RESEARCH ARTICLE
875
Growth and form of secretory granules involves
stepwise assembly but not differential sorting of a
family of secretory proteins in Paramecium
Laurence Vayssié, Nicole Garreau de Loubresse and Linda Sperling*
Centre de Génétique Moléculaire, CNRS, 91198 Gif-sur-Yvette, France
*Author for correspondence (e-mail: [email protected])
Accepted 18 December 2000
Journal of Cell Science 114, 875-886 © The Company of Biologists Ltd
SUMMARY
Paramecium trichocysts are voluminous secretory vesicles
consisting of a spindle-shaped body surmounted by a tip
that serves to anchor them at exocytotic sites in the plasma
membrane. This constrained shape is conferred by the
proteins stored in the vesicles, which form an insoluble
three-dimensional crystalline array. The constituent
polypeptides (Trichocyst Matrix Proteins, TMPs), which
assemble during trichocyst biogenesis, are produced by
proteolytic processing of soluble proproteins encoded by a
large multigene family. In order to investigate the
functional significance of the TMP multigene family, which
assures the synthesis of a mixture of related polypeptides,
we have designed synthetic genes for heterologous
expression of three different mature polypeptides, which
were used to obtain sequence-specific rabbit antisera.
We used these antisera to carry out immunolocalization
experiments with wild-type trichocysts at different stages
of development and found that the trichocyst matrix
consists of two concentric layers containing different
TMPs, and that the assembly of each layer corresponds
to a distinct phase of trichocyst growth. Examination of
mutant trichocysts created by targeted gene silencing of
different TMP genes showed that the layer containing the
products of the silenced genes is specifically affected, as
are all subsequently assembled parts of the structure,
consistent with an ordered assembly pathway. This
stepwise assembly is not controlled by differential sorting
of the TMPs, as single and double label experiments
provided evidence that the different TMPs are delivered
together to post-Golgi vesicles and developing trichocysts.
We present a model for trichocyst biogenesis in which TMP
assembly is controlled by protein processing.
INTRODUCTION
a highly constrained shape necessary for function, consisting
of a voluminous spindle-shaped body surmounted by a tip that
serves to anchor the granule to cortical exocytotic sites.
Mutants with aberrantly shaped trichocysts are deficient in
exocytosis because the affected vesicles cannot attach to the
cortical exocytotic sites and be secreted (Pollack, 1974; Ruiz
et al., 1976; Adoutte et al., 1984; Gautier et al., 1994). Upon
exocytotic membrane fusion, the vesicle content, which is a
metastable protein crystal, rapidly and irreversibly expands to
an insoluble needle-shaped form, thus propelling itself out of
the cell. This exocytotic response is probably involved in
defense against predators (Harumoto and Miyake, 1991).
Although Paramecium trichocysts like many protozoan
extrusomes (for review see Hausmann, 1978) are very
elaborate, their properties are shared by secretory granules of
higher eukaryotes. Granule contents are in all instances stored
in a condensed, osmotically inert state and decondense upon
release. The state of the condensed molecules can be an
amorphous aggregate but can also be an ordered crystalline
array as in the insulin granules of many species. Vesicle shape
can be constrained (i.e. non-spherical) and is then a property
of the protein contents of the granule. For example, the rod
shape of the Weibel-Palade bodies of endothelial cells is
The regulated secretory pathway allows some differentiated
metazoan cells and a variety of unicellular eukaryotes to
elaborate secretory granules for intracellular storage of
biological molecules and their release by exocytosis in
response to signals from the environment. Histamine release,
insulin secretion, and exocytosis of apical granules during host
cell invasion by malaria parasites are some examples. Despite
extensive studies of secretory granule biogenesis, especially in
mammalian hormone-producing, neuroendocrine and exocrine
cells and tissues, the molecular mechanisms involved in
intracellular transport, sorting, processing, and condensation of
secretory proteins during granule biogenesis remain in large
part undefined (for reviews of secretory granule biogenesis see
Halban and Irminger, 1994; Thiele and Huttner, 1998; Tooze
1998; Arvan and Castle, 1998).
Paramecium provides a model system for analysis of
secretory granule biogenesis. This ciliated protozoan
elaborates ~1000 secretory granules (trichocysts) per cell and
stores them at specialized sites in the plasma membrane, ready
for rapid exocytotic release (for review see Vayssié et al.,
2000). Mature trichocysts are a few microns in size and have
Key words: Dense core vesicle, Multigene family, Gene silencing,
Proteolytic processing, Membrane traffic, Trichocyst
876
JOURNAL OF CELL SCIENCE 114 (5)
conferred by the proteins stored within them, as demonstrated
by transfection of von Willebrand factor propolypeptide into
pituitary or insulinoma cell lines (Wagner et al., 1991).
Mutations affecting granule shape have been isolated in
Paramecium (Pollack, 1974; Ruiz et al., 1976) and in another
ciliate, Tetrahymena (Orias et al., 1983), which secretes
cylindrically shaped granules with crystalline contents known
as mucocysts. Although the corresponding genes have not yet
been cloned, studies of the mutant cells indicate that
perturbation in proteolytic maturation of the secretory proteins
compromises formation of functional secretory granules,
indicating a key role for protein processing in the biogenesis
of these organelles (Adoutte et al., 1984; Turkewitz et al., 1991;
Gautier et al., 1994; for review see Vayssié et al., 2000).
Biochemical characterization in both ciliate models has
shown that, as in insulin-producing cells (Orci et al., 1987; for
reviews see Halban and Irminger, 1994; Arvan and Castle,
1998), the major protein components of ciliate secretory
granules are produced as soluble proproteins that follow the
classical biosynthetic pathway and are delivered to immature
secretory granules before any processing to mature
polypeptides (Turkewitz et al., 1991; Garreau de Loubresse,
1993; Gautier et al., 1994). The products of the proprotein
conversion, which occurs in post-Golgi immature and/or
maturing granules (Hausmann, 1988; Shih and Nelson, 1992;
Gautier et al., 1994; Garreau de Loubresse et al., 1994), finally
assemble into the insoluble, metastable crystalline arrays
characteristic of these secretory organelles. In Paramecium, the
crystalline matrix of the granule is composed of antigenically
distinct core and cortex layers (Hausmann et al., 1988),
reminiscent of the organization of rat insulin secretory
granules. The latter consist of a dense core of crystalline insulin
surrounded by a non-crystalline layer containing C-peptide
(Michael et al., 1987; Bendayan, 1989). This two-layered
structure is the consequence of proinsulin processing given that
insulin crystallizes and the crystal excludes more soluble
components (proinsulin, C-peptide) which concentrate at the
granule periphery.
Whether delivery of cargo proteins to immature granules is
a passive, bulk flow process in ciliates or involves some active
sorting and recruitment of membrane is not known. In addition
to the major cargo proproteins that will condense into the
crystalline matrix after processing, Paramecium trichocysts
also contain a minor population of soluble, membraneassociated glycoproteins that link the insoluble cyrstalline
matrix to the trichocyst membrane via a delicate mesh-like
structure (Momayezi et al., 1993). These proteins, which have
not yet been characterized at the molecular level, might be
involved in membrane recruitment during trichocyst formation
as recently proposed for proteoglycans during zymogen
granule formation in rat pancreatic acinar cells (Schmidt et al.,
2000).
Thus in Paramecium (Adoutte et al., 1984; Gautier et al.,
1994; Gautier et al., 1996; Ruiz et al., 1998) as well as in
Tetrahymena (Turkewitz et al., 1991; Chilcoat et al., 1996;
Verbsky and Turkewitz, 1998), the ensemble of the
biochemical and genetic data indicate that the cargo proteins
themselves play an important role in the formation of the
secretory granules. We have therefore focused our efforts
on characterization of the major protein components of
trichocysts, the trichocyst matrix proteins (TMPs), in order to
investigate how these proteins are delivered to immature
granules and then processed and assembled during granule
maturation.
