THE JOURNAL OF BIOLOGICAL CHEMISTRY
© 1998 by The American Society for Biochemistry and Molecular Biology, Inc.
Vol. 273, No. 30, Issue of July 24, pp. 18992–19001, 1998
Printed in U.S.A.
Effect of CTP Synthetase Regulation by CTP on Phospholipid
Synthesis in Saccharomyces cerevisiae*
(Received for publication, April 27, 1998, and in revised form, May 14, 1998)
Darin B. Ostrander‡, Daniel J. O’Brien‡, Jessica A. Gorman§, and George M. Carman‡¶
From the ‡Department of Food Science, Cook College, New Jersey Agricultural Experiment Station, Rutgers University,
New Brunswick, New Jersey 08901 and the §Department of Microbial Molecular Biology, Pharmaceutical Research
Institute, Bristol-Myers Squibb, Princeton, New Jersey 08543
CTP synthetase (EC 6.3.4.2, UTP:ammonia ligase
(ADP-forming)) activity in Saccharomyces cerevisiae is
allosterically regulated by CTP product inhibition.
Amino acid residue Glu161 in the URA7-encoded and
URA8-encoded CTP synthetases was identified as being
involved in the regulation of these enzymes by CTP
product inhibition. The specific activities of the URA7encoded and URA8-encoded enzymes with a Glu161 3
Lys (E161K) mutation were 2-fold greater when compared with the wild-type enzymes. The E161K mutant
URA7-encoded and URA8-encoded CTP synthetases
were less sensitive to CTP product inhibition with inhibitor constants for CTP of 8.4- and 5-fold greater, respectively, than those of their wild-type counterparts.
Cells expressing the E161K mutant enzymes on a multicopy plasmid exhibited an increase in resistance to the
pyrimidine poison and cancer therapeutic drug cyclopentenylcytosine and accumulated elevated (6 –15-fold)
levels of CTP when compared with cells expressing the
wild-type enzymes. Cells expressing the E161K mutation
in the URA7-encoded CTP synthetase exhibited an increase (1.5-fold) in the utilization of the Kennedy pathway for phosphatidylcholine synthesis when compared
with control cells. Cells bearing the mutation also exhibited an increase in the synthesis of phosphatidylcholine
(1.5-fold), phosphatidylethanolamine (1.3-fold), and
phosphatidate (2-fold) and a decrease in the synthesis of
phosphatidylserine (1.7-fold). These alterations were accompanied by an inositol excretion phenotype due to
the misregulation of the INO1 gene. Moreover, cells
bearing the E161K mutation exhibited an increase (1.6fold) in the ratio of total neutral lipids to phospholipids,
an increase in triacylglycerol (1.4-fold), free fatty acids
(1.7-fold), and ergosterol ester (1.8-fold), and a decrease
in diacylglycerol (1.3-fold) when compared with control
cells. These data indicated that the regulation of CTP
synthetase activity by CTP plays an important role in
the regulation of phospholipid synthesis.
CTP synthetase (EC 6.3.4.2, UTP:ammonia ligase (ADPforming)) is a cytosolic-associated glutamine amidotransferase
* The costs of publication of this article were defrayed in part by the
payment of page charges. This article must therefore be hereby marked
“advertisement” in accordance with 18 U.S.C. Section 1734 solely to
indicate this fact. This work was supported in part by U. S. Public
Health Service, National Institutes of Health Grant GM-50679 (to
G. M. C.). This is New Jersey Agricultural Experiment Station Publication D-10581-2-98.
¶ To whom correspondence and reprint requests should be addressed:
Dept. of Food Science, Cook College, New Jersey Agricultural Experiment Station, Rutgers University, 65 Dudley Rd., New Brunswick, NJ
08901. Tel.: 732-932-9611 (ext. 217); Fax: 732-932-6776; E-mail:
[email protected].
that catalyzes the ATP-dependent transfer of the amide nitrogen from glutamine to the C-4 position of UTP to form CTP (1,
2). This enzyme plays an essential role in the synthesis of all
membrane phospholipids in eukaryotic cells (3, 4). Its reaction
product CTP is the direct precursor of the activated, energyrich phospholipid pathway intermediates CDP-DG1 (5), CDPcholine (6), and CDP-ethanolamine (6) (Fig. 1). CDP-DG is the
source of the phosphatidyl moiety of PS, PE, and PC synthesized by the CDP-DG pathway as well as PI, phosphatidylglycerol, and cardiolipin (3, 4). CDP-choline and CDP-ethanolamine are the sources of the hydrophilic head groups of PC and
PE synthesized by the Kennedy pathways, respectively (3, 4).
Our laboratory utilizes the yeast Saccharomyces cerevisiae as a
model eukaryote to study the regulation of CTP synthetase and
its impact on phospholipid metabolism.
CTP synthetase is encoded by the URA7 (7) and URA8 (8)
genes in S. cerevisiae. Neither gene is essential provided that
cells possess one functional gene encoding the enzyme (7, 8).
Phenotypic analysis of ura7D and ura8D mutants (8) and the
biochemical characterization of purified preparations of the
URA7-encoded (9) and URA8-encoded (10) enzymes have
shown that the two CTP synthetases are not functionally identical. Moreover, the URA7-encoded enzyme is more abundant
than the URA8-encoded enzyme (11) and is responsible for the
majority of the CTP synthesized in vivo (8). The overexpression
of the URA7-encoded CTP synthetase causes a 2-fold increase
in the utilization of the Kennedy pathway for PC synthesis (11).
This has been attributed to an increase in the substrate availability of CTP for the phosphocholine cytidylyltransferase reaction in the Kennedy pathway and the inhibition of PS synthase activity by CTP in the CDP-DG pathway (11).
The URA7-encoded (9) and URA8-encoded (10) CTP synthetases are allosterically regulated by CTP product inhibition.
CTP inhibits activity by increasing the positive cooperativity of
these enzymes for UTP (9, 10). This regulation controls the
cellular concentration of CTP in growing S. cerevisiae cells (7,
9, 11). In mammalian cells, inhibition of CTP synthetase by
CTP plays an important role in the balance of the pyrimidine
nucleoside triphosphate pools (12). A number of mammalian
mutant cell lines possess CTP synthetase activity which is
insensitive to inhibition by CTP. As a result, these cell lines
display complex phenotypes which include increased intracellular pools of CTP and dCTP (13, 14), resistance to nucleotide
analog drugs used in cancer chemotherapy (15–18), and an
increased rate of spontaneous mutations (14 –16). In addition,
elevated CTP synthetase activity is a common property of leukemic cells (19) and rapidly growing tumors found in liver (20),
1
The abbreviations used are: CDP-DG, CDP-diacylglycerol; CPEC,
cyclopentenylcytosine; PA, phosphatidate; PC, phosphatidylcholine;
PCR, polymerase chain reaction; PE, phosphatidylethanolamine; PI,
phosphatidylinositol; PS, phosphatidylserine.
