTE Cells
We then analyzed the expression of each of the three
known human centrin genes to determine which are
transcribed during growth and differentiation of HTE
cells. Expression of the centrin-1 gene was first analyzed through Northern blot hybridization experiments. To limit cross-reactions with other related centrin genes, we used the 38-untranslated region of the
centrin-1 gene (nucleotides 770 through 1088) as a
probe. This probe was obtained by PCR amplification of
genomic DNA (see MATERIALS AND METHODS ). No signal
was detected in Northern blot experiments with RNA
isolated from HTE cells cultured at an air-liquid interface or immersed (data not shown). However, the same
radiolabeled probe readily detected a single sequence in
human DNA in Southern blot experiments. These
experiments indicate that, in cultured HTE cells, centrin-1 mRNA is found at a very low concentration, if
at all.
We sought to detect centrin-1 transcripts using the
more sensitive RT-PCR technique. RNA was prepared
from cultured HTE cells and reverse transcribed. cDNA
aliquots were then amplified with the primers C1-88
and C1-a587 (see Table 1). Amplification of genomic
DNA with these primers yields a 500-bp product (Fig. 3,
lane a), the identity of which was confirmed by digestion with the restriction endonucleases Bgl II and Stu I.
This is the size expected from amplification of a cDNA,
making it impossible to distinguish genuine amplification of cDNAs from amplification of genomic DNA
contaminating the RNA preparation. It was therefore
essential to treat the RNA with RNase-free DNase
before RT. Figure 3, lanes b and c, shows aliquots of
PCR reactions performed with template cDNAs derived
from HTE cells grown for 21 days either immersed or at
an air-liquid interface. No specific product is visible. It
should be noted that 40 cycles of amplification were
performed, which should allow the detection of even
Downloaded from http://ajplung.physiology.org/ by 10.220.33.1 on June 18, 2017
Fig. 2. Immunocytochemical detection
of centrin. A: immunofluorescence microscopy of ciliated cells obtained by
trypsinization and cytocentrifugation of
cells grown at an air-liquid interface.
Staining is located in apical cytoplasm
in a punctate pattern corresponding to
distribution of basal bodies. Bar, 20 µm.
B: immunogold electron microscopy of a
ciliated cell from an air-liquid interface
culture. Gold particles are located primarily within basal bodies and transition zones. Ax, axoneme; Bb, basal body;
Sf, striated fiber; Tz, transition zone.
Bar, 1 µm. C: immunogold electron
microscopy of a ciliated cell from native
tracheal epithelium shows an identical
distribution of centrin. Bar, 1 µm.
L1150
CILIOGENESIS AND CENTRIN EXPRESSION
Centrin-1 Is Not Expressed in Human
Tracheal Epithelium
The absence of centrin-1 transcripts could be an
artifact of cell culture. We therefore sought to detect
centrin-1 mRNA in uncultured human tracheal epithelium. RNA was purified from strips of tracheal epithelium obtained 16 h or less postmortem and reverse
transcribed. Forty cycles of amplification with the
primers C1-88 and C1-a587 failed to yield any detectable product (Fig. 4, lane a). As a positive control, we
used the same reaction mix to amplify 200 ng of
genomic DNA. The expected 500-bp product was observed after 34 cycles of amplification (Fig. 4, lane b).
Therefore, we conclude that the centrin-1 gene is not
transcribed in native, uncultured tracheal epithelial
cells.
Centrin-1 Is an Intronless Gene
The result of the amplification of cDNAs with the
primers C1-88 and C1-a587 had shown that most of the
Fig. 4. RT-PCR detection of centrin sequences in fresh (uncultured)
human tracheal cells. Primers used were specific for centrin-1
(lanes a and b), centrin-2 (lane c), and centrin-3 (lane d). Samples
amplified were genomic human DNA (lane b) and cDNAs derived
from native tracheal epithelium (lanes a, c, and d). No. of amplification cycles performed was 40 (lane a), 34 (lane b), 32 (lane c), and 38
(lane d). Nos. at left, position of DNA size markers (in bp).
centrin-1 coding sequence was not interrupted by introns. We sought to determine whether this was true of
the rest of the centrin-1 cDNA sequence.
The sequence, position, and orientation of the centrin1-specific primers used are given in Table 1. In all of our
experiments, the size of the PCR products obtained
after amplification of genomic DNA was identical to
that expected from the centrin-1 cDNA sequence; as we
mentioned before, amplification with the primers C1-88
and C1-a587 yielded a 500-bp product (Fig. 3, lane a),
amplification with the primers C1-88 and C1-a1088
yielded a 1,000-bp product, and, finally, amplification
with the primers C1-770 and C1-a1088 yielded a
300-bp product (data not shown). The identities of the
PCR products were confirmed by determining their
nucleotide sequence or by diagnostic digestions with
restriction enzymes. We conclude from these experiments that most of the centrin-1 gene is devoid of
introns, although we cannot rule out the presence of an
intron upstream of nucleotide 88 or downstream of
nucleotide 1088.
The Centrin-2 Gene Is Actively Transcribed
in Cultured HTE Cells, Testes, and Native
Tracheal Epithelium
Fig. 3. PCR amplification of centrin sequences. Primers used were
specific for centrin-1 (lanes a–d) or centrin-2 (lanes e–h) genes.