The TMPs are the products of a large family of ~100 genes
encoding 40-45 kDa proproteins which are processed to mature
15-20 kDa polypeptides; the latter are the polypeptides that
crystallize to form the condensed trichocyst matrix (Gautier et
al., 1994). TMP genes, which appear to be co-expressed and
co-regulated at the transcriptional level (Galvani and Sperling,
2000), can be classified in subfamilies consisting of 4-8 very
similar genes (>85% nucleotide identity) that specify nearly
identical proteins (Madeddu et al., 1995). TMPs that belong to
different subfamilies share only ~25% amino acid identity.
However, all TMPs are predicted to have the same protein
fold (Gautier et al., 1996). Genetic evidence that TMP
heterogeneity is of functional significance and does not
simply reflect a need for large amounts of proteins that can
co-assemble, was obtained by targeted gene silencing
experiments. Cells in which expression of either of two TMP*
gene subfamilies was specifically reduced contained aberrantly
shaped trichocysts which could not be secreted (Ruiz et al.,
1998).
In order to further analyse the role of the TMP multigene
family in the biogenesis of a functional secretory organelle,
we have prepared sequence-specific antibodies against
polypeptides specified by genes belonging to each of three
different TMP gene subfamilies. The antibodies allowed us to
determine the localization of the corresponding polypeptides
in mature and developing wild-type trichocysts and in mutant
trichocysts created by gene silencing. Our data show that each
of the different TMPs is restricted to one or the other of the
concentric core and cortex regions of the trichocyst matrix.
Double-label experiments provide evidence that this does
not result from differential sorting of the corresponding
polypeptides, since they are present as a mixture even in small
post-Golgi vesicles. We propose a model in which TMP
assembly is controlled by protein processing, each layer of the
crystalline edifice corresponding to one phase of trichocyst
growth.
MATERIALS AND METHODS
Cell culture
The wild-type strain used in this study is Paramecium tetraurelia d42, derived from stock 51 (Sonneborn, 1974). Cells were grown at 27°C
in grass infusion (Wheat Grass Powder, Pines International,
Lawrence, KS; USA), inoculated with Klebsiella pneumoniae the day
before use, and supplemented with 0.4 µg/ml β-sitosterol (Sonneborn,
1970). The secretory mutant tam38 (Ruiz et al., 1976) was also used.
Synthetic genes
Synthetic genes were designed for optimal expression in E. coli of
three different polypeptides, the first mature polypeptide of the gene
TMP2c (GenBank U47116), the first mature polypeptide of the gene
TMP4a (GenBank U47117), and the second mature polypeptide of the
gene TMP1b (GenBank U47115), as diagrammed in Fig. 1A. The
protocol for construction of synthetic genes is essentially as described
(Dillon and Rosen, 1993). Overlapping oligonucleotides of 70-100
*Throughout this article, TMP designates the multigene family, TMP1, TMP2 and TMP4
refer to gene subfamilies and TMP1a, TMP2c and TMP4a to specific genes belonging to
the respective subfamilies.
Secretory granule biogenesis in Paramecium
nucleotides were synthesized and gel purified. Each set of
oligonucleotides
(TMP1b,
oligonucleotides
2-9;
TMP2c,
oligonucleotides 12-19; TMP4a, oligonucleotides 22-29) was
annealed and extended with Pfu polymerase (Stratagene). The
reactions of 100 µl contained 5 mM of each dNTP, 20 pmol of each
oligonucleotide, 2.5 units Pfu in the buffer provided by the supplier;
the PCR involved 5 minutes denaturation at 94°C, 10 cycles of
denaturation for 1 minute at 94°C, hybridization 1 minute at 55°C and
elongation 2 minutes 30 seconds at 68°C with an augmentation of 15
seconds at each cycle, followed by a final elongation of 6 minutes at
68°C. All temperature changes were ramped at 1°C/second. The
products of the first reaction were then re-amplified (5 minutes
denaturation at 94°C, 25 cycles of 1 minute denaturation at 94°C, 1
minute annealing at 55°C and 2 minutes 30 seconds elongation at
68°C plus an additional 10 seconds per cycle, final elongation 10
minutes 68°C) with external oligonucleotides of smaller size (TMP1b,
oligonucleotides 1 and 10; TMP2c, oligonucleotides 11 and 20;
TMP4a, oligonucleotides 21 and 30) containing at each extremity
restriction sites for cloning in the expression vector. PCR products
were gel purified, restriction digested, and cloned into the pET21-a
expression vector (Novagen), which adds a C-terminal His6 tag to the
polypeptide.
Oligonucleotides used:
TMP1:
Oligo1: 5′cgccatatgTCGCTGACCAGGGTGCTCTGCG3′;
Oligo2: 5′cgccatatgTCGCTGACCAGGGTGCTCTGCGTGAAATCCTGACCGCTTTCAACAACCTGCGTGTTCAGCTGGTTGACTCC3′;
Oligo3: 5′GCTTCGAAGTCTTTCTGAGCTTCAGCTTCGTCAGCGGTCAGCTGGTTCAGGGAGTCAACCAGCTGAAC3′;
Oligo4: 5′CAGAAAGACTTCGAAGCTCGTGTTATCCAGCTGAACCAGGAACACGCTGAATTCCGCGTGCTGTTGTTG3′;
Oligo5: 5′CCAGGGTCTGTTCGATTTTGTTAGCGTTAGCTTCGATTTCAGCGGTTTTAACAACAACAGCACGCTGG3′;
Oligo6: 5′CGAACAGACCCTGGACCTGATCGACGTTCTGCACGCTGACCTGGACACCCTGAACGGTCAGCTGC3′;
Oligo7: 5′CGGTAGCGTTGTAAACGTCGGTAGCGAAAGCGTAGTCGTCGTTTTCAGCCTGCAGCTGACCGTTCAGG3′;
Oligo8: 5′GTTTACAACGCTACCGTTTCCGAATACAACAAAGAACTGAACGCTGCTCACCAGGCTCTGGACCTGCTGAACC3′;
Oligo9: 5′cgcctcgagTCAGAAAGCACCTTTCAGCTGGGATTTAACGTAGTCGGTGAAACGCGGCTGGTTCAGCAGGTCCAGAGC3′;
Oligo10: 5′cgcctcgagTCAGAAAGCACCTTTCAGCTGGG3′.
TMP2:
Oligo11: 5′cgccatatgTCCTCCACCC3′;
Oligo12: 5′cgccatatgTCCTCCACCCAGGCTGACGTTATCGCTACCATCAAAAAAATCGACCAGTCTCCGTTCGGTC3′;
Oligo13: 5′GTCAACGGTGCAAGCGTCCTGGTATTCGTGGTTACGAGCGTCGTCTTCTTTCTGTTCAGCAACGTAACGGTC3′;
Oligo14: 5′GGACGCTTGCACCGTTGACATCAAAGCTTTCGACAAAGACCTGGCTGAATCCAACCGTAAAAAAATCGAAC3′;
Oligo15: 5′CCTGCAGGATACCACGCTGTGGATACAGCTGACCTTCCAGACGAGCTTCCAGTTCGATTTTTTTACGGTTG3′;
Oligo16: 5′CAGCGTGGTATCCTGCAGGGTCTGGTTGCTCAGAAACAGGCTGAAGTTAAAGGTTACCAGAAAGACCTGGACG3′;
Oligo17: 5′CAGAACTTTTTCTTCGAAGTCAGCTTTTTCTTCAGCACGCTGAGCGTCCAGTTCGTCCAGGTCTTTCTGGTAA3′;
Oligo18: 5′GACTTCGAAGAAAAAGTTCTGGAACACCAGGAAGCTACTGCTATCATCGCTGAAGCTCGTCGTCTG3′;
Oligo19: 5′cgcctcgagCTGGATGAAGGATTCGTGTTCGATGTTGTCAGCGAACAGACGACGAGCTTCAGC3′;
Oligo20: 5′cgcctcgagCTGGATGAAGG3′.