18992
This paper is available on line at http://www.jbc.org
Regulation of Phospholipid Synthesis
FIG. 1. Pathways for the biosynthesis of phospholipids in S.
cerevisiae. The pathways shown for the biosynthesis of phospholipids
include the relevant steps discussed in the text. The CDP-DG pathway
is indicated by the boxed area. A more comprehensive phospholipid
biosynthetic pathway which includes the intermediate steps in the
pathway may be found in Ref. 53. The abbreviations used are: CDP-DG,
CDP-diacylglycerol; CDP-Etn, CDP-ethanolamine; CDP-Cho, CDP-choline; PS, phosphatidylserine; PE, phosphatidylethanolamine; PC, phosphatidylcholine; PG, phosphatidylglycerol; CL, cardiolipin; PI, phosphatidylinositol; SL, sphingolipids; PIPs, phosphoinositides; PA,
phosphatidate; DG, diacylglycerol; TG, triacylglycerol.
colon (21), and lung (22). These findings underscore the importance of studies to understand the regulation of CTP synthetase activity by CTP product inhibition.
In this work we identified amino acid residue Glu161 in the
URA7-encoded and URA8-encoded CTP synthetases to be involved in CTP product inhibition of the enzyme. Cells carrying
a Glu161 3 Lys (E161K) mutation in the CTP synthetases
exhibited increased resistance to the pyrimidine poison and
cancer therapeutic drug CPEC (23, 24) and accumulated high
levels of CTP. The E161K mutation in the URA7-encoded CTP
synthetase caused alterations in the synthesis of phospholipids
by the CDP-DG and Kennedy pathways and in the proportional
synthesis of phospholipids and neutral lipids.
EXPERIMENTAL PROCEDURES
Materials
Growth medium supplies were purchased from Difco. Restriction
endonucleases, modifying enzymes, and recombinant Vent DNA polymerase with 59- and 39-exonuclease activity and the DNA size ladder used
for agarose gel electrophoresis were purchased from New England
Biolabs. PCR and sequencing primers were prepared commercially by
Genosys Biotechnologies, Inc. The Prism DyeDeoxy DNA sequencing
kit was obtained from Applied Biosystems. Avian myeloblastosis virus
reverse transcriptase was purchased from Life Technologies, Inc. Nucleotides, choline, phosphocholine, CDP-choline, 5-fluoroorotic acid, and
bovine serum albumin were purchased from Sigma. The b-galactosidase
activity kit was from CLONTECH. Protein assay reagent, electrophoresis reagents, and immunochemical reagents were purchased from BioRad. Lipids were purchased from Avanti Polar Lipids and Sigma. Radiochemicals and EN3HANCE were purchased from NEN Life Science
Products. Scintillation counting supplies were from National Diagnostics. High performance thin layer chromatography and Silica Gel 60
thin layer chromatography plates were from EM Science. CPEC was a
gift from Grant M. Hatch (University of Manitoba, Canada).
Methods
Strains, Plasmids, Oligonucleotides, and Growth Conditions—The
strains, plasmids, and oligonucleotides used in this work are listed in
Tables I, II, and III respectively. Methods for growth and analysis of
yeast were performed as described previously (25, 26). Yeast cultures
were grown in YEPD medium (1% yeast extract, 2% peptone, 2% glucose) or in complete synthetic medium minus inositol (27) containing 2%
glucose at 30 °C. The appropriate amino acid of complete synthetic
medium was omitted for selection purposes, and inositol (50 mM) was
added to the growth medium where indicated. Escherichia coli strain
HB 101 was grown in LB medium (1% tryptone, 0.5% yeast extract, 1%
NaCl, pH 7.4) at 37 °C. Ampicillin (100 mg/ml) was added to cultures of
18993
HB 101 carrying plasmids. Media were supplemented with either 2%
(yeast) or 1.5% (E. coli) agar for growth on plates. Yeast cell numbers in
liquid media were determined spectrophotometrically at an absorbance
of 540 nm. The sensitivity of yeast strains to CPEC (10 mg) was determined by a standard radial diffusion assay. The Opi (over production of
inositol) phenotype (28) of yeast strains was examined on complete
synthetic medium (minus inositol) by using growth of an inositol auxotrophic indicator strain MC13 (ino1) (27) as described by McGee et al.
(29).
DNA Manipulations, Amplification of DNA by PCR, DNA Sequencing, and Quantitative Reverse Transcriptase-PCR—Plasmid maintenance and amplifications were performed in E. coli strain HB 101.
Plasmid and genomic DNA preparation, restriction enzyme digestion,
and DNA ligations were performed by standard methods (26). Transformation of yeast (30, 31) and E. coli (26) was performed as described
previously. Conditions for the amplification of DNA by PCR were optimized as described previously (32). The annealing temperature for
PCRs was 52 °C, and extension time was 1 min at 72 °C. PCRs were
routinely run for a total of 35 cycles. DNA sequencing reactions were
performed with the Prism DyeDeoxy Terminator Cycle sequencing kit
and analyzed with an automated DNA sequencer. Total RNA was
extracted from cells (33), converted to cDNA by treatment with reverse
transcriptase, and then amplified by PCR (34). The primers used for
URA7 mRNA (Ura7-A and Ura7-B) produced a 1.7-kb product, and the
primers used for URA8 mRNA (Ura8-A and Ura8-B) produced a 0.87-kb
product.
Construction of Plasmids—In order to construct a URA8 disruption
vector, the 59 (primers Ura8-C and Ura8-D) and 39 (primers Ura8-E and
Ura8-F) noncoding regions of the URA8 gene were isolated by PCR
using DNA from strain W303-1A as the template. These fragments
were digested with BglII and EcoRI and with BamHI and SalI, respectively, and ligated into plasmid pNKY51 to form plasmid pDO183. In
order to construct a URA7 expression vector, a 2.49-kb fragment containing the URA7 gene was released from plasmid pFL44S-URA7 by
digestion with BamHI and PstI. This fragment was ligated into plasmid
YEpLac195 that was digested with the same restriction enzymes to
form plasmid pDO134. In order to construct a URA7 disruption vector,
a 1.4-kb DNA fragment containing the URA7D::TRP1 allele (7) was
obtained from strain OK8 (8) by PCR using primers Ura7-C and
Ura7-D. This fragment was blunt-end ligated into pBlueScript II digested with EcoRV to form plasmid pDO163. In order to clone the URA7
open reading frame for mutagenesis experiments, a 1.81-kb DNA fragment containing the URA7 open reading frame was obtained by PCR
(primers Ura7-E and Ura7-F) using DNA from strain W303-1A as the
template. This fragment was digested with NotI and PstI and ligated
into pBlueScript II that was digested with the same restriction enzymes
to form plasmid pDO178. A 1.76-kb DNA fragment containing the
URA8 open reading frame was obtained by PCR (primers Ura8-G and
Ura8-H) using DNA from strain W303–1A as the template. This fragment was blunt-end ligated into pBlueScript II digested with EcoRV to
form plasmid pDO179. The primary sequences of the cloned open reading frames of URA7 and URA8 in plasmids pDO178 and pDO179 were
verified by DNA sequencing.
The URA7E161K (primer Ura7-G and complement) and URA7H233K
(primer Ura7-H and complement) and URA8E161K (primer Ura8-I and
complement) and URA8H233K (primer Ura8-J and complement) mutations were constructed by PCR using plasmids pDO178 and pDO179,
respectively, as templates. The primers for the E161K mutations incorporated an ApaLI restriction site, and the primers for the H233K
mutations incorporated an ApaI restriction site. These silent restriction
sites were used to identify plasmids with the correct mutations. The
URA7E161K,H233K and URA8E161K,H233K mutants were constructed with
the appropriate primers for the H233K mutations using the URA7E161K
and URA8E161K mutants, respectively, as templates. The mutated genes
were completely sequenced to verify that no additional unwanted mutations were made.