Template consisted of genomic DNA (lanes a and e), cDNAs derived
from human tracheal epithelium (HTE) cells grown immersed (lanes b
and f ), cDNAs derived from HTE cells grown at an air-liquid interface
(lanes c and g), and cDNAs derived from human testes (lanes d and
h). An aliquot of PCR reactions was analyzed by agarose gel
electrophoresis in presence of ethidium bromide. Nos. at left, position
of DNA molecular-weight markers.
RT-PCR experiments performed in parallel with those
described in The Centrin-1 Gene Is Not Transcribed in
Cultured HTE Cells showed that the centrin-2 gene is
transcribed in cultured HTE cells. Figure 3 (lanes e–h)
shows the PCR products obtained with the primers
C2-88 and C2-a604. Amplification of genomic DNA
yielded a 2-kb product, indicating that one or more
introns interrupt the centrin-2 coding sequence (Fig. 4,
lane e). A 500-bp product was obtained after amplification of cDNAs derived from HTE cells grown for 21 days
immersed (Fig. 3, lane f ) or at an air-liquid interface
(Fig. 3, lane g), as well as after amplification of testis
cDNAs (Fig. 3, lane h). The identity of this PCR product
was confirmed by digesting it with the enzymes Hind
Downloaded from http://ajplung.physiology.org/ by 10.220.33.1 on June 18, 2017
minute amounts of cDNA. In further experiments, no
product was obtained by amplification of cDNAs derived from HTE cells cultured for shorter lengths of
time (12, 14, and 16 days, immersed and air-liquid
interface cultures). We also failed to obtain any PCR
amplification product when other centrin-1-specific
primers were used (data not shown). These results
show that the centrin-1 gene is not transcribed in
cultured HTE cells.
Figure 3, lane d, shows that a PCR product was
obtained when human testis cDNA was used as a
template. No product was obtained if the enzyme was
omitted from the RT reaction, proving that this product
is truly derived from a cDNA. This result confirms that
the centrin-1 gene is transcribed in human testes (from
which its cDNA was isolated) (6).
CILIOGENESIS AND CENTRIN EXPRESSION
Fig. 5. Quantitation of centrin-2 transcripts by Northern blot hybridization. RNA was isolated from HTE cells grown at an air-liquid
interface for 12, 15, 18, or 21 days. Each gel lane contains polyadenylated RNA prepared from 5 culture inserts (100–150 µg of total RNA).
A: portion of an autoradiogram showing binding of a centrin-2specific probe to a 1.2-kb mRNA. Nos. at bottom, amount of radioactivity bound. B: portion of an autoradiogram showing binding of a
glyceraldehyde-3-phosphate dehydrogenase (GAPDH)-specific probe
to a 1.4-kb mRNA. Nos. at bottom, amount of radioactivity bound.
C: centrin-2-specific signal was normalized relative to GAPDH signal
and is expressed as a percentage of signal obtained from day 12 cells
(see text for details).
concentration increases 2.5-fold to reach a maximum
after 17–19 days in culture.
Comparison of Fig. 6, A and B, shows that the
magnitude of the change in centrin-2 concentration is
essentially the same (2.5-fold). However, the timing of
this change varies; in the experiment shown in Fig. 6A,
the centrin-2 mRNA concentration did not increase
markedly until days 15–17. In contrast, in the experiment shown in Fig. 7B, the centrin-2 mRNA concentration increased as early as day 9 and reached a maximum after 17 days in culture. The length of time in
culture before the change in centrin-2 mRNA concentration and the appearance of ciliated cells varies from
trachea to trachea. The experiment shown in Fig. 6A is
more typical than that shown in Fig. 6B.
Microscopic examination of frozen sections showed
that the accumulation of centrin-2 mRNA coincides
with the appearance of ciliated cells; for instance, in the
experiment shown in Fig. 6A, the first ciliated cells
appeared after 15 days in culture. The number of
Downloaded from http://ajplung.physiology.org/ by 10.220.33.1 on June 18, 2017
III and Sty I and observing fragments of the expected
sizes. A centrin-2-specific PCR product could also be
obtained after 32 cycles of amplification of cDNAs
derived from native human tracheal epithelium (Fig. 4,
lane c).
Comparison of Fig. 3, lanes f and g, suggested that
there may be more centrin-2 mRNA in HTE cells grown
at an air-liquid interface than in HTE cells grown
immersed. We therefore sought to quantitate the levels
of centrin-2 gene expression during the growth and
differentiation of HTE cells.
We first studied the expression of the centrin-2 gene
through Northern blot experiments. To avoid crossreactions with other centrin genes, we used the 38untranslated region of the centrin-2 cDNA as a probe
(see MATERIALS AND METHODS ). This probe was radiolabeled and applied to a blot of polyadenylated RNA
isolated from HTE cells grown at an air-liquid interface
for various lengths of time. Each lane contains polyadenylated RNA prepared from five culture wells (,100–
150 µg of total RNA). As expected, the probe detected a
1.2-kb mRNA. A typical autoradiogram is shown in Fig.