TMP4:
Oligo21: 5′cgccatatgGGTCCAGTTGGTGAAATCC3′;
877
Oligo22: 5′cgccatatgGGTCCAGTTGGTGAAATCCAGATCCTGCTGAACAACATTGCTTCCCAGCTGAACGGTGACCAG3′;
Oligo23: 5′CACTGTTGCTTTCGAAAAAATCATTGCTGACCTGGAACAGGAAATTGCTTACCACCAGACCCAGATCG3′;
Oligo24: 5′GAAGCTCTGGGTGAAGCTGAAGTTGAAGTTCGTGTTGTTACCTCCGACATTGCTAACAACGAAAAATCC3′;
Oligo25: 5′CAGCACGACACCTGGGTTCGTAAAGATGCTGAACACGTTGACCAGATGGAAGCTATCGACGAAGCTTCC3′;
Oligo26: 5′TTTTTTCGAAAGCAACAGTGTCAGATTCGTCCAGTTTGTCAGCTTTTTTCTGGTCACCGTTCAGCTGGG3′;
Oligo27: 5′CAGCTTCACCCAGAGCTTCAGTGGTGGAGTCACGCAGGTTGGACAGAGCAACGATCTGGGTCTGGTGG3′;
Oligo28: 5′CATCTTTACGAACCCAGGTGTCGTGCTGGGACTGACGAGTAGCAGATTCGTCAGCAAAGGATTTTTCGTTGTTAGC3′;
Oligo29: 5′cgcctcgagCTGAGCAAAAGCAACACCAGCCTGCAGGTGCTGAACGATTTTGGAAGCTTCGTCGATAGC3′;
Oligo30: 5′cgcctcgagCTGAGCAAAAGCAACACC3′.
Expression of the synthetic genes and immunization
For bacterial expression of the different synthetic genes, BL21-DE3
cells were transformed with the appropriate pET21 constructs.
Colonies were inoculated with 2% glucose and 100 to 150 µg/ml
ampicillin. After 3 hours of non-induced culture, cells were harvested
by centrifugation, and resuspended in fresh medium containing 100
to 150 µg/ml ampicillin and 0.4 µg/ml IPTG for 3 hours of induced
culture. Cells were harvested and the pellet frozen at −80°C. The
pellet was thawed and supplemented with 8 M urea, 0.1 M NaH2PO4,
0.01 M Tris-HCl, pH 8, and mixed for one hour using a wheel. The
preparation was centrifuged and the clear lysate was loaded directly
onto a Ni-NTA column (Qiagen), washed with the same buffer at pH
8 and then pH 6.5 and the tagged protein eluted at pH 4.5.
The proteins were then dialysed in PBS pH 6.45, and 500 µg of
protein injected into rabbits in Complete Freund’s adjuvant. Injections
were repeated using incomplete Freund’s adjuvant at three week
intervals until high affinity antisera were obtained as judged by
immunoblots against the different affinity purified polypeptides,
purified trichocysts and whole cell extracts (4 or 5 injections).
Electron microscopy and immunolocalization
For morphological observations, whole cell pellets were fixed in 2%
glutaraldehyde in 0.05 M cacodylate buffer pH 7.2 for 90 minutes at
4°C. After washing in the same buffer, the samples were post-fixed in
1% osmium tetroxide in 0.05 M cacodylate buffer, for 60 minutes at
4°C. Post-fixed cells were dehydrated by passage through a series of
ethanol and propylene oxide baths before embedding in Epon. Thin
sections were contrasted with ethanolic uranyl acetate and lead citrate,
then examined using a Philips EM410.
For post-embedding immunolocalization, cell pellets were fixed in
2% paraformaldehyde, 0.15% glutaraldehyde in 0.05 M cacodylate
buffer, pH 7.4, at room temperature for 2 hours. After washing in the
same buffer, cells were dehydrated by passage through a series of
ethanol baths before embedding in LR White (London Resin Ltd).
Thin sections were collected on nickel grids and saturated and
processed with 3% BSA in PBS. This fixation procedure is optimized
for antibody recognition at the expense of ultrastructure preservation.
In particular, the periodic aspect of the crystalline regions of the
trichocyst matrices is poorly preserved. In most of the images
presented here, the crystalline regions appear more electron dense
than surrounding amorphous regions.
For single-label experiments, primary polyclonal antibodies were
diluted 1/250 (anti-TMP1 and anti-TMP2 antisera) or 1/400 (antiTMP4 antiserum). Used at these dilutions, background level and
density of specific staining were roughly equivalent for the anti-TMP1
and anti-TMP4 sera. However both rabbits immunized with TMP2
polypeptide gave specific sera with somewhat lower affinity as judged
by the weaker staining density in immunolocalization experiments;
878
JOURNAL OF CELL SCIENCE 114 (5)
the dilution of 1/250 was used for this serum in order to obtain the
same low background as for the other sera. After washing, the sections
were incubated with a 1/100 dilution of 10 nm colloidal goldconjugated anti-rabbit immunoglobulins (GAR G10, AmershamPharmacia). After extensive washing, the sections were contrasted
with ethanolic uranyl acetate.
Double-label experiments were carried out as described (Slot et al.,
1991) using Protein A – gold purchased from Dr J. W. Slot, Utrecht
University. Briefly, after saturation in 3% BSA – 0.1% fish skin gelatin
in PBS, the sections were treated with anti-TMP4 primary antibody
at a dilution of 1/600, then washed and incubated with Protein A
coupled to 10 nm gold particles at the dilution recommended by
the supplier (1/70). The sections were then treated with 1%
glutaraldehyde in the saturation buffer for 5 minutes and quenched in
the presence of 50 mM glycine in PBS. After washing, the same
procedure was repeated with or without the second primary antibody
(anti-TMP1 at a dilution of 1/350) and the sections were incubated
with Protein A coupled to 15 nm gold particles (1/65 dilution). Finally,
the sections were treated with glutaraldehyde as above, washed in
water and contrasted with ethanolic uranyl acetate.
2D gels and immunoblots
2D gel electrophoresis and immunoblots of partially purified extruded
trichocysts were performed as previously described (Gautier et al.,
1996) with anti-TMP1 and anti-TMP2 sera at 1/400 dilution and the
anti-TMP4 serum at 1/1000 dilution. Serum 031 (Gautier et al., 1994)
was raised against and recognizes almost all of the TMPs and was
used at a dilution of 1/2000.
Homology-dependent gene silencing
Wild-type cells were microinjected with the coding region of either
the TMP1b or the TMP4a gene cloned in pUC18 and linearized prior
to injection, as previously described (Ruiz et al., 1998). Phenotypes
of the clonal descendants of microinjected cells were scored by
examining the exocytotic capacity of the cells and by observation of
trichocyst morphology using immunofluorescence techniques as
previously described (Ruiz et al., 1998). The exocytosis-deficient
phenotypes of the silenced cells are reproducibly correlated with the
reduction of the specific mRNA, as measured by Northern blots
(Ruiz et al., 1998). Cell pellets of appropriately expanded cultures
of the chosen clones were fixed and processed for electron
microscope morphological observation and for post-embedding
immunolocalization experiments as described above.