The wild-type and mutant alleles of URA7 and URA8 were subcloned
into an expression shuttle vector containing the ADH1 promoter. The
ADH1 promoter was isolated from plasmid pDB20 by digestion with
BamHI and PstI. This fragment was ligated into plasmid YEpLac181
digested with the same restriction enzymes to form plasmid pDO104. A
pair of annealed oligonucleotides (Mcs-A and Mcs-B), which contains
additional restriction sites, was ligated into plasmid pDO104 that was
digested with NotI and PstI to form plasmid pDO105. The wild-type and
mutant alleles of URA7 were released from plasmid pDO178 by digestion with NotI and PstI, and the wild-type and mutant alleles of URA8
were released from plasmid pDO179 by digestion with NotI and XbaI.
These fragments were then ligated into plasmid pDO105, digested with
18994
Regulation of Phospholipid Synthesis
TABLE I
Strains used in this work
Strain
E. coli
HB 101
S. cerevisiae
W303–1A
OK8a
SGY157
SDO159
SDO195a
MC13
OP1
a
Relevant characteristics
Source or Ref.
F2, hsdS20 (r2B, m2B), recA13, ara14, proA2, lacY1, galK2, rpsL20 (Smr), xyl-5, mtl-1, supE44, l2
26
MATa, leu2–3,112, trp1–1, can1–100, ura3–1, ade2–1, his3–11,15
MATa, leu2, trp1, ura3, ura7D::TRP1 ura8
MATa, leu2–3,112, trp1–289, ura3–52
ura8D::HisG derivative of SGY157
ura7D::TRP1, ura8D::HisG derivative of SGY157
MATa, ino1–13, lys2, can1
MATa, opi1–1, lys2
82
8
83
This work
This work
27
28
Growth-dependent on a plasmid bearing either the URA7 or the URA8 gene.
TABLE II
Plasmids used in this work
Plasmid
Promoter
pNKY51
pDO183
pFL44S-URA7
YEpLac195
pDO134
pBlueScript II
pDO163
pDO178
pDO179
pDB20
YEpLac181
pDO104
pDO105
pDO169
pDO170
pDO171
pDO172
pDO173
pDO174
pDO175
pDO176
pJH359
None
None
URA7
None
URA7
None
None
None
None
ADH1
None
ADH1
ADH1
ADH1
ADH1
ADH1
ADH1
ADH1
ADH1
ADH1
ADH1
CYC1
Relevant characteristic
Marker
Source or Ref.
HisG/URA3/HisG
URA8D::HisG/URA3/HisG derivative of pNKY51
Multicopy E. coli/yeast shuttle vector containing URA7
Multicopy E. coli/yeast shuttle vector
URA7 derivative of YEpLac195
Color-selectable multiple cloning site
URA7D::TRP1 derivative of pBlueScript II
URA7 derivative of pBlueScript II used for mutagenesis
URA8 derivative of pBlueScript II used for mutagenesis
Plasmid containing ADH1 promoter
Multicopy E. coli/yeast shuttle vector
ADH1 promoter derivative of YEpLac181
Multiple cloning site derivative of pDO104
URA8 derivative of pDO105
URA7 derivative of pDO105
URA7E161K derivative of pDO170
URA7H233K derivative of pDO170
URA7E161K,H233K derivative of pDO170
URA8E161K derivative of pDO169
URA8H233K derivative of pDO169
URA8E161K,H233K derivative of pDO169
INO1-CYC1-lacI9Z reporter construct
URA3
URA3
URA3
URA3
URA3
Ampr
TRP1
None
None
URA3
LEU2
LEU2
LEU2
LEU2
LEU2
LEU2
LEU2
LEU2
LEU2
LEU2
LEU2
URA3
84
This work
7
85
This work
Stratagene
This work
This work
This work
52
85
This work
This work
This work
This work
This work
This work
This work
This work
This work
This work
81
TABLE III
Oligonucleotides used in this work
a
b
Oligo
Sequencea
Positionb
Ura7-A
Ura7-B
Ura7-C
Ura7-D
Ura7-E
Ura7-F
Ura7-G
Ura7-H
Ura8-A
Ura8-B
Ura8-C
Ura8-D
Ura8-E
Ura8-F
Ura8-G
Ura8-H
Ura8-I
Ura8-J
Mcs-A
Mcs-B
ATTATTTCCACCAGCATTCT
TCTCAAACCTAATCTCATTG
GGACAGTTGGTGACATTGAAAGTGCTCCTT
TTCGCCGGCCTCAAGATCGTACTTACCTTC
acagcggccgcAAATGAAGTACGTTGTTGTTTCAGGTGGTGT
cgcctgcagTTAGAAATTTATCTTTGTTAATGCAGTAGAC
TGACATTGAAAGTGCaCCTTTTGTGaAGGCACTAAGACAAT
ATTGCCATGTTTTGTaAgGTGGGcCCTGAACAGGTGGTT
AGAGAATTTCGCCCTGATCCATGTTTCACT
GGCCTCAAACCCAATCTCATCGTGCCACCC
ctcgaattcAAATGCAGACTCTTCAGTAGAAAGGAGCAA
tctagatctGGTAAGCGCCTCATACGGAAAAAGTAGTTAT
aaaggatcCCGGTGTTCCCTTTCTTGGTGTCTGTC
agagtcgacCAATTCATTCATTTTCATTTCCCTCGCTTAG
tctgcggccgccAATTGAAAATGAAATACG
gagtctagaATTTTCATTTCCCTCGCTTAG
TGACATTGAGAGTGCaCCCTTCGTGaAAGCATTACGACAAT
ATTGCCATGTTTTGCaAgGTGGGcCCGGAGCAAGTGGTC
GGCCGCATATGCTAGCTAAGCTCTAGACCAAGAACGCGTCTGCA
GACGCGTTCTTGGTCTAGAGCTTAGCTAGCATATGC
2316F
1379R
445F
1721R
22F
1791R
455F
681F
515F
1387R
2682F
2280R
1186F
1739R
27F
1729R
455F
681F
Lowercase letters refer to nonhomologous sequences used for incorporating restriction enzyme sites, mutagenesis, or sequence spacers.
Position relative to the initiator ATG codon. F, forward orientation relative to sense strand; R, reverse relative to sense strand.
NotI and PstI and NotI and XbaI, respectively, to form the expression
shuttle vectors pDO169-pDO176.
Construction of the ura7D ura8D Double Mutant—A ura7D ura8D
double mutant was constructed and used as the host strain for the
expression of the wild-type and mutant alleles of the URA7-encoded
and URA8-encoded CTP synthetases. A ura8D mutant was constructed
first. A 4.6-kb SspI fragment of plasmid pDO183, which contained the
URA8D::HisG/URA3/HisG cassette, was used to transform strain
SGY157 to uracil prototrophy. HisG is a 1100-base pair DNA sequence
from Salmonella typhimurium which is utilized in direct repeats flanking URA3 to increase the frequency of homologous recombination resulting in the loss of URA3. Colonies were subsequently plated onto
media containing 5-fluoroorotic acid, and uracil auxotrophs were recovered. This step selected for the ura8D::HisG recombination. One of the
ura8D mutants was designated strain SDO159. Strain SDO159 was
transformed with plasmid pDO134, which contains a wild-type URA7
allele. This plasmid was maintained by growth of the strain on plates
without uracil. This step was necessary because a ura7D ura8D mutant
Regulation of Phospholipid Synthesis
is not viable (8). Strain SDO159 bearing plasmid pDO134 was then
transformed to tryptophan prototrophy with a 1.34-kb fragment of
plasmid pDO163 that was digested with DraI and NaeI. One of the
ura7D ura8D double mutants was designated strain SDO195. Both
mutations were confirmed by Southern blot analysis.