5A. The radioactivity bound to this mRNA was quantified with a phosphorimager and is recorded underneath
each band. To account for differences in the amount of
RNA loaded in each lane, the centrin-2 probe was
removed and a new probe specific for the ‘‘housekeeping’’ gene GAPDH was applied. The GAPDH gene is
usually assumed to be transcribed at a constant level in
cells. The 1.4-kb mRNA detected is shown in Fig. 5B. At
each time point, the intensity of the centrin-2 signal
was divided by the corresponding GAPDH signal to
yield an estimate of the centrin-2 mRNA abundance in
the original sample. The number obtained for day 12
cultures was chosen as a reference, and all other
numbers are expressed as a percentage of this number.
Figure 5C shows the centrin-2 mRNA abundance
after 12, 15, 18, and 21 days of culture at an air-liquid
interface. The concentration of centrin-2 mRNA after
15, 18, and 21 days in culture at an air-liquid interface
is approximately double the concentration seen at day
12. Similar results were obtained with cells from three
different tracheae, although the exact timing of the
increase in mRNA concentration varied from experiment to experiment.
We then sought to independently confirm these results using a semiquantitative method based on RTPCR. We took several precautions (see MATERIALS AND
METHODS ) to ensure that the amount of PCR product
synthesized is proportional to the concentration of
centrin-2 mRNA in the sample.
RNA was prepared from HTE cells grown at an
air-liquid interface for various lengths of time. Two
micrograms of RNA were reverse transcribed, and a
cDNA aliquot was amplified with the primers C2-88
and C2-a604. The mRNA level observed at the earliest
time point was fixed at 1.0, and all other data are
expressed as multiples of this level. Figure 6 shows the
result of two experiments with cells obtained from two
different tracheae. Over time, the centrin-2 mRNA
L1151
L1152
CILIOGENESIS AND CENTRIN EXPRESSION
Centrin-2 and -3 Are Expressed at a Low Constant
Level in HTE Cells Grown Immersed
Fig. 6. Quantitation of centrin-2 and centrin-3 transcripts by RTPCR amplification. Centrin-2 (n) and centrin-3 (r) mRNAs were
detected by RT-PCR with total RNA isolated from HTE cells grown at
an air-liquid interface for various lengths of time. Amount of specific
PCR product is expressed as a multiple of the amount obtained at the
earliest time point. A and B: results of the same experiment
performed with cells of 2 different tracheae. Each data point represents average of 2 or 3 independent PCR amplifications. Most
individual data points were within 10% of the average.
ciliated cells increased after 17 days and was maximal
after 19 and 21 days in culture.
The Centrin-3 Gene Is Expressed at a Constant Level
in Cultured HTE Cells
Centrin-3 is the most recently isolated member of the
human centrin family. The 38-untranslated region is
not included in the published sequence (24), making it
difficult to design a gene-specific probe to use in Northern blot hybridizations. Instead, we chose to determine
the level of centrin-3 expression using the RT-PCR
method described in MATERIALS AND METHODS. HTE
cDNAs were amplified with the primers C3-1 and
We previously mentioned that ciliogenesis does not
occur in cells grown immersed. If the change in centrin-2 mRNA concentration we observed in air-liquid
interface cultures is indeed linked to ciliogenesis, it
should not take place if the cells are grown in immersion.
To test this hypothesis, HTE cells from one trachea
were grown either at an air-liquid interface or in
immersion. RNA was purified after 7 or 14 days and
analyzed by Northern blot with a probe specific for
centrin-2 transcripts. Figure 7 A shows that, after 7
days in culture, the centrin-2 mRNA concentration was
approximately identical in immersed cells and in cells
grown at an air-liquid interface. Between 7 and 14 days
of culture, the centrin-2 mRNA concentration increased
as expected in cells grown at an air-liquid interface. In
contrast, this concentration did not change in immersed cells. This result reinforces our conclusion that
the change in centrin-2 mRNA concentration that we
observed is truly linked to the occurrence of ciliogenesis.
We then sought to generalize this observation using
our semiquantitative RT-PCR assay. Using cells derived from several different tracheae, we determined
mRNA concentrations for centrin-2, centrin-3, and
GAPDH. We then expressed our results as the ratio of
the concentration seen in cells grown at an air-liquid
interface to that in cells grown immersed (air-toimmersed ratio; Fig. 7B). At early time points (4–6 days
in culture), we found that the concentrations of centrin-2 and centrin-3 mRNAs were identical in both
types of culture (ratios of 1.08 and 0.94, respectively).
These numbers are the averages of the results of two
experiments with cells derived from two different tracheae. We then analyzed RNA derived from four independent experiments where the cells were grown for
Downloaded from http://ajplung.physiology.org/ by 10.220.33.1 on June 18, 2017
C3-a503 (see Table 1). The 500-bp PCR product obtained was digested with the restriction enzyme Hind
III to yield fragments of 350 and 150 bp, confirming its
identity. No product was obtained if reverse transcriptase was omitted from the cDNA synthesis reaction
(data not shown).
We quantitated the amount of PCR product derived
from HTE cells grown for various lengths of time at an
air-liquid interface and normalized the results as above.
Figure 6 shows that the concentration of centrin-3
mRNA does not change more than 50% in comparison
with that observed after 4 days in culture. In particular,
the centrin-3 mRNA concentration does not systematically increase over time.