RESULTS
Fig. 1. Sequence-specific TMP antibodies. (A) Schematic
representation of the organisation of TMP precursors, deduced from
three complete gene sequences (Gautier et al., 1996). Each of the 4045 kDa precursors consists of a signal sequence (yellow) followed by
a pro sequence (green), the first mature polypeptide (red), a basic
region (grey) and the second mature polypeptide (red). Beneath are
represented the regions specified by the TMP1, TMP2 and TMP4
synthetic genes, which consisted of coding sequences for a mature
polypeptide followed by a His6 tag provided by the pET21
expression vector into which the synthetic genes were cloned (see
Materials and Methods). (B) 2D immunoblots of partially purified
trichocysts. The antisera used are indicated on the right of the blots;
serum 031 recognizes most TMPs. N-terminal microsequences
available for the numbered spots, which confirm the sequence
specificity of the sera, are as follows:
1=FADQGALRDIVVAFNNLRVELVDSLNQ;
2=DPLDRLLSTLTDLEDRY; 3=XPVGEIQILLNDIASQLNGD;
4=GPVGEIQILLNNIASQLNGDQ.
Sequence-specific antibodies
TMPs are highly immunogenic (Fok et al., 1988), and
immunization of rabbits with isolated extruded trichocysts
or with gel-purified TMPs raises antibodies that recognize
essentially the entire mixture of up to 100 distinct polypeptides
that compose the crystalline matrix (Adoutte et al., 1984;
Gautier et al., 1994). Monoclonal antibodies are more specific,
but still recognize TMP subsets containing many polypeptides
(Fok et al., 1988; Shih and Nelson, 1991). In order to obtain
more specific reagents, we chose to direct bacterial expression
of a single mature polypeptide from each of three previously
characterized TMP subfamilies. Since Paramecium uses two of
the stop codons recognized by bacteria (TAA and TAG)
to specify glutamine, we constructed synthetic genes (see
Materials and Methods) corresponding to the first mature
polypeptides of TMP2c and of TMP4a and the second mature
polypeptide of TMP1b (Fig. 1A). These are the polypeptides
for which we originally obtained the N-terminal sequences
Secretory granule biogenesis in Paramecium
879
Fig. 2. Immunogold decoration of mature trichocysts using the sequence-specific antibodies. Post-embedding immunolocalization images
obtained for wild-type cells are shown using the anti-TMP2 serum (A,a), the anti-TMP4 serum (B,b) and the anti-TMP1 serum (C,c).
Longitudinal (A,B,C) and cross-section (a,b,c) images are shown for each antiserum. pm; plasma membrane; tj, tip junction; tmx, trichocyst
matrix; tt, trichocyst tip. The secondary antibody was goat anti-rabbit IgGs coupled to 10 nm colloidal gold particles. We note that, independent
of the presence of gold particles, the cortex appears more electron dense than the core in these images, as is generally the case for transmission
e.m. images of thin-sections of trichocysts. Bar, 500 nm.
used to clone the genes, by microsequencing 2D gel spots
(Madeddu et al., 1994; Madeddu et al., 1995). We thus know
with certainty both the N-terminus of these polypeptides and
their position on a 2D gel.
As shown in Fig. 1B, each of the antisera recognizes 2 to 4
of the over 30 major spots resolved on a 2D gel of extruded
trichocyst matrices. These 2D trichocyst gel profiles are highly
reproducible, and in each case, the serum recognizes the spot
used to obtain the original microsequence that served to clone
the gene. In the case of the anti-TMP4a serum, which
recognizes 2 adjacent spots, the microsequences of both spots
were previously determined and are very similar, identifying
two polypeptides encoded by members of the TMP4 gene
subfamily. The antisera were thus judged to be specific for the
sequences they were designed to recognize, and to constitute
subfamily-specific, if not polypeptide-specific, reagents.
The trichocyst crystalline matrix consists of two
concentric layers that contain different TMPs
Fig. 2 shows typical images of mature trichocysts labelled by
the different TMP antisera. Each of the antisera recognizes
every mature trichocyst in the cell. However, the antisera
recognize distinct regions of the trichocyst body matrix. The
anti-TMP2 and the anti-TMP4 sera recognize the same central
or ‘core’ region of the trichocyst in both longitudinal and crosssections, while the anti-TMP1 serum decorates the outer or
‘cortex’ layer, not recognized by the first two sera. We found,
using an HA (influenza haemagglutinin) epitope tag, that the
second mature polypeptide encoded by the TMP4a gene also
localizes to the core region (L. Vayssié and L. Sperling,
unpublished observations).
As a parallel control, we used antiserum 031 (cf. Materials
and Methods) that recognizes the whole set of TMPs and found
uniform staining of both the core and cortex regions of the
trichocyst body (not shown; see Fig. 2 in Garreau de Loubresse
et al., 1994). We note that the elaborate trichocyst tip (cf. Fig.
2), which serves to anchor the vesicle at exocytotic sites in the
plasma membrane, is not recognized by any of the available
antibodies (Fig. 2; Garreau de Loubresse, 1993; Garreau de
Loubresse et al., 1994).
880
JOURNAL OF CELL SCIENCE 114 (5)
The outer layer assembles once growth stops
Previous immunolocalization studies (Garreau de Loubresse,
1993; Garreau de Loubresse et al., 1994) showed that the TMPs
follow the classical secretory pathway. The earliest post-Golgi
vesicles have amorphous contents corresponding to TMP
proproteins, which are soluble molecules (Garreau de
Loubresse et al., 1994; Gautier et al., 1994). These vesicles
increase in volume by homotypic fusion events, which have
been documented by cryomicroscopy (Hausmann et al., 1988)
and by quick freezing-deep etching (Allen and Fok, 2000).
Once they are about 1 µm in size, crystallization begins. The
vesicles continue to increase in volume while the body matrix
crystallizes and attains an elongated shape. The tip assembles
last, as the body matrix finishes its crystallization.
In Fig. 3, the localization of the TMP1, TMP2 and TMP4
polypeptides are shown through different post-Golgi steps of
Fig. 3. Immunogold decoration of developing trichocysts using the sequence-specific antibodies. For each antisera, three developmental stages
are shown: post-Golgi immature granules with amorphous contents (A,D,G), vesicles in which crystallization (darker regions designated by
double arrows) has begun but which have not attained final volume (B,E,H) and a late stage of development showing an elongated crystal and
the appearance of the electron-dense material which marks the tip junction (tj), (C,F,I); these vesicles have attained their final volume although
crystallization is not yet complete and the tip has not assembled. Anti-TMP2 serum (A,B,C); anti-TMP4 serum (D,E,F) and anti-TMP1 serum
(G,H,I). The secondary antibody was goat anti-rabbit IgGs coupled to 10 nm colloidal gold particles. Bar, 250 nm.
Secretory granule biogenesis in Paramecium
881
Fig. 4. Immunolocalization images of tam38 trichocysts. These images were obtained with the anti-TMP2 (A), anti-TMP4 (B) and anti-TMP1
(C) antisera. Arrows, unassembled trichocyst tip material. Arrowhead, abortive tip assembly. The secondary antibodies were goat anti-rabbit
IgGs coupled to 10 nm gold particles. Bar, 250 nm.
trichocyst biogenesis. The smallest vesicles with amorphous
contents are decorated uniformly with each of the three
sequence-specific antisera. As soon as crystallization begins,
the TMP2 and TMP4 antigens are concentrated in the crystal
and the excluded TMP1 antigens in the surrounding amorphous
material. This pattern is maintained until the trichocysts attain
their final size, a stage at which electron dense material
becomes visible at one pole of the vesicle, where the tip will
assemble (tip junction, Fig. 3C,F and I). At this point, the core
assembly is complete, and the outer TMP1 containing layer
crystallizes. These images indicate that the two distinct layers
of TMPs found in mature trichocysts correspond to two
temporally distinct phases of growth.