Strain SDO195, bearing plasmid pDO134, was transformed to
leucine prototrophy with the ADH1 expression vectors containing the
wild-type and mutant alleles of URA7 and URA8. Plasmid pDO134 was
subsequently selected against with 5-fluoroorotic acid by plasmid shuffle (35). Cells were then examined to verify that they regained uracil
auxotrophy. The presence of the ADH1 expression vectors containing
the wild-type and mutant alleles of URA7 and URA8 was verified by
re-isolation in E. coli and restriction analysis.
Preparation of Enzymes—The URA7-encoded (9) and URA8-encoded
(10) CTP synthetases were partially purified through the ammonium
sulfate fractionation step as described previously. Cell extracts for
b-galactosidase assays were prepared by cell disruption with glass
beads (9) using the Z buffer described by Guarente (36).
Enzyme Assays and Protein Determination—CTP synthetase activity
was determined by measuring the conversion of UTP to CTP (molar
extinction coefficients of 182 and 1520 M21 cm21, respectively) by following the increase in absorbance at 291 nm on a recording spectrophotometer (2). The standard reaction mixture contained 50 mM TrisHCl, pH 8.0, 2 mM UTP, 2 mM ATP, 2 mM L-glutamine, 0.1 mM GTP, 10
mM MgCl2, 10 mM 2-mercaptoethanol, and an appropriate dilution of
enzyme protein in a total volume of 0.2 ml. Enzyme assays were performed in triplicate with an average standard deviation of 6 3%. All
assays were linear with time and protein concentration. A unit of CTP
synthetase activity was defined as the amount of enzyme that catalyzed
the formation of 1 nmol of product/min. b-Galactosidase activity was
measured by a fluorescent assay using methylumbelliferyl galactoside
as substrate according to the instructions of the manufacturer. A unit of
b-galactosidase activity was defined as the amount of enzyme that
catalyzed the hydrolysis of 1 pmol of substrate/min. Protein was determined by the method of Bradford (37) using bovine serum albumin as
the standard.
Immunoblotting of CTP Synthetase—Immunoblot assays were performed with IgG anti-URA7-encoded (9) and IgG anti-URA8-encoded
(10) CTP synthetase antibodies as described previously (38). The density of the URA7-encoded and URA8-encoded CTP synthetase bands on
immunoblots was quantified by scanning densitometry. Immunoblot
signals were in the linear range of detectability.
Extraction and Mass Analysis of Nucleotides—Cells bearing the wildtype and mutant URA7-encoded and URA8-encoded CTP synthetases
were grown to the exponential phase of growth. Cellular nucleotides
were extracted (7) and were analyzed by high performance liquid chromatography (8).
Labeling and Analysis of Phospholipids and Neutral Lipids—Labeling of phospholipids and neutral lipids with 32Pi, [methyl-3H]choline,
and [2-14C]acetate were performed as described previously (11, 39 – 42).
Lipids were extracted from labeled cells by the method of Bligh and
Dyer (43) as described previously (42). Phospholipids were analyzed by
two-dimensional thin layer chromatography on high performance silica
gel thin layer chromatography plates using chloroform/methanol/glacial acetic acid (65:25:10, v/v) as the solvent for dimension one and
chloroform/methanol/88% formic acid (65:25:10, v/v) as the solvent for
dimension two (44). Neutral lipids were analyzed by one-dimensional
thin layer chromatography on high performance silica gel thin layer
plates using the solvent system hexane/diethyl ether/glacial acetic acid
(80:20:2) (45). The 32P-labeled phospholipids were visualized by autoradiography, and the 14C-labeled neutral lipids were visualized by
fluorography using EN3HANCE. The position of the labeled lipids on
chromatography plates were compared with standard lipids after exposure to iodine vapor. The amount of each labeled lipid was determined
by liquid scintillation counting of the corresponding spots on the
chromatograms.
Labeling and Analysis of Kennedy Pathway Intermediates—Labeling
of the Kennedy (CDP-choline) pathway intermediates with [methyl3
H]choline was performed as described previously (11). Choline, phosphocholine, and CDP-choline were obtained from whole cells after lipid
extraction (43). The aqueous phase was neutralized and dried in vacuo,
and the residue was dissolved in deionized water. Samples were subjected to centrifugation at 12,000 3 g for 3 min to remove insoluble
material. The Kennedy pathway intermediates were separated by thin
layer chromatography with silica gel 60 plates using the solvent system
methanol, 0.5% sodium chloride, ammonia (50:50:1) as described by
Teegarden et al. (46). The positions of the labeled intermediates on
chromatograms were determined by fluorography using EN3HANCE
18995
and compared with standards. The amount of each labeled compound
was determined by liquid scintillation counting.
RESULTS AND DISCUSSION
Construction and Characterization of the URA7-encoded and
URA8-encoded CTP Synthetase E161K and H233K Mutants—
CTP synthetase mutants defective in CTP product inhibition
have been isolated from Chinese hamster ovary cells (47). Sequence analysis of the CTP synthetase gene from these mutants revealed that most of the mutations were clustered
within a stretch of 14 amino acids (47). The most frequent
mutations in the clustered region of the enzyme were glutamate to lysine and histidine to lysine (47). The clustered sites
are in a highly conserved region of the CTP synthetases from
human cells (48), E. coli (49), Chlamydia trachomatis (50),
Bacillus subtilis (51), and S. cerevisiae (7, 8). Based on this
information, we hypothesized that the two amino acids that are
most frequently mutated in Chinese hamster ovary cells (47)
would be involved in the regulation of the S. cerevisiae CTP
synthetases by CTP. These amino acids correspond to Glu161
and His233 in the URA7-encoded and URA8-encoded CTP
synthetases.
The codons for Glu161 and His233 in the URA7-encoded and
URA8-encoded CTP synthetases were changed to lysine codons
by site-directed mutagenesis. The mutations were made individually and in combination for each of the CTP synthetase
enzymes. The open reading frames of each of the mutated genes
were subcloned behind the constitutive ADH1 promoter (52) on
a multicopy plasmid. We used the ADH1 promoter for enzyme
expression to obviate regulation mediated by the native URA7
and URA8 promoters. The mutant enzymes were separately
expressed on a multicopy plasmid in a ura7D ura8D double
mutant to examine the effects of the URA7-encoded and URA8encoded CTP synthetase mutations on phospholipid synthesis.
A multicopy plasmid was chosen to accentuate the effects of the
mutations. The effects of the mutations in cells were compared
with cells expressing the wild-type enzymes on a multicopy
plasmid.
Cells bearing multicopy plasmids containing the wild-type
and mutant alleles of the URA7 and URA8 genes exhibited
growth rates similar to parent wild-type (SGY157) cells when
grown vegetatively at 30 °C in liquid YEPD and complete synthetic media. However, cells bearing the E161K mutation in
the URA7-encoded CTP synthetase entered the stationary
phase of growth at a lower cell density (1–2 3 108 cells/ml) than
that (2–5 3 108 cells/ml) of cells expressing the wild-type enzyme. No morphological differences were observed in the cells
bearing the mutations in the URA7-encoded and URA8-encoded CTP synthetases. Quantitative reverse transcriptasePCR analysis showed that there were no differences in the
mRNA levels between strains containing the wild-type and
mutant alleles of the URA7 and URA8 genes on the multicopy
plasmid. Immunoblot analysis of cell extracts prepared from
cells bearing multicopy plasmids with the wild-type and mutant alleles showed that there were no differences in the CTP
synthetase protein levels expressed. As expected, the CTP synthetase mRNA (about 30-fold) and protein (6 –7-fold) levels in
all of the strains were elevated when compared with the mRNA
and protein levels found in the parent wild-type strain
SGY157. Therefore, the mutations in the URA7 and URA8
genes did not affect the functional expression of these genes.