Centrin-3 transcripts were also detected in RNA
derived from native human tracheal epithelium (Fig. 4,
lane d). However a minimum of 35 cycles of amplification had to be performed to observe a specific PCR
product. In contrast, 25 cycles of amplification were
sufficient to detect a specific product from cultured
HTE cell RNA. Therefore, centrin-3 is expressed in
native epithelium, although at a much lower level than
in cultured HTE cells.
CILIOGENESIS AND CENTRIN EXPRESSION
L1153
Fig. 7. Comparison of centrin gene expression levels in HTE cells
grown immersed or at an air-liquid interface. A: Northern blot
analysis of centrin-2 mRNA abundance in HTE cells. Cells were
grown either at an air-liquid interface (Air) or immersed (Imm) for 7
(d7) or 14 (d14) days. Each lane contains 20 µg of total RNA. B:
centrin-2 (C2), centrin-3 (C3), and GAPDH transcripts were detected
by RT-PCR as described in text. RNA was prepared before onset of
ciliogenesis (Early; days 4–6) or after appearance of ciliated cells
(Late; days 12–18). In each case, we calculated ratio of amount of
PCR product obtained from cells grown at an air-liquid interface to
that obtained from immersed cells. Data are averages 6 SE from 2
(Early) or 4 (Late) different tracheae.
longer times (12–18 days) so that ciliogenesis could
occur. We found that the average concentration of
centrin-2 mRNA was 2.45 times higher in cells grown at
an air-liquid interface than in immersed cells (n 5 4;
SE 5 0.25). In contrast, the concentration of the
GAPDH mRNA was identical in both types of cells
(air-to-immersed ratio 5 0.96; n 5 3; SE 5 0.08). The
concentration of centrin-3 mRNA was slightly higher in
cells grown at an air-liquid interface (air-to-immersed
ratio 5 1.65; n 5 4; SE 5 0.26).
DISCUSSION
Centrins are Ca21-binding proteins found in a variety
of subcellular structures, often in association with
microtubule-organizing centers. Many centrin-containing structures are found exclusively in ciliated cells,
suggesting that centrin gene expression may be a
useful marker in the study of ciliogenesis. For this
reason, we sought to characterize the expression patterns of human centrin genes during ciliogenesis.
In Vitro Ciliogenesis in HTE Cells
The culture system we used in this study has been
previously partially characterized (43). Growth of HTE
cells at an air-liquid interface results in the formation
of a multilayered pseudoepithelium. The apical surface
of the cell sheet consists of ciliated cells (60–80% of the
area) and mucus-producing goblet cells. The mechanism by which the air-liquid interface improves the
differentiation of HTE cells is not known.
Distribution of Centrin in Ciliated Cells
Our immunostaining data show centrin to be largely
confined to the basal bodies of ciliated cells. Centrin has
been shown before to be a component of basal bodies in
many species (20). The absence of centrin outside the
basal bodies is somewhat surprising. No staining was
seen over the striated rootlets that are clearly visible in
electron micrographs (Fig. 2). In contrast, centrin is an
important component of striated fibers in algae (see
below). Absence of anti-centrin staining in striated
rootlets has been previously noted in chick and mouse
tracheal ciliated cells (20) and mammalian photoreceptor cells (41). This may indicate that in mammals
centrin is not an obligatory component of these structures. Alternatively, centrin may be present but in a
conformation preventing access by the antibody. However, the monoclonal antibody we used (20H5) stains
striated rootlets in invertebrates (35). A third possibility is that the centrin isoform present in these structures is not recognized by the antibody we used.
However, we think that this is unlikely because the
20H5 antibody bound 10 protein isoforms resolved by
2-dimensional gel electrophoresis in immunoblotting
experiments (28). Moreover, it recognized all three
bacterially produced centrin gene products (24).
The absence of centrin in the striated rootlets of
vertebrate cilia may be functionally significant. Centrin is the major component of the striated rootlets of
Tetraselmis (31). In several species of algae, including
Chlamydomonas, Platymonas, Spermatozopsis, and Tetraselmis, these fibers were shown to contract in a
Ca21-dependent manner (23, 30, 33–36). The analysis
of the Chlamydomonas centrin mutants (vfl2 and others) supported the hypothesis that centrin, a Ca21binding protein, mediated this contraction (38). Conceivably, a protein other than centrin mediates contraction
of the striated rootlets in vertebrate ciliated epithelial
cells.
Recent data (10) obtained in the human oviduct
showed that the striated rootlets are much longer early
in the ciliogenesis process than they are in mature
ciliated cells. It is conceivable that centrin may be
Downloaded from http://ajplung.physiology.org/ by 10.220.33.1 on June 18, 2017
Very similar culture systems have been previously
described for cells obtained from other organisms (1, 4,
5, 8, 15, 16, 18, 27, 39, 40). One important quantitative
feature of our system is the abundance of ciliated cells;
the area covered by ciliated cells in our system is much
greater than that reported in cultures of rat cells
(where it represents 5–15% of the area) (4). This
feature certainly facilitates the detection of changes in
gene expression linked to ciliogenesis.
Cells derived from different tracheae become ciliated
after a variable length of time. The most typical value is
13–15 days until the appearance of ciliated cells.
However, this value can occasionally be as early as 11
days or as late as 17 days. This variability is reflected in
the timing of gene expression changes as illustrated in
Fig. 6. Because these are primary cultures, this variability may be linked to the health of the epithelium before
isolation of the cells.