This organization in two concentric layers of TMPs appears
to be quite robust. A number of secretory mutants have been
characterized in which trichocyst biogenesis is affected and the
resulting aberrantly shaped organelles are unable to attach to
the cortical exocytotic sites or be secreted. Fig. 4 shows
immunolocalization images for one such mutant, tam38, using
the specific antisera. The organization of the TMPs in two
Fig. 5. Morphological and immunogold images of mutant trichocysts created by gene silencing. Reduced expression of TMP4 subfamily genes
(A-D) yields trichocysts with spherical or ovoid forms. Morphological images show complete crystallization of the body matrix (tmx). The
trichocyst in A has an abortive tip (at) while the trichocyst in B has irregular contours suggesting multiple foci of crystallization and no tip at
all. Immunolocalization with the anti-TMP4 (C) and anti-TMP1 (D) antisera reveals TMP4 antigen in the round core surrounded by a thick
cortex layer containing TMP1 antigen. Reduced expression of TMP1 subfamily genes (E-G) yields sub-normal spindle-shaped trichocysts, with
a completely crystallized body matrix (tmx) as seen in the morphological image in E, but an abortive tip assembly (at). Immunolocalization
reveals an elongated core recognized by the anti-TMP4 antiserum (F) similar to the core of wild-type trichocysts, surrounded by a cortex layer
recognized by the anti-TMP1 antiserum (G). Bar, 250 nm.
882
JOURNAL OF CELL SCIENCE 114 (5)
concentric layers is conserved, however the inner layer fails to
elongate before the other layer assembles (cf. wild type, Fig.
3C,F and I), accounting for the ovoid form of these abortive
trichocysts. Amorphous material visible at the periphery of
some vesicles is not recognized by any of our antibodies (Fig.
4A and B and data not shown) and could correspond to tip
material which is unable to assemble (Fig. 4A and B, arrows).
Fig. 6. Double-label control. Images of developing trichocysts at a
stage where the crystalline core is just beginning to elongate.
(A) Immunocytochemistry was carried out with anti-TMP4 antibody
followed by Protein A-10 nm gold, then with anti-TMP1 antibody
followed by Protein A-15 nm gold. (B) Immuncytochemistry was
carried out as in A, except that the second anti-TMP1 antibody was
omitted before treatment with the Protein A-15 nm gold. Bar,
500 nm.
Gene silencing creates phenotypes consistent with
TMP immunolocalization
In Paramecium, the phenomenon of homology-dependent gene
silencing can be used to specifically reduce the expression of
the cellular homologues of a given gene (Ruiz et al., 1998; for
review see Bastin et al., 2001). Since the phenomenon is
homology dependent, similar genes can be silenced together,
as demonstrated for TMP gene subfamilies by quantification of
mRNA (Ruiz et al., 1998). Silencing is achieved by
microinjection at high copy number of the coding region of the
gene of interest into the somatic macronucleus. The silencing
effect is observed in the clonal descendants of the
microinjected cells throughout vegetative growth.
We previously reported that microinjection of the coding
region of either TMP1b or TMP4a led to specific reduction in
TMP1 or TMP4 subfamily mRNA and that the silenced cells
contained aberrantly shaped trichocysts that could not be
secreted. Immunofluorescence analysis of the silenced cells
showed that the form of the mutant trichocysts is different
depending upon which TMP subfamily was silenced,
suggesting that TMP1 and TMP4 polypeptides have different
roles in trichocyst biogenesis (Ruiz et al., 1998).
We have now further characterized the mutant trichocysts
in TMP1 and TMP4 silenced cells at the ultrastructural
level, using the sequence-specific antibodies. Fig. 5 shows
morphological and immunogold images of trichocysts in
TMP4 and TMP1 silenced cells. The trichocysts in TMP4
silenced cells are never elongated. Most (Fig. 5A) have round
or slightly ovoid cross-sections with a visible but highly
abortive tip. In a few cells (Fig. 5B) the trichocysts have
irregular contours suggesting multiple foci of crystallization
and no visible tip. Immunolocalization with the anti-TMP4
antibody (Fig. 5C) shows that, just as TMP4 mRNA is
reduced by ~75% but not completely abolished (Ruiz et al.,
1998), some TMP4 antigen is present in silenced cells. The
core assembly does begin as in wild type, but does not
progress to the point of elongation, probably because TMP4
polypeptides are in short supply. The TMP1-containing
cortex assembles around the misshapen core (Fig. 5D) and
most of the trichocysts contain tip material but the tip cannot
assemble. These phenotypes are completely consistent with
localization of TMP4 in the core region and demonstrate that
if the core cannot assemble correctly, cortex and tip are also
affected.
Analysis of trichocysts in TMP1 silenced cells completes the
picture (Fig. 5E-G). Within each silenced cell, all of the
trichocysts are elongated, however, they appear thinner, more
irregular and less rigid than wild-type trichocysts. A few
trichocysts have a functional tip assembly and are attached to
the cortex but most have an abortive tip (Fig. 5E) and remain
free in the cytoplasm. These images are consistent with
assembly of an elongated core as in wild type, as revealed by
the anti-TMP4 antibody (Fig. 5F), but an incomplete cortex
layer (Fig. 5F and G), presumably owing to reduced amounts
of TMP1 antigen in the cell. In the absence of a complete
cortex layer, the tip material present in the vesicles does not
usually form a functional tip. The anti-TMP2 antiserum (not
shown) decorates the same core region of the mutants as the
anti-TMP4 antiserum. Gene silencing thus primarily affects the
layer of the trichocyst matrix that contains the products of the
silenced genes. These results underscore the fact that the
Secretory granule biogenesis in Paramecium
883
Fig. 7. Co-localization of core and cortex TMPs in condensing secretory vesicles. (A) Conventional Epon embedded thin section showing a
typical Golgi complex, consisting of a single layer of thickly coated transitional vesicles (tv) between rough endoplasmic reticulum (ER) and
the Golgi stack (G). A coated vesicle (arrowhead) is seen budding from the trans face of the Golgi. The two irregular, uncoated vesicles with
amorphous contents are condensing secretory vesicles (sv). (B-J) Post-embedding immunogold double-labelling of secretory vesicles.
Immunocytochemistry was carried out with the anti-TMP4 antibody followed by Protein A-10 nm gold, then with the anti-TMP1 antibody
followed by Protein A-15 nm gold. In some of the images, a still identifiable Golgi complex (GC) or coated vesicles (arrowheads) indicate that
the small TMP-containing vesicles are close to Golgi. Bar, 250 nm.
different TMPs have different morphogenetic roles in
trichocyst assembly.
TMPs are not differentially sorted
The Paramecium Golgi apparatus is fragmented into
dictyosomes (Estève, 1972; for review see Allen and Fok,
2000) and the trans compartment buds coated vesicles which
may correspond to the ~75 nm clathrin coated vesicles
containing acid phosphatase identified previously (Fok et al.,
1984) as primary lysosomes. Other small irregular vesicles,
apparently uncoated, are often found in close vicinity to the
trans compartment. These vesicles contain amorphous dense
material and represent the first step of TMP condensation
(Garreau de Loubresse, 1993). These structures are shown in
Fig. 7a by conventional Epon embedding. The clathrin coated
vesicle budding from the Golgi indicates the polarity of the
stack and two uncoated secretory vesicles, recognizable by
their relatively dense, amorphous contents, lie in the vicinity
of the trans compartment.
Since mature trichocysts several microns in size develop
from such small TMP-containing vesicles, it is possible that
‘core’ TMPs are sorted away from ‘cortex’ TMPs as the
proteins exit the Golgi complex, and that this sorting followed
by specific vesicle fusion controls the order of TMP assembly.