Effect of CPEC on the Growth of Cells Bearing the E161K and
H233K Mutations in the URA7-encoded and URA8-encoded
CTP Synthetases—The effect of CPEC on the growth of cells
bearing the E161K and H233K mutations in the URA7-encoded and URA8-encoded CTP synthetases was examined by a
radial diffusion assay. CPEC is a carbocyclic analogue of cyti-
18996
Regulation of Phospholipid Synthesis
FIG. 2. Effect of CPEC on the growth
of cells bearing the E161K and H233K
mutations in the URA7-encoded and
URA8-encoded CTP synthetases.
Cells expressing the indicated URA7-encoded (A) and URA8-encoded (B) wildtype and mutant CTP synthetases were
seeded onto separate agar plates containing complete synthetic medium. 10 mg of
CPEC was placed into a 3-mm hole in the
center of each agar plate. The plates were
incubated for 24 h, and the diameter of
the zone of growth inhibition around the
hole was measured. The values reported
were the average of four separate experiments (S.D. 6 1 mm). WT, wild type.
dine where the ribofuranose moiety is substituted by a cyclopentenyl ring (23). In mammalian cells, CPEC is rapidly phosphorylated to CPEC triphosphate, a specific and potent
inhibitor of CTP synthetase activity (23). This compound would
be expected to inhibit CTP synthetase activity, reduce the
cellular levels of CTP, and thus inhibit growth (23). Indeed,
CPEC inhibited S. cerevisiae cells bearing the multicopy plasmids with the wild-type alleles of the URA7 and URA8 genes
(Fig. 2). This growth inhibition was the same as that observed
with parent wild-type (SGY157) cells that did not contain a
plasmid. On the other hand, cells bearing plasmids with the
E161K mutation showed a dramatic decrease in sensitivity to
CPEC (Fig. 2). Cells bearing the H233K mutation exhibited a
less dramatic decrease in CPEC sensitivity when compared
with cells containing the E161K mutation (Fig. 2). The CPEC
resistance of cells bearing the E161K,H233K double mutation
was similar to cells bearing the E161K mutation alone.
Effect of the E161K and H233K Mutations in the URA7encoded and URA8-encoded CTP Synthetases on the Inhibition
of Activity by CTP—We directly examined the hypothesis that
the E161K and H233K mutations in the CTP synthetase enzymes affected the regulation of activity by CTP product inhibition. CTP synthetase was partially purified from cells bearing the wild-type and mutant alleles of the URA7 and URA8
genes and assayed for activity in the absence and presence of
CTP. When measured in the absence of CTP, the specific activities of the E161K mutant enzymes were about 2-fold higher
than the wild-type enzymes (Fig. 3, A and B). As described
previously (9, 10), the wild-type URA7- and URA8-encoded
CTP synthetase activities were inhibited by CTP in a dose-dependent manner (Fig. 3, C and D). The CTP synthetase activities of the E161K mutant enzymes were less sensitive to CTP
inhibition (Fig. 3, C and D). The IC50 values for CTP of the
URA7-encoded and URA8-encoded E161K mutant enzymes
were 8.4- and 5-fold greater, respectively, than those of their
wild-type counterparts (Table IV). Moreover, the apparent inhibitor constants for CTP of the mutant enzymes were within
the physiological range of CTP (Table IV). The URA7-encoded
E161K mutant enzyme was more resistant to CTP product
inhibition when compared with the URA8-encoded E161K mutant enzyme (Fig. 3, C and D). The specific activities of the
H233K mutant URA7-encoded and URA8-encoded enzymes
and their sensitivities to CTP inhibition were similar to that of
the wild-type enzymes (Fig. 3). The specific activities and patterns of CTP inhibition of the E161K,H233K double mutant
enzymes were similar to that of the single E161K mutant
(Fig. 3).
Effect of the E161K and H233K Mutations in the URA7encoded and URA8-encoded CTP Synthetases on the Cellular
Concentrations of Nucleotides—The effect of the E161K and
H233K mutations in the URA7-encoded and URA8-encoded
CTP synthetases on the cellular concentration of nucleotide
triphosphates was examined. Cells were grown to the exponential phase of growth, and nucleotides were extracted and then
analyzed by high performance liquid chromatography. The
CTP levels contributed by the wild-type URA7-encoded CTP
synthetase were greater than those contributed by the URA8encoded enzyme (Fig. 4 and Table IV). Cells expressing the
E161K mutation in the URA7-encoded (6-fold) and URA8-encoded (15-fold) CTP synthetases had elevated cellular concentrations of CTP when compared with cells that overexpressed
their wild-type counterpart enzymes (Fig. 4 and Table IV). The
CTP concentration in cells bearing the E161K mutation in the
URA7-encoded enzyme was 36-fold greater than the CTP concentration in the parent wild-type strain SGY157 (Table IV).
Although the H233K mutation in the URA7-encoded CTP synthetase did not have a significant effect on the cellular CTP
concentration, the H233K mutation in the URA8-encoded enzyme resulted in an increase (5-fold) in CTP concentration (Fig.
4 and Table IV). The CTP concentration in cells bearing the
E161K,H233K double mutation in URA7-encoded enzyme was
not significantly different from cells bearing the E161K mutation alone (Fig. 4A). On the other hand, the CTP concentration
in cells bearing the double mutation in the URA8-encoded
enzyme was greater (1.3-fold) than that of cells bearing the
E161K mutation alone (Fig. 4B and Table IV). The E161K and
H233K mutations in both the URA7-encoded and URA8-encoded enzymes did not have a significant effect on the cellular
concentrations of UTP, ATP, and GTP (Fig. 4).
The differences in the effects of the E161K and H233K mutations in the URA7-encoded and URA8-encoded CTP synthetase on activity and cellular CTP levels further support the
hypothesis (8, 10) that these enzymes are regulated differentially in vivo. Owing to the fact that the E161K mutation in the
URA7-encoded CTP synthetase had the major effect on CTP
synthetase regulation by CTP, the other mutants of the URA7encoded and URA8-encoded CTP synthetases were not examined further in this study.
Effect of the E161K Mutation in the URA7-encoded CTP
Synthetase on the Synthesis and Composition of Phospholipids—The effect of the E161K mutation in the URA7-encoded
CTP synthetase on the synthesis and steady-state composition
of phospholipids was examined. Cells were grown in complete
synthetic medium minus inositol and choline to obviate the
regulatory effects these compounds have on phospholipid metabolism (4, 53–55). In the absence of exogenous choline, wildtype S. cerevisiae cells synthesize phospholipids by both the
CDP-DG and Kennedy pathways (11, 56, 57). We examined the
Regulation of Phospholipid Synthesis
18997
FIG. 3. Effect of the E161K and
H233K mutations in the URA7-encoded and URA8-encoded CTP synthetases on the inhibition of activity
by CTP. Cells expressing the indicated
URA7-encoded (A and C) and URA8-encoded (B and D) wild-type and mutant
CTP synthetases were grown in complete
synthetic medium to the exponential
phase of growth. The CTP synthetase enzymes were partially purified and assayed for activity in the absence (A and B)
and presence (C and D) of the indicated
concentrations of CTP as described under
“Experimental Procedures.” WT, wild
type.