L1154
CILIOGENESIS AND CENTRIN EXPRESSION
Comparison of Gene Expression Levels by RT-PCR
To follow centrin gene expression during differentiation, we needed to compare the abundance of mRNAs in
cells grown for various lengths of time. The first
technique we used was Northern blot hybridization,
followed by a quantitation of the signal bound specifically. However, we found that this technique was not
well suited to our goals. It requires large amounts of
RNA, and it does not lend itself well to determining
expression levels of many different genes with the same
RNA samples.
For these reasons, we developed a semiquantitative
method based on RT-PCR to independently confirm the
results of Northern blot analysis. Both RT and PCR
amplification have the potential to give nonquantitative results. As described in MATERIALS AND METHODS, we
took several precautions to ensure that our results are
as quantitative as possible. Our task was made easier
by the fact that we did not need to determine absolute
abundances of mRNAs but merely needed to compare
mRNA concentrations between similarly prepared RNA
samples.
Three main lines of evidence indicate that our RTPCR method yields accurate comparisons of mRNA
abundances from sample to sample. 1) First, the conclusions regarding centrin-2 expression that were reached
by this method were identical qualitatively and quantitatively to those reached through the Northern blot
experiments. This agreement between the two methods
was also noted for other genes involved in ciliogenesis
(LeDizet and Finkbeiner, unpublished data). 2) The
results obtained were very reproducible when duplicate
amplifications of the same RNA samples were performed and when the experiments were duplicated
with cells obtained from a different trachea. 3) Finally,
we found that different centrin genes have different
patterns of expression. Therefore, we can rule out the
possibility that the variations in the amounts of RTPCR products are due to the presence of inhibitory
components in some of the RNA samples studied, to
RNA degradation, or to errors in RNA quantitation. We
are therefore confident that the amount of RT-PCR
product synthesized under our conditions represents a
reasonable estimate of mRNA abundance.
Centrin-1
Ciliated cells harbor several specific cytoskeletal
structures known or suspected to contain centrin. For
this reason, we hypothesized that ciliated cells might
contain specific centrin isoforms, possibly expressed
from a specific gene. At the outset of this work, we
expected to find centrin-1 expressed in ciliated cells;
the centrin-1 cDNA was isolated from human testes (6),
an organ where active ciliogenesis takes place. A later
abstract (42) reported centrin-1 expression in mammalian ciliated sensory cells, which contain a highly
modified ciliary axoneme.
We found, however, that the centrin-1 gene is never
transcribed in HTE cells, either native or cultured. It is
therefore clear that ciliogenesis can occur in the absence of centrin-1. Furthermore, with the possible
exception of ciliated sensory cells, centrin-1 expression
appears restricted to testes; we searched the expressed
sequence tag (EST) section of GenBank for ESTs derived from the centrin-1 gene. Only two human ESTs
were found, and both originated in testis cDNA libraries (see Table 2).
Table 2. Human ESTs derived from known
centrin genes
Tissue or Cell Type
Number of ESTs
Centrin-1
Testis
2
Centrin-2
Heart
Lung
Melanocyte
Pineal gland
Jurkat T cells
Testis
Tonsil (germinal B cells)
8- to 9-wk total fetus
Fetal brain
Fetal cochlea
Fetal heart
Fetal lung
Brain tumor
Breast tumor
Colon tumor
Kidney tumor
Skin tumor
Unknown
Total
1
4
2
1
1
1
2
2
1
1
2
4
1
1
2
1
1
1
29
Centrin-3
Breast
Pregnant uterus
Rhabdomyosarcoma
Testis
Tonsil (germinal B cells)
8- to 9-wk total fetus
12-wk total fetus
Fetal cochlea
Total
EST, expressed sequence tag.
2
6
1
4
9
2
1
2
27
Downloaded from http://ajplung.physiology.org/ by 10.220.33.1 on June 18, 2017
found in these longer fibers but may be absent from the
‘‘remnants’’ seen in older cells.
The 20H5 antibody also failed to stain the ciliary
axoneme. In contrast, the same antibody stains Chlamydomonas axonemes, where centrin was shown to be
a light chain associated with one type of inner dynein
arms (17, 29), as well as the axonemes of the protist
Holomastigotoides (21). Levy et al. (20), using a different anti-centrin antibody, found no staining in the
axonemes of chick and mouse tracheal epithelia. The
polypeptide composition of inner dynein arms has been
studied in two vertebrate species, the pig and the
Antarctic rockfish (11, 14). However, the published
electrophoretograms do not include the region of the gel
where centrin would be found. Therefore, the presence
or absence of centrin in vertebrate inner dynein arms
remains an open question.
CILIOGENESIS AND CENTRIN EXPRESSION
One possible explanation of these results is that the
centrin-1 protein is needed exclusively in testes. However, the absence of introns in the centrin-1 sequence
raises the intriguing possibility that it represents a
processed pseudogene. As such, an mRNA derived from
it might not be translatable. This possibility could be tested
with the development of antibodies specific for centrin-1.