To look for differential sorting, we first examined all
identifiable small secretory vesicles in immunolocalization
experiments with each of the three sequence-specific
antibodies. If core and cortex TMPs are differentially sorted,
we would expect to see some unlabeled vesicles. Examination
of thin sections of hundreds of different cells for each antibody
indicated that all morphologically recognizable vesicles were
decorated with gold particles (data not shown), strongly
arguing that each antigen is found in every small condensing
vesicle.
In order to obtain more direct evidence that the small postGolgi vesicles contain mixtures of core and cortex TMPs, we
performed double-label experiments (see Materials and
Methods) using the anti-TMP1 and anti-TMP4 antisera. Thin
884
JOURNAL OF CELL SCIENCE 114 (5)
expression of three TMP mature polypeptides with different
primary structures. The polypeptides were used to obtain
sequence-specific rabbit antisera. Immunolocalization
experiments with the antisera have allowed us to evaluate the
way in which the protein heterogeneity generated by the TMP
multigene family is used to build the crystalline matrix of
Paramecium secretory granules.
Fig. 8. The cleavage site at the junction of the basic region and the
second mature polypeptide may participate in discrimination of core
and cortex TMPs. (A) Alignment of the core TMPs, TMP2c and
TMP4a with Tetrahymena Grl1p and Grl4p sequences indicating the
probable cleavage site for liberation of the 2nd mature polypeptide.
(B) Alignment of the cortex TMP, TMP1b and the Tetrahymena
Grl3p sequences in the same region. The amino acid in the pink box
indicates the beginning of an experimentally determined short Nterminal sequence not used to clone TMP4a (Le Caer and Sperling,
unpublished data). The amino acids in yellow boxes indicate the
beginning of experimentally determined N-terminal sequences that
were used to clone the respective genes. The N-termini in yellow are
thus certain, and the one in pink is probable. The cleavage site
proposed for TMP2c is based uniquely on the alignment with the
other sequences. Conserved amino acids are indicated in red boxes
for the 4 sequences in A and by asterisks for the two sequences in B.
Tetrahymena data is from Verbsky and Turkewitz (Verbsky and
Turkewitz, 1998).
sections were first incubated with anti-TMP4 serum and then
Protein A-10 nm gold. After destruction of the epitope
recognized by the Protein A using glutaraldehyde, the sections
were incubated with anti-TMP1 serum and then Protein A-15
nm gold. As a control for the method, we evaluated images of
mature and developing wild-type trichocysts obtained either
including or omitting the 2nd antibody directed against TMP1.
Typical control images are shown in Fig. 6: each antibody
decorates the same region of developing (Fig. 6A) and mature
(not shown) trichocysts as in single label experiments.
Furthermore, in the absence of the 2nd antibody, there is no
indication of ‘clustering’ of the Protein A-15 nm gold near the
1st antibody-gold complexes (Fig. 6B).
Double-labelling in the region of Golgi complexes is shown
in Fig. 7. Paramecium Golgi is not preserved by the LR White
post-embedding protocol used for immunocytochemistry, in
fact these delicate membranes are poorly preserved even
in cryosections as discussed (Hausmann et al., 1988).
Nonetheless, the presence in some images of a still
recognizable Golgi complex (Fig. 7B and C), or of coated
vesicles (Fig. 7C,E,H,I,J), indicates that the small vesicles
labelled by the anti-TMP antibodies are close to Golgi. All of
the small vesicles that we observed contained both sizes of gold
label, attesting to the presence of both antigens. The systematic
co-localization of core and cortex TMPs, even in small postGolgi vesicles, provides good indication that TMP proproteins
are not differentially sorted but travel as a mixture through the
compartments of the biosynthetic pathway to immature
secretory granules where the proprotein conversion will occur.
DISCUSSION
We have designed synthetic genes that direct bacterial
Two layers
Each antiserum decorates one or the other of two distinct, nonoverlapping concentric regions of the spindle-shaped
crystalline matrix: the central ‘core’ or the peripheral ‘cortex’.
Examination of trichocysts at different stages of biogenesis
showed that crystallization of the core, which is first spherical
and then elongates, occurs while the vesicles grow to their final
size. The end of this phase of growth is marked by appearance
of the electron dense tip junction underneath the vesicle
membrane, anchored to the wide end of the growing crystal.
Crystallization of the cortex then occurs and the trichocyst tip
assembles last. These results were independently confirmed
with genetic experiments. Examination of mutant trichocysts
created by gene silencing, which reduces the expression only
of the targeted TMP gene subfamily, showed that the layer of
the trichocyst matrix containing the products of the silenced
genes was specifically affected.
The organization of the trichocyst matrix in antigenically
distinct core and cortex regions was previously reported by Fok
and colleagues (Fok et al., 1988; Hausmann et al., 1988) and
by Shih and Nelson (Shih and Nelson, 1991) based on
immunolocalization experiments with monoclonal antibodies
that recognize subsets of TMPs. These studies, carried out
before any knowledge of the primary structure of TMPs or of
the organization and expression of the TMP multigene family
was available, are consistent with the data presented here.
Core and cortex TMPs are present in the same
immature granules
How is assembly of the TMPs in two distinct layers controlled?
Since the inner layer assembles while the vesicles are increasing
in volume, one possibility is that specific sorting of TMPs
delivers them to the growing trichocyst in an ordered fashion.
It is now generally accepted that sorting of newly
synthesized lumenal and membrane proteins can occur both in
the TGN and in immature secretory granules. The aggregative
properties of granule proteins constitute most or all of the
information for their sorting to granules (Chanat and Huttner,
1991), be it ‘sorting for entry’ upon exit from the TGN or
‘sorting by retention’ in the maturing granules (Kuliawat and
Arvan, 1994; reviewed by Arvan and Castle, 1998). We have
previously argued (Garreau de Loubresse et al., 1994) that
TMP precursors, which are soluble molecules, are delivered to
post-Golgi vesicles with the bulk flow and only remain in the
regulated compartment if processed to mature polypeptides,
consistent with ‘sorting by retention’. Our evidence was based
on genetic as well as morphological data. In particular, cells of
the mutant trichless contain no trichocysts at all, but do
synthesize TMP precursor molecules, which localize to small
post-Golgi vesicles with amorphous contents. The precursors
cannot be processed to mature polypeptides owing to the
mutation, and they are constitutively secreted into the culture
medium (Gautier et al., 1994).
Secretory granule biogenesis in Paramecium
We have presented here two lines of evidence that TMPcontaining vesicles enclose both TMP1 and TMP4
polypeptides. First, examination of hundreds of cells in singlelabel experiments failed to reveal any unlabeled vesicles.
Second, double-label experiments directly show colocalization
in the same small vesicles of TMP4 (core) and TMP1 (cortex)
polypeptides. Our data are thus consistent with bulk flow of
soluble lumenal proteins, including all the TMPs, into postGolgi vesicles upon exit from the Golgi apparatus. We
conclude that sequential delivery of core then cortex TMPs to
developing trichocysts is extremely unlikely and cannot
account for the ordered assembly of the TMPs.
It remains possible that the antigenically distinct and as yet
uncharacterized trichocyst tip polypeptides are sorted into
distinct vesicles, as in the ciliate Pseudomicrothorax dubious.
This ciliate produces trichocysts consisting of a crystalline
‘shaft’ equivalent to the Paramecium body matrix surmounted
by four ‘arms’ which have the same anchorage function as the
Paramecium trichocyst tip. Peck et al. have shown that the arm
material, which is electron dense, and the shaft material for
which they obtained specific antibodies, are sorted into distinct
post-Golgi vesicles as they exit the TGN (Peck et al., 1993).