TABLE IV
Inhibitor constants for CTP of mutant CTP synthetases and the
cellular concentration of CTP in cells bearing the mutant CTP
synthetases
Strain or relevant
plasmid genotype
IC50
for CTPa
SGY157
URA7WT
URA7E161K
URA7H233K
URA7E161K,H233K
URA8WT
URA8E161K
URA8H233K
URA8E161K,H233K
NDb
0.10
0.84
0.08
0.90
0.05
0.25
0.04
0.41
Cellular concentration
of CTP
mM
a
b
0.1
0.6
3.6
0.7
3.3
0.1
1.5
0.5
1.9
The IC50 values reported were calculated from the data in Fig. 3.
ND, not determined.
synthesis and composition of phospholipids by labeling cells
with both 32Pi and [methyl-3H]choline. 32Pi will be incorporated
into phospholipids synthesized by both the CDP-DG and
Kennedy pathways, whereas the labeled choline will only be
incorporated into PC synthesized via the Kennedy pathway.
The concentration of choline added to the growth medium from
the radioactive label was 0.1 mM, a concentration too low to
affect the rate of synthesis of PC by the Kennedy pathway (58).
Phospholipid synthesis was followed by pulse labeling. The
amount of label incorporated into each phospholipid represented the relative rates of synthesis during the pulse. Cells
overexpressing the E161K mutation in the URA7-encoded CTP
synthetase showed an increase in the synthesis of PC (1.5-fold),
PE (1.3-fold), and PA (2-fold), and a decrease in the synthesis of
PS (1.7-fold) when compared with cells overexpressing the
wild-type enzyme (Fig. 5A). The effect of the E161K mutation
on the steady-state phospholipid composition is shown in Fig.
5C. The major effect of the E161K mutation on composition was
an increase in PC (1.3-fold) and a decrease in PS (1.3-fold).
Radiolabeled choline was incorporated into PC during the
pulse labeling and steady-state labeling experiments indicating that PC was synthesized via the Kennedy pathway. The
data shown in Fig. 5, B and D, are plotted as the ratio of the
cpm of 3H incorporated into PC to the cpm of 32P incorporated
into PC. This allowed us to determine if the E161K mutation in
the CTP synthetase affected the pathways by which cells synthesized PC (11). The E161K mutation in the URA7-encoded
CTP synthetase caused an increase in this ratio in both the
pulse labeling (1.7-fold) and steady-state labeling (1.5-fold) of
PC when compared with cells overexpressing the wild-type
enzyme. These results indicated that cells expressing the
E161K mutation had an increase in the utilization of the
Kennedy pathway for PC synthesis when compared with cells
expressing the wild-type enzyme. This increased utilization of
the Kennedy pathway is an underestimate since the 32Pi label
incorporated into PC occurred by both the Kennedy and
CDP-DG pathways. The decrease in the synthesis and steadystate content of PS was consistent with a decrease in the
utilization of the CDP-DG pathway.
Cells were pulse-labeled and labeled to steady state with
[methyl-3H]choline to analyze the Kennedy pathway intermediates choline, phosphocholine, and CDP-choline. The E161K
mutation in the URA7-encoded CTP synthetase caused a small
decrease in the synthesis of phosphocholine (1.2-fold) and an
increase in the synthesis of CDP-choline (1.5-fold) when compared with the control cells (Fig. 6A). The E161K mutation had
a more dramatic effect on the steady-state composition of the
Kennedy pathway intermediates (Fig. 6B). The mutation
caused a 1.2-fold decrease in the amount of phosphocholine and
a 2.3-fold increase in the amount of CDP-choline when compared with the control cells. The increase in the synthesis and
steady-state amounts of CDP-choline, the rate-limiting
Kennedy pathway intermediate (58, 59), was consistent with
the increased utilization of the Kennedy pathway for PC synthesis in the E161K mutant. An increase in the utilization of
the Kennedy pathway is caused by the overexpression of the
wild-type URA7-encoded CTP synthetase (11). However, the
effects of the E161K mutation in CTP synthetase on Kennedy
pathway utilization were over and above those effects brought
about by the overexpression of the wild-type enzyme. The increase in utilization of the Kennedy pathway and in the
amount of CDP-choline in cells bearing the E161K mutant CTP
synthetase were 3.2- and 3-fold greater, respectively, when
compared with cells expressing the wild-type URA7-encoded
CTP synthetase from a single copy plasmid (11). Moreover, the
18998
Regulation of Phospholipid Synthesis
FIG. 4. Effect of the E161K and
H233K mutations in the URA7-encoded and URA8-encoded CTP synthetases on the cellular concentrations of nucleotides. Cells expressing
the indicated URA7-encoded (A) and
URA8-encoded (B) wild-type and mutant
CTP synthetases were grown in complete
synthetic medium to the exponential
phase of growth. Nucleotides were extracted and analyzed by high performance liquid chromatography as described
under “Experimental Procedures.” The
values reported were the average of four
separate experiments 6 S.D. WT, wild
type.
FIG. 5. Effect of the E161K mutation in the URA7-encoded CTP synthetase on the synthesis and steady-state composition of
phospholipids. Cells expressing either the wild-type URA7-encoded or the mutant URA7E161K-encoded CTP synthetases were grown to the
exponential (1 3 107 cells/ml) phase of growth. For pulse labeling of phospholipids (A) and PC (B), cells were incubated with 32Pi (5 mCi/ml) and
[methyl-3H]choline (0.5 mCi/ml) for 30 min. The incorporation of 32Pi and [methyl-3H]choline into total phospholipids and PC were approximately
1,000 cpm/107 cells and 5,000 cpm/107 cells, respectively. The steady-state composition of phospholipids (C) and PC (D) were determined by labeling
cells for five to six generations with 32Pi (5 mCi/ml) and [methyl-3H]choline (0.5 mCi/ml). The incorporation of 32Pi and [methyl-3H]choline into total
phospholipids and PC were about 10,000 cpm/107 cells and 2,000 cpm/107 cells, respectively. Phospholipids were extracted and analyzed as
described under “Experimental Procedures.” The values reported in A and C were determined from 32Pi labeling. The values in B and D were
reported as the cpm of 3H incorporated into PC relative to the cpm of 32P incorporated into PC. The percentages shown for phospholipids were
normalized to the total 32Pi-labeled chloroform-soluble fraction which included sphingolipids and other unidentified phospholipids. The values
reported were the average of four separate experiments 6 S.D. The abbreviations used are: PC, phosphatidylcholine; PE, phosphatidylethanolamine; PI, phosphatidylinositol; PS, phosphatidylserine; PA, phosphatidate; WT, wild type.
overexpression of the wild-type CTP synthetase does not cause
changes in phospholipid composition (11).
Effect of the E161K Mutation in the URA7-encoded CTP
Synthetase on the Regulation of INO1 Expression—An Opi (inositol excretion) phenotype (28) is characteristic of defects in the
regulation of phospholipid metabolism in S. cerevisiae (4, 53–
55). The Opi phenotype was examined for cells bearing the
E161K mutation in the URA7-encoded CTP synthetase using
growth of an ino1 mutant as an indicator of the phenotype.