Centrin-2
Centrin-3
Centrin-3 is the most recently discovered member of
the human centrin gene family (24). The predicted
centrin-3 protein is only 54% identical to that of
centrin-1 or centrin-2, suggesting a markedly different
function. We identified 27 ESTs derived from the
centrin-3 gene (see Table 2). These ESTs originate from
a variety of tissues and cell types, although their
distribution appears less wide than that of centrin-2derived ESTs. Centrin-3 mRNA appears abundant in
cultured HTE cells, where 25 cycles of PCR amplification were sufficient to detect a specific product. Thirty-
five cycles of PCR amplification were sufficient to detect
a specific product from RNA isolated from native tracheal epithelial cells. These results contrast with those
of Middendorp et al. (24). These authors reported a very
low centrin-3 mRNA abundance in a human lymphoblastic cell line where two rounds of PCR amplification
with nested primers were necessary to obtain 500 ng of
PCR product. Centrin-3 gene expression may therefore
be very variable in different cell types.
We found that the centrin-3 mRNA concentration
varied on either side of a constant value during the
growth and differentiation of HTE cells. There did not
seem to be a systematic trend to these variations. In
particular, the centrin-3 mRNA abundance did not
consistently increase over time as was the case with
centrin-2 mRNA. Although we cannot be certain that
the concentration of centrin-3 protein mirrors that of
its mRNA, this result would suggest that centrin-3 is
not found in cilia and cilia-associated structures. This
conclusion is supported by the finding that centrin-3
mRNA is only slightly lower in cells grown immersed
compared with cells grown at an air-liquid interface.
The much lower abundance in centrin-3 mRNA observed in native, uncultured epithelial cells is harder to
explain but may be significant.
In conclusion, we have shown that the genes encoding the three known human centrin genes are regulated independently during the growth and differentiation of HTE cells. In the absence of antibodies specific
for individual centrin isoforms, one can only presume
that changes in mRNA levels are reflected in the
abundance of the corresponding proteins. However, our
finding that the three centrin genes have markedly
different expression patterns suggests that centrin
isoforms are not interchangeable and that they each
fulfill unique functions. Furthermore, the centrin-2
mRNA abundance closely mirrors the fraction of ciliated cells within the pseudoepithelium and may therefore constitute a useful marker for the study of this
differentiation process.
We express our gratitude to Susan Y. Chun, Rebecca SiegelWasserman, and Lorna T. Zlock for outstanding technical help; to
Margaret Mayes for instruction in histological techniques; to Zac
Cande, Gianni Piperno, Joel Rosenbaum, and Tim Stearns for useful,
encouraging, and stimulating discussions; and to Amie Franklin and
Gianni Piperno for critical readings of the manuscript before publication.
This work was supported by National Heart, Lung, and Blood
Institute Specialized Center of Research Grant HL-42368 and Multidisciplinary Training Program in Lung Disease Grant T32-HL07185.
Present addresses: M. LeDizet, Dept. of Medical Pathology, Univ.
of California, Davis Medical Center, 2315 Stockton Blvd, Sacramento, CA 95817; J. C. Beck, Alza Corporation, 950 Page Mill Rd.,
Palo Alto, CA 94303.
Address for reprint requests and present address of W. E. Finkbeiner: Dept. of Medical Pathology, Univ. of California, Davis Medical
Center, 2315 Stockton Blvd., Sacramento, CA 95817.
Received 3 February 1998; accepted in final form 15 September 1998.
REFERENCES
1. Adler, K. B., P. W. Cheng, and K. Kim. Characterization of
guinea pig tracheal epithelial cells maintained in biphasic organotypic culture: cellular composition and biochemical analysis or
Downloaded from http://ajplung.physiology.org/ by 10.220.33.1 on June 18, 2017
In contrast to centrin-1, the centrin-2 gene appears to
be ubiquitously expressed. ESTs derived from the centrin-2 gene were identified on the basis of their high
homology (.95%) to the centrin-2 cDNA sequence. To
date, 29 ESTs derived from the centrin-2 gene can be
found in the GenBank database, and they originate
from many different organs and cell types (see Table 2).
This suggests that centrin-2 is present in structures
found in all cell types, such as centrosomes.
In cultured HTE cells, the centrin-2 mRNA is always
detectable. Its abundance increases approximately twofold after 15–19 days of growth at an air-liquid interface, which coincides with the appearance of ciliated
cells. As expected, this concentration increase does not
take place in cells grown immersed, which never undergo ciliogenesis. Furthermore, our data indicate that
centrin, as detected by immunostaining, is concentrated in the basal bodies of ciliated cells. Taken
together, these results strongly suggest that centrin-2
is present in the basal bodies of ciliated cells.
It should be pointed out that the centrin-2 mRNA
abundance was determined in RNA samples prepared
from the entire multilayered pseudoepithelium. Ciliogenesis only occurs in the topmost layer of cells.
Therefore, although 60–80% of the cells in the top layer
acquire cilia, they represent a much smaller proportion
of the total number of cells in the culture. Presumably,
centrin-2 gene induction only occurs in the ciliated cells
and not in the cells of the lower layers. As a result, the
twofold increase in overall centrin-2 mRNA abundance
represents a much larger increase within the ciliated cells.
The mechanism by which the concentration of centrin-2 mRNA increases is not known. An increase in the
levels of mRNAs encoding ciliary proteins was shown to
accompany ciliogenesis in many different organisms (2,
9, 13, 22, 26). In Chlamydomonas, this increase was
shown to be the consequence both of increased gene
transcription and of a selective mRNA stabilization (13).