These vesicles fuse with the developing trichocysts. The
electron dense arm material remains at the periphery of the
growing trichocysts and does not assemble until the shaft
crystallization is complete.
Protein processing controls TMP assembly
We propose that in Paramecium, TMP processing controls
trichocyst matrix assembly. Our model involves two
hypotheses, first of all that TMPs crystallize as soon as they
are processed, and second that TMPs are in competition for the
same processing enzyme(s). The core TMPs compete more
successfully and are thus converted at a greater rate than the
cortex TMPs.
That TMPs crystallize as soon as they are processed implies
that the amorphous regions of developing trichocysts consist
of TMP precursors while the crystalline regions consist of
mature polypeptides. Shih and Nelson provided direct
experimental evidence that this is indeed the case (Shih and
Nelson, 1992). Antibodies specific for TMP precursor
molecules were prepared. In immunolocalization experiments,
these antibodies recognized only the amorphous regions of
developing trichocysts, allowing the authors to conclude that
proteolytic processing occurs in parallel with crystallization.
The second hypothesis is that core TMPs are better
substrates for the processing enzyme(s) than cortex TMPs.
This implies that all TMPs are converted by the same
enzyme(s) and that core TMP precursors (such as TMP2 and
TMP4) are converted more rapidly than cortex TMP precursors
(such as TMP1). Support for this hypothesis is provided by
examination of the TMP sequences (Fig. 8). Sequence analysis
previously indicated that Paramecium TMPs and Tetrahymena
Grlps are homologous proteins, and that the as yet
uncharacterized processing enzymes may be the same in both
ciliates given the good conservation of the cleavage sites
(Verbsky and Turkewitz, 1998). It may therefore be significant
that the deduced amino acid sequences at the putative cleavage
site N-terminal to the second mature polypeptide is nearly
identical for the ‘core’ proteins TMP2c and TMP4a and closely
resembles cleavage sites of Tetrahymena Grl1p and Grl4p (Fig.
885
8A). The cleavage site of the ‘cortex’ protein TMP1b is
different from these but nearly identical to the cleavage site of
Tetrahymena Grl3p (Fig. 8B) as previously noted (Verbsky and
Turkewitz, 1998). These sites do not fit the consensus for the
kexin/prohormone convertase family of processing enzymes
conserved from yeast to mammals (Seidah et al., 1999). Some
additional support for the substrate competition hypothesis
comes from 2D analysis of TMP pulse-chase experiments.
Despite limited temporal resolution owing to the fact that the
experiments involved feeding paramecia with metabolically
labelled bacteria and chasing with cold bacteria, different
precursors are processed at different chase times (Gautier et al.,
1996).
We therefore propose that all TMPs are delivered together
to post-Golgi vesicles which incorporate into developing
trichocysts by homotypic fusion events. Throughout growth
to the final volume, the developing trichocysts are thus
continually supplied with a stoichiometric mixture of
precursors. As long as core TMP precursors are present, they
will successfully compete for the processing machinery and
be preferentially converted to mature polypeptides, which
assemble as soon as they are produced. The core TMPs might
have higher affinity constants than the cortex TMPs for an
endoprotease with a low Km, like the prohormone convertases
of multicellular organisms (for reviews see Steiner, 1998; Zhou
et al., 1999). The phase during which the trichocyst grows in
volume thus corresponds to the period during which the core
crystallizes.
The appearance of the tip junction (cf. Fig. 2A, Fig. 3C,F,I)
marks the transition to a second growth phase during which
TMP-bearing vesicles no longer fuse with the developing
trichocyst which has attained its final volume. As no more
TMPs enter the vesicles, the processing machinery runs out of
its preferred substrate, the core TMPs, whose conversion and
parallel crystallization go to completion. The cortex TMP
precursors, despite the postulated lower affinity for the
enzyme, can now be processed and crystallize.
This simple model, involving only substrate competition for
processing enzymes, cannot explain the sharp boundary
between the core and cortex regions. It would predict a fuzzy
boundary with a concentration gradient of TMPs between
the two layers. However, the gene silencing experiments
dramatically demonstrate that TMPs belonging to different
subfamilies are not interchangeable. Without entering into the
details of how TMPs might assemble and be packed in the
crystal lattice of the trichocyst matrix (Sperling et al., 1987),
this is formally equivalent to saying that ‘core’ and ‘cortex’
TMPs cannot co-crystallize. Our model can thus account for
the organization of the trichocyst matrix in two concentric
crystalline layers. It also illustrates a strategy for the modular
construction of a complex edifice within a membrane bound
compartment that could be of general relevance. The successful
completion of each part of the final structure is only achieved
if the previous part, upon which it builds, has assembled
correctly.
We are grateful to Claude Antony for useful advice and help with
the double-label experiments. We thank Janine Beisson, Jean Cohen
and Carl Creutz for critical reading of the manuscript. This work was
supported by the CNRS (Cell Biology Program, grant 9064) and the
Microbiology Program of the Ministère de l’Education Nationale, de
la Recherche et de la Technologie (Programme de Recherche
886
JOURNAL OF CELL SCIENCE 114 (5)
Fondamentale en Microbiologie et Maladies Infectieuses et
Parasitaires). LV was supported by a fellowship from the Association
pour la Recherche contre le Cancer (ARC) and by the Association
Française contre les Myopathies (AFM).
REFERENCES
Adoutte, A., Garreau de Loubresse, N. and Beisson, J. (1984). Proteolytic
cleavage and maturation of the crystalline secretion products of
Paramecium. J. Mol. Biol. 180, 1065-1081.
Allen, R. D. and Fok, A. K. (2000). Membrane trafficking and processing in
Paramecium. Int. Rev. Cytol. 198, 277-318.
Arvan, P. and Castle, D. (1998). Sorting and storage during secretory granule
biogenesis: looking backward and looking forward. Biochem. J. 332, 593610.
Bastin, P., Galvani, A. and Sperling, L. (2001). Genetic interference in
protozoa. Res. Microbiol. (in press).
Bendayan, M. (1989). Ultrastructural localization of insulin and C-peptide
antigenic sites in rat pancreatic B cell obtained by applying the quantitative
high-resolution Protein A-gold approach. Am. J. Anat. 185, 205-216.
Chanat, E. and Huttner, W. B. (1991). Milieu-induced, selective aggregation
of regulated secretory proteins in the trans-Golgi network. J. Cell Biol. 115,
1505-1519.
Chilcoat, N. D., Melia, S. M., Haddad, A. and Turkewitz, A. P. (1996).
Granule lattice protein 1 (Grl1p), an acidic, calcium-binding protein in
Tetrahymena thermophila dense-core secretory granules, influences granule
size, shape, content organization, and release but not protein sorting or
condensation. J. Cell Biol. 135, 1775-1787.
Dillon, P. J. and Rosen, C. A. (1993). Use of polymerase chain reaction for
the rapid construction of synthetic genes. Meth. Mol. Biol. 15, 263-269.
Estève, J. C. (1972). L’appareil de Golgi des ciliés. Ultrastructure,
particulièrement chez Paramecium. J. Protozool. 19, 609-618.
Fok, A. K., Muraoka, J. H. and Allen, R. D. (1984). Acid phosphatase in
the digestive vacuoles and lysosomes of Paramecium caudatum: A timed
study. J. Protozool. 31, 216-220.
Fok, A. K., Olegario, R. P., Ueno, M. S. and Allen, R. D. (1988).
Characterization of monoclonal antibodies to trichocyst antigens in
Paramecium. J. Cell Sci. 91, 191-199.
Galvani, A. and Sperling, L. (2000). Regulation of secretory protein gene
expression in Paramecium. Role of the cortical exocytotic sites. Eur. J.