Cells expressing the E161K mutant enzyme exhibited an Opi
phenotype, whereas cells expressing the wild-type enzyme did
not (Fig. 7A). Parent wild-type (SGY157) cells did not exhibit
an Opi phenotype. The Opi phenotype of the E161K mutant
was not as great as that exhibited by the inositol excreting opi1
mutant (28), which was used as a positive control (Fig. 7A).
The Opi phenotype is the result of the derepression of the
INO1 gene encoding inositol-1-phosphate synthase (53, 55).
The expression of the INO1 mRNA in cells bearing the E161K
mutation in the URA7-encoded CTP synthetase was examined
by using the INO1-CYC1-lacI9Z reporter construct. Cells bearing the reporter construct were grown in complete synthetic
medium minus inositol; cell extracts were prepared, and b-galactosidase activity was measured. The b-galactosidase activity
in cells expressing the E161K mutant was 2.4-fold greater than
the activity in cells expressing the wild-type enzyme (Fig. 7B).
The level of b-galactosidase activity in parent wild-type
(SGY157) cells was the same as that of cells overexpressing the
wild-type enzyme. Thus the Opi phenotype of cells bearing the
E161K mutation was due to the derepression of the INO1 gene.
The addition of inositol to wild-type cells results in a repression
of INO1 mRNA (60). We examined the effect of inositol supplementation on INO1 expression in cells bearing the E161K
Regulation of Phospholipid Synthesis
18999
FIG. 6. Effect of the E161K mutation in the URA7-encoded CTP synthetase on the synthesis and steady-state composition of
Kennedy pathway intermediates. Cells expressing either the wild-type URA7-encoded or the mutant URA7E161K-encoded CTP synthetases
were grown to the exponential (1 3 107 cells/ml) phase of growth. For pulse labeling of the Kennedy pathway intermediates (A), cells were
incubated with [methyl-3H]choline (5 mCi/ml) for 30 min. The incorporation of [methyl-3H]choline into the Kennedy pathway intermediates was
about 20,000 cpm/107 cells. The steady-state composition of the Kennedy pathway intermediates (B) was determined by labeling cells for five to
six generations with [methyl-3H]choline (5 mCi/ml). The incorporation of [methyl-3H]choline into the Kennedy pathway intermediates was about
50,000 cpm/107 cells. The Kennedy pathway intermediates were extracted and analyzed as described under “Experimental Procedures.” The values
reported were the average of three separate experiments 6 S.D. WT, wild type.
FIG. 7. Effect of the E161K mutation in the URA7-encoded CTP
synthetase on the expression of the INO1 gene. A, the inositolrequiring ino1 mutant was streaked beside a patch of cells expressing
either the wild-type or the E161K mutant CTP synthetase or a patch of
opi1 mutant cells grown on agar plates containing complete synthetic
medium minus inositol. The plates were incubated for 72 h at 30 °C. B,
cells expressing either the wild-type URA7-encoded or mutant
URA7E161K-encoded CTP synthetases were transformed with plasmid
pJH359. This plasmid carries a fully regulated INO1-CYC1-lacI9Z construct (81). Cells were grown in complete synthetic medium in the
absence (2I) and presence (1I) of 50 mM inositol. Cells were harvested
at the exponential phase of growth; cell extracts were prepared, and
b-galactosidase activity was measured as described under “Experimental Procedures.” The values reported were determined from duplicate
assays (S.D. 6 3%) from a minimum of two independent growth studies.
The abbreviations used are: WT, wild type; OP1, opi1 mutant cells.
mutation in URA7-encoded CTP synthetase. The addition of
inositol to the growth medium resulted in a 3-fold decrease in
b-galactosidase activity in cells bearing the E161K mutation.
However, the b-galactosidase activity in the repressed E161K
mutant was not as low as the activity in the control cells
supplemented with inositol (Fig. 7B). Cells bearing the E161K
mutation were also analyzed for INO1 mRNA by reverse transcriptase-PCR. This analysis confirmed the results described
above using the INO1-CYC1-lacI9Z reporter construct. Overall,
these results showed that the E161K mutation in CTP synthetase affected the normal regulation of the INO1 gene.
Effect of the E161K Mutation in the URA7-encoded CTP
Synthetase on Neutral Lipid Synthesis and Composition—We
examined the effect of the E161K mutation in the URA7-encoded CTP synthetase on the synthesis of total phospholipids
and neutral lipids by pulse labeling with [2-14C]acetate. The
E161K mutation did not have a significant effect on the relative
synthesis of total neutral lipids and total phospholipids when
compared with cells expressing the wild-type enzyme (Fig. 8A).
The mutation also had little effect on the synthesis of the major
neutral lipid compounds (Fig. 8B). On the other hand, the
E161K mutation had a dramatic effect on the steady-state
composition of lipids. The amount of total neutral lipids increased 1.3-fold, whereas the total amount of phospholipids
decreased 1.3-fold in the E161K mutant when compared with
control cells (Fig. 8C). The ratio of total neutral lipids to phospholipids (1.45) in cells bearing the E161K mutation was 1.6fold greater than the ratio of total neutral lipids to phospholipids (0.93) in cells expressing the wild-type enzyme. Moreover,
the E161K mutation caused increases in triacylglycerol (1.4fold), free fatty acids (1.7-fold), and ergosterol ester (1.8-fold)
and caused a decrease in diacylglycerol (1.3-fold) when compared with control cells (Fig. 8D).
Concluding Discussion—To gain insight into the regulation
of S. cerevisiae CTP synthetase activity by CTP product inhibition and its impact on phospholipid synthesis, we constructed
mutant forms of the enzyme that were defective in CTP product
inhibition. The E161K mutation had the major effect on the
regulation of the URA7-encoded and URA8-encoded CTP synthetases by CTP. Cells bearing the E161K mutation were resistant to CPEC and accumulated elevated levels of CTP. The
major consequence of the E161K mutation in the URA7-encoded CTP synthetase on phospholipid synthesis was an increase in the utilization of the Kennedy pathway. The mechanism for this regulation may be attributed to an increase in the
substrate availability of CTP for the phosphocholine cytidylyl-
19000
Regulation of Phospholipid Synthesis
FIG. 8. Effect of the E161K mutation
in the URA7-encoded CTP synthetase
on the synthesis and composition of
lipids. Cells expressing either the wildtype URA7-encoded or the mutant
URA7E161K-encoded CTP synthetases
were grown to the exponential (1 3 107
cells/ml) phase of growth. For pulse labeling of total lipids (A and B), cells were
incubated with [2-14C]acetate (1 mCi/ml)
for 30 min. The incorporation of [2-14C]acetate into total lipids during the pulse
was approximately 25,000 cpm/107 cells.
The steady-state composition of total lipids (C and D) was determined by labeling
cells for five to six generations with
[2-14C]acetate (1 mCi/ml). The incorporation of [2-14C]acetate into total lipids during steady-state labeling was approximately 30,000 cpm/107 cells. Total lipids
were extracted and analyzed as described
under “Experimental Procedures.” The
percentages shown for total phospholipids
and neutral lipids were normalized to the
total 14C-labeled chloroform-soluble fraction which included sphingolipids and
other unidentified lipids. The values reported were the average of three separate
experiments 6 S.D. The abbreviations
used are: PL, total phospholipids; NL, total
neutral lipids; TG, triacylglycerol; DG, diacylglycerol; FA, fatty acid; Erg, ergosterol;
ErgE, ergosterol ester; WT, wild type.
transferase reaction (11). The CDP-DG pathway is primarily
used by wild-type S. cerevisiae when they are grown in the
absence of choline (53, 54, 61, 62). However, the Kennedy
pathway contributes to PC synthesis even when wild-type cells
are grown in the absence of choline (11, 56, 57, 63). The choline
required is derived from the phospholipase D-mediated turnover of PC synthesized by the CDP-DG pathway (63, 64). The
Kennedy pathway becomes important for PC synthesis when
the enzymes in the CDP-DG pathway are defective. Mutants
defective in the synthesis of PS (39, 40), PE (65, 66), or PC
(67–70) require choline for growth in order to synthesize PC via
the Kennedy pathway.