L1155
L1156
2.
3.
4.
5.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
released glycoconjugates. Am. J. Respir. Cell Mol. Biol. 2: 145–
154, 1990.
Andrews, K. L., P. Nettesheim, D. J. Asai, and L. E. Ostrowski. Identification of seven rat axonemal dynein heavy
chain genes: expression during ciliated cell differentiation. Mol.
Biol. Cell 7: 71–79, 1996.
Birrel, G. H., and O. H. Griffith. Strategies in colloidal gold
labeling of cell surfaces and cytoskeletal elements of cultured
cells. In: Colloidal Gold: Principles, Methods and Applications,
edited by M. A. Hayat. San Diego, CA: Academic, 1989, p.
333–335.
Clark, A. B., S. H. Randell, P. Nettesheim, T. E. Gray, B.
Bagnell, and L. E. Ostrowski. Regulation of ciliated cell
differentiation in cultures of rat tracheal epithelial cells. Am. J.
Respir. Cell Mol. Biol. 12: 329–338, 1995.
De Jong, P. M., M. A. J. A. van Sterkenburg, S. C. Hesseling,
J. A. Kempenaar, A. A. Mulder, A. M. Mommaas, J. H.
Dijkman, and M. Ponec. Ciliogenesis in human bronchial
epithelial cells cultured at the air-liquid interface. Am. J. Respir.
Cell Mol. Biol. 10: 271–277, 1994.
Errabolu, R., M. A. Sanders, and J. L. Salisbury. Cloning of a
cDNA encoding human centrin, an EF-hand protein of centrosomes and mitotic spindle poles. J. Cell Sci. 107: 9–16, 1994.
Finkbeiner, W. E., S. D. Carrier, and C. E. Teresi. Reverse
transcription-polymerase chain reaction (RT-PCR) phenotypic
analysis of cell cultures of human tracheal epithelium, tracheobronchial glands, and lung carcinomas. Am. J. Respir. Cell Mol.
Biol. 9: 547–556, 1993.
Finkbeiner, W. E., J. A. Nadel, and C. B. Basbaum. Establishment and characterization of a cell line derived from bovine
tracheal glands. In Vitro Cell. Dev. Biol. 22: 561–567, 1986.
Guttman, S. D., and M. A. Gorovsky. Cilia regeneration in
starved Tetrahymena: an inducible system for studying gene
expression and organelle biogenesis. Cell 17: 307–317, 1979.
Hagiwara, H., T. Aoki, N. Ohwada, and T. Fujimoto. Development of striated rootlets during ciliogenesis in the human
oviduct epithelium. Cell Tissue Res. 290: 39–42, 1997.
Hastie, A. T., D. T. Dicker, S. T. Hingley, F. Kueppers, M. L.
Higgins, and G. Weinbaum. Isolation of cilia from porcine
tracheal epithelium and extraction of dynein arms. Cell Motil.
Cytoskeleton 6: 25–34, 1986.
Hodges, G. M., M. A. Smolira, and D. C. Livingstone.
Scanning electron microscope immunocytochemistry in practice.
In: Immunolabelling for Electron Microscopy, edited by J. M.
Polak and I. M. Varndell. Amsterdam: Elsevier, 1984, p. 189–
233.
Johnson, K. A., and J. L. Rosembaum. Flagellar regeneration
in Chlamydomonas: a model system for studying organelle
assembly. Trends Cell Biol. 3: 156–161, 1993.
King, S. M., S. P. Marchese-Ragona, S. K. Parker, and H. W.
Detrich III. Inner and outer arm axonemal dyneins from the
antarctic rockcod Notothenia coriiceps. Biochemistry 36: 1306–
1314, 1997.
Kondo, M., W. E. Finkbeiner, and J. H. Widdicombe. Simple
technique for culture of highly differentiated cells from dog
tracheal epithelium. Am. J. Physiol. 261 (Lung Cell. Mol. Physiol.
5): L106–L117, 1991.
Kondo, M., W. E. Finkbeiner, and J. H. Widdicombe. Cultures of bovine tracheal epithelium with differentiated ultrastructure and ion transport. In Vitro Cell. Dev. Biol. 29A: 19–24, 1993.
LeDizet, M., and G. Piperno. The light chain p28 associates
with a subset of inner dynein arm heavy chains in Chlamydomonas axonemes. Mol. Biol. Cell 6: 697–711, 1995.
Lee, T.-C., R. Wu, A. R. Brody, J. C. Barrett, and P.
Nettesheim. Growth and differentiation of hamster tracheal
epithelial cells in culture. Exp. Lung Res. 6: 27–45, 1984.
Lee, V. D., and B. Huang. Molecular cloning and centrosomal
localization of human caltractin. Proc. Natl. Acad. Sci. USA 90:
11039–11043, 1993.
Levy, Y. Y., E. Y. Lai, S. P. Remillard, M. B. Heintzelman, and
C. Fulton. Centrin is a conserved protein that forms diverse
associations with centrioles and MTOCs in Naegleria and other
organisms. Cell Motil. Cytoskeleton 33: 298–323, 1996.
Lingle, W. L., and J. L. Salisbury. Centrin and the cytoskeleton of the protist Holomastigotoides. Cell Motil. Cytoskeleton 36:
377–390, 1997.