Biochem. 267, 3226-3234.
Garreau de Loubresse, N. (1993). Early steps of the secretory pathway in
Paramecium: ultrastructural, immunocytochemical and genetic analysis of
trichocyst biogenesis. In Membrane Traffic in Protozoa (ed. H. Plattner), pp.
27-59. Greenwich (Conn. ), USA. : JAI Press Inc.
Garreau de Loubresse, N., Gautier, M. -C. and Sperling, L. (1994).
Immature secretory granules are not acidic in Paramecium: implications for
sorting to the regulated pathway. Biol. Cell 82, 139-147.
Gautier, M. C., Garreau de Loubresse, N., Madeddu, L. and Sperling, L.
(1994). Evidence for defects in membrane traffic in Paramecium secretory
mutants unable to produce functional storage granules. J. Cell Biol. 124,
893-902.
Gautier, M. C., Sperling, L. and Madeddu L. (1996). Cloning and sequence
analysis of genes coding for Paramecium secretory granule (trichocyst)
proteins. A unique protein fold for a family of polypeptides with different
primary structures. J. Biol. Chem. 271, 10247-10255.
Halban, P. A. and Irminger, J. C. (1994). Sorting and processing of secretory
proteins. Biochem. J. 299, 1-18.
Harumoto, T. and Miyake, A. (1991). Defensive function of trichocysts in
Paramecium. J. Exp. Zool. 260, 84-92.
Hausmann, K. (1978). Extrusive organelles in protists. Int. Rev. Cytol. 52,
197-276.
Hausmann, K., Fok, A. K. and Allen, R. D. (1988). Immunocytochemical
analysis of trichocyst structure in Paramecium. J. Ultrastruct. Mol. Res 99,
213-225.
Kuliawat, R. and Arvan, P. (1994). Distinct molecular mechanisms for
protein sorting within immature secretory granules of pancreatic beta-cells.
J. Cell Biol. 126, 77-86.
Madeddu, L., Gautier, M. C., Le Caer, J. P., Garreau de Loubresse, N.
and Sperling, L. (1994). Protein processing and morphogenesis of secretory
granules in Paramecium. Biochimie 76, 329-335.
Madeddu, L., Gautier, M. C., Vayssié, L., Houari, A. and Sperling, L.
(1995). A large multigene family codes for the polypeptides of the
crystalline trichocyst matrix in Paramecium. Mol. Biol. Cell 6, 649-659.
Michael, J., Carroll, R., Swift, H. H. and Steiner, D. F. (1987). Studies on
the molecular organization of rat insulin secretory granules. J. Biol. Chem.
262, 16531-16535.
Momayezi, M., Habermann, A. W., Sokolova, J. J., Kissmehl, R. and
Plattner, H. (1993). Ultrastructural and antigenic preservation of a delicate
structure by cryopreparation: identification and immunogold localization
during biogenesis of a secretory component (membrane-matrix connection)
in Paramecium trichocysts. J. Histochem. Cytochem. 41, 1669-1677.
Orci, L., Ravazzola, M., Storch, M. J., Anderson, R. G., Vassalli, J. D. and
Perrelet, A. (1987). Proteolytic maturation of insulin is a post-Golgi event
which occurs in acidifying clathrin-coated secretory vesicles. Cell 49, 865868.
Orias, E., Flacks, M. and Satir, B. H. (1983). Isolation and ultrastructural
characterization of secretory mutants of Tetrahymena thermophila. J. Cell
Sci. 64, 49-67.
Peck, R. K., Swiderski, B. and Tourmel, A. M. (1993). Secretory organelle
biogenesis: trichocyst formation in a ciliated protozoan. Biol. Cell 77, 277287.
Pollack, S. (1974). Mutations affecting the trichocysts in Paramecium
aurelia. I. Morphology and description of the mutants. J. Protozool. 21,
352-362.
Ruiz, F., Adoutte, A., Rossignol, M. and Beisson, J. (1976). Genetic analysis
of morphogenetic processes in Paramecium. I. A mutation affecting
trichocyst formation and nuclear division. Genet. Res. 27, 109-122.
Ruiz, F., Vayssié, L., Klotz, C., Sperling, L. and Madeddu, L. (1998).
Homology-dependent gene silencing in Paramecium. Mol. Biol. Cell 9, 931943.
Schmidt, K., Dartsch, H., Linder, D., Kern, H. F. and Kleene, R. (2000). A
submembranous matrix of proteoglycans on zymogen granule membranes
is involved in granule formation in rat pancreatic acinar cells. J. Cell Sci.
113, 2233-2242.
Seidah, N. G., Benjannet, S., Hamelin, J., Mamarbachi, A. M., Basak, A.,
Marcinkiewicz, J., Mbikay, M., Chretien, M. and Marcinkiewicz, M.
(1999). The subtilisin/kexin family of precursor convertases. Emphasis on
PC1, PC2/7B2, POMC and the novel enzyme SKI-1. Ann. NY Acad. Sci.
885, 57-74.
Shih, S. J. and Nelson, D. L. (1991). Multiple families of proteins in the
secretory granules of Paramecium tetraurelia: immunological
characterization and immunocytochemical localization of trichocyst
proteins. J. Cell Sci. 100, 85-97.
Shih, S. J. and Nelson, D. L. (1992). Proteolytic processing of secretory
proteins in Paramecium: immunological and biochemical characterization
of the precursors of trichocyst matrix proteins. J. Cell Sci. 103, 349-361.
Slot, J. W., Geuze, H. J., Gigengack, S., Lienhard, G. E. and James, D. E.
(1991). Immuno-localization of the insulin regulatable glucose transporter
in brown adipose tissue of the rat. J. Cell Biol. 113, 123-135.
Sonneborn, T. M. (1974). Paramecium aurelia. In Handbook of genetics (ed.
R. King), pp. 469-594. New York: Plenum Publishing Corp.
Sperling, L., Tardieu, A. and Gulik-Krzywicki, T. (1987). The crystal lattice
of Paramecium trichocysts before and after exocytosis by X-ray diffraction
and freeze-fracture electron microscopy. J. Cell Biol. 105, 1649-1662.
Steiner, D. F. (1998). The proprotein convertases. Curr. Opin. Chem. Biol. 2,
31-39.
Thiele, C. and Huttner, W. B. (1998). Protein and lipid sorting from the transGolgi network to secretory granules-recent developments. Semin. Cell Dev.
Biol. 9, 511-516.
Tooze, S. A. (1998). Biogenesis of secretory granules in the trans-Golgi
network of neuroendocrine and endocrine cells. Biochim. Biophys. Acta
1404, 231-244.
Turkewitz, A. P., Madeddu, L. and Kelly, R. B. (1991). Maturation of dense
core granules in wild type and mutant Tetrahymena thermophila. EMBO J.
10, 1979-1987.
Vayssié, L., Skouri, F., Sperling, L. and Cohen, J. (2000). Molecular
genetics of regulated secretion in Paramecium. Biochimie 82, 269-288.
Verbsky, J. W. and Turkewitz, A. P. (1998). Proteolytic processing and Ca2+binding activity of dense-core vesicle polypeptides in Tetrahymena. Mol.
Biol. Cell 9, 497-511.
Wagner, D. D., Saffaripour, S., Bonfanti, R., Sadler, J. E., Cramer, E. M.,
Chapman, B. and Mayadas, T. N. (1991). Induction of specific storage
organelles by von Willebrand factor propolypeptide. Cell 64, 403-413.
Zhou, A., Webb, G., Zhu, X. and Steiner, D. F. (1999). Proteolytic processing
in the secretory pathway. J. Biol. Chem. 274, 20745-20748.