22. Mar, J., J. H. Lee, D. Shea, and C. J. Walsh. New poly(A)1
RNAs appear coordinately during the differentiation of Naegleria gruberi amebae into flagellates. J. Cell Biol. 102: 353–361,
1986.
23. McFadden, G. I., D. Schulze, B. Surek, J. L. Salisbury, and
M. Melkonian. Basal body reorientation mediated by a Ca21modulated contractile protein. J. Cell Biol. 105: 903–912, 1987.
24. Middendorp, S., A. Paoletti, E. Schiebel, and M. Bornens.
Identification of a new mammalian centrin gene, more closely
related to Saccharomyces cerevisiae CDC 31 gene. Proc. Natl.
Acad. Sci. USA 94: 9141–9146, 1997.
25. Newman, G. R. Use and abuse of LR White. Histochem. J. 19:
118–120, 1987.
26. Norrander, J. M., R. W. Linck, and R. E. Stephens. Transcriptional control of tektin A mRNA correlates with cilia development
and length determination during sea urchin embryogenesis.
Development 121: 1615–1623, 1995.
27. Ostrowski, L. E., S. H. Randell, A. B. Clark, T. E. Gray, and
P. Nettesheim. Ciliogenesis of rat tracheal epithelial cells in
vitro. Methods Cell Biol. 47: 57–63, 1995.
28. Paoletti, A., M. Moudjou, M. Paintrand, J. L. Salisbury, and
M. Bornens. Most of centrin in animal cells is not centrosomeassociated and centrosomal centrin is confined to the distal
lumen of centrioles. J. Cell Sci. 109: 3089–3102, 1996.
29. Piperno, G., Z. Ramanis, E. F. Smith, and W. S. Sale. Three
distinct inner dynein arms in Chlamydomonas flagella: molecular composition and location in the axoneme. J. Cell Biol. 110:
379–389, 1990.
30. Salisbury, J. L. Centrin, centrosomes, and mitotic spindle poles.
Curr. Opin. Cell Biol. 7: 39–45, 1995.
31. Salisbury, J. L., A. Baron, B. Surek, and M. Melkonian.
Striated flagellar roots: isolation and partial characterization of
a calcium-modulated contractile organelle. J. Cell Biol. 99:
962–970, 1984.
32. Salisbury, J. L., A. T. Baron, and M. A. Sanders. The
centrin-based cytoskeleton of Chlamydomonas reinhardtii: distribution in interphase and mitotic cells. J. Cell Biol. 107: 635–641,
1988.
33. Salisbury, J. L., and G. L. Floyd. Calcium-induced contraction
of the rhizoplast of a quadriflagellate green alga. Science 202:
975–977, 1978.
34. Salisbury, J. L., M. A. Sanders, and L. Harpst. Flagellar root
contraction and nuclear movement during flagellar regeneration
in Chlamydomonas reinhardtii. J. Cell Biol. 105: 1799–1805,
1987.
35. Sanders, M. A., and J. L. Salisbury. Centrin plays an essential
role in microtubule severing during flagellar excision in Chlamydomonas reinhardtii. J. Cell Biol. 124: 795–805, 1994.
36. Schiebel, E., and M. Bornens. In search of a function for
centrins. Trends Cell Biol. 5: 197–201, 1995.
37. Slot, J. W., and H. J. Geuze. Gold markers for single and double
immunolabeling of ultrathin cryosections. In: Immunolabelling
for Electron Microscopy, edited by J. M. Polak and I. M. Varndell.
Amsterdam: Elsevier, 1984, p. 129–142.
38. Taillon, B. E., S. A. Adler, J. P. Suhan, and J. W. Jarvik.
Mutational analysis of centrin: an EF-hand protein associated
with three distinct contractile fibers in the basal body apparatus
of Chlamydomonas. J. Cell Biol. 119: 1613–1624, 1992.
39. Van Scott, M. R., N. P. Lee, J. R. Yankaskas, and R. C.
Boucher. Effect of hormones on growth and function of cultured
canine tracheal epithelial cells. Am. J. Physiol. 255 (Cell Physiol.
24): C237–C245, 1988.
40. Whittcut, M. J., K. B. Adler, and R. Wu. A biphasic chamber
system for maintaining polarity of differentiation of cultured
respiratory tract epithelial cells. In Vitro Cell. Dev. Biol. 24:
420–428, 1988.
41. Wolfrum, U. Centrin in the photoreceptor cells of mammalian
retinae. Cell Motil. Cytoskeleton 32: 55–64, 1995.
42. Wolfrum, U., and A. Schmitt. Expression of centrin in sensory
cells of retinae, cochlea, and olfactory epithelia (Abstract). Mol.
Biol. Cell 7, Suppl.: 47a, 1996.
43. Yamaya, M., W. E. Finkbeiner, S. Y. Chun, and J. H.
Widdicombe. Differentiated structure and function of cultures
from human tracheal epithelium. Am. J. Physiol. 262 (Lung Cell.
Mol. Physiol. 6): L713–L724, 1992.
Downloaded from http://ajplung.physiology.org/ by 10.220.33.1 on June 18, 2017
6.
CILIOGENESIS AND CENTRIN EXPRESSION