Although the synthesis of PC by the Kennedy pathway is
essential when the CDP-DG pathway is defective, there are
circumstances when the Kennedy pathway is detrimental to S.
cerevisiae. Bankaitis and co-workers (56, 71) have shown that
the synthesis of PC via the Kennedy pathway is lethal in the
absence of a functional PI/PC transfer protein (Sec14p). Sec14p
activity is essential for viability and vesicle budding from the
Golgi complex (72, 73). Yet this essential function can be obviated by mutations in the Kennedy pathway (71). Data suggest
that Sec14p may function to down-regulate the Kennedy pathway by inhibiting phosphocholine cytidylyltransferase activity
(74) and/or by preventing consumption of the DG used for PC
synthesis via the Kennedy pathway (75).
The activation of the Kennedy pathway in response to the
E161K mutation in CTP synthetase was not lethal but was
accompanied by alterations in the synthesis of the major membrane phospholipids. These changes included significant increases in the synthesis of PC and PA and a decrease in the
synthesis of PS. The decrease in PS synthesis is consistent with
the conclusion that the E161K mutation caused a decrease in
PC synthesis via the CDP-DG pathway. The mechanism for
this regulation may be attributed to a direct inhibition of PS
synthase activity by CTP (11). The increase in PA synthesis
may be the result of a decrease in the utilization of the CDP-DG
pathway. Defects in the synthesis of PC via the CDP-DG pathway are accompanied by the misregulation of the INO1 gene
and an Opi phenotype (53–55, 76 –78). Indeed, cells bearing the
E161K mutation in CTP synthetase exhibited an Opi phenotype due to the misregulation of the INO1 gene. These observations further support the hypothesis that the misregulation
of the pathways for PC synthesis generates a signal for the
misregulation of the INO1 gene (63, 64, 78). Recent data suggest that this signaling molecule is PA (64). As indicated above,
PA synthesis was elevated in cells bearing the E161K mutation
in CTP synthetase. The synthesis of PC is coordinately regulated with the synthesis of PI (53, 54, 78). The derepression of
the INO1 gene plays a role in this regulation to provide inositol
for PI synthesis (53, 54, 78). PI and its derivative molecules
(polyphosphoinositides and sphingolipids) are essential to the
growth and viability of S. cerevisiae (53, 54, 78).
The E161K mutation in CTP synthetase also caused an increase in total neutral lipid content at the expense of total
phospholipids as well as increases in triacylglycerols, free fatty
acids, and ergosterol esters. These alterations, which occurred
in exponential phase cells, were reminiscent of changes that
occur in wild-type cells when they enter the stationary phase of
growth (41, 79, 80). The effects of the E161K mutation on
cellular CTP levels and on phospholipid synthesis may have
created a stress-like condition that accounted for cells bearing
the mutation to enter the stationary phase of growth at a lower
cell density when compared with cells expressing the wild-type
enzyme.
In this study we focused on the effect of CTP synthetase
regulation by CTP on phospholipid synthesis. CTP synthetase
activity is also essential for the synthesis of RNA, DNA, and
sialoglycoproteins. Therefore alterations in the metabolism of
these macromolecules in response to the E161K mutation in
CTP synthetase could also have an influence on the regulation
of phospholipid synthesis. Additional studies will be required to
address this question. Clearly, the regulation of CTP synthetase activity by CTP would be expected to play a major role in
cell growth and physiology.
Acknowledgments—We thank Dr. Grant M. Hatch for a gift of CPEC,
Subbarao Mantha for assistance with the high performance liquid chromatography of nucleotides, and Susan A. Henry for plasmid pJH359.
Regulation of Phospholipid Synthesis
REFERENCES
1. Liberman, I. (1956) J. Biol. Chem. 222, 765–775
2. Long, C. W., and Pardee, A. B. (1967) J. Biol. Chem. 242, 4715– 4721
3. Vance, D. E. (1996) in Biochemistry of Lipids, Lipoproteins and Membranes
(Vance, D. E., and Vance, J., eds) pp. 153–181, Elsevier Science Publishers
B.V., Amsterdam
4. Carman, G. M., and Zeimetz, G. M. (1996) J. Biol. Chem. 271, 13293–13296
5. Carter, J. R., and Kennedy, E. P. (1966) J. Lipid Res. 7, 678 – 683
6. Kennedy, E. P., and Weiss, S. B. (1956) J. Biol. Chem. 222, 193–214
7. Ozier-Kalogeropoulos, O., Fasiolo, F., Adeline, M.-T., Collin, J., and Lacroute,
F. (1991) Mol. Gen. Genet. 231, 7–16
8. Ozier-Kalogeropoulos, O., Adeline, M.-T., Yang, W.-L., Carman, G. M., and
Lacroute, F. (1994) Mol. Gen. Genet. 242, 431– 439
9. Yang, W.-L., McDonough, V. M., Ozier-Kalogeropoulos, O., Adeline, M.-T.,
Flocco, M. T., and Carman, G. M. (1994) Biochemistry 33, 10785–10793
10. Nadkarni, A. K., McDonough, V. M., Yang, W.-L., Stukey, J. E., OzierKalogeropoulos, O., and Carman, G. M. (1995) J. Biol. Chem. 270,
24982–24988
11. McDonough, V. M., Buxeda, R. J., Bruno, M. E. C., Ozier-Kalogeropoulos, O.,
Adeline, M.-T., McMaster, C. R., Bell, R. M., and Carman, G. M. (1995)
J. Biol. Chem. 270, 18774 –18780
12. Aronow, B., and Ullman, B. (1987) J. Biol. Chem. 262, 5106 –5112
13. Robert de Saint Vincent, B., and Buttin, G. (1980) Biochim. Biophys. Acta 610,
352–359
14. Meuth, M., L’Heureux-Huard, N., and Trudel, M. (1979) Proc. Natl. Acad. Sci.
U. S. A. 76, 6505– 6509
15. Aronow, B., Watts, T., Lassetter, J., Washtien, W., and Ullman, B. (1984)
J. Biol. Chem. 259, 9035–9043
16. Chu, E. H. Y., McLaren, J. D., Li, I.-C., and Lamb, B. (1984) Biochem. Genet.
22, 701–715
17. Kaufman, E. R. (1986) Mutat. Res. 161, 19 –27
18. Meuth, M., Goncalves, O., and Thom, P. (1982) Somatic Cell Genet. 8, 423– 432
19. van den Berg, A. A., van Lenthe, H., Busch, S., de Korte, D., Roos, D., van
Kuilenburg, A. B. P., and van Gennip, A. H. (1993) Eur. J. Biochem. 216,
161–167
20. Kizaki, H., Williams, J. C., Morris, H. P., and Weber, G. (1980) Cancer Res. 40,
3921–3927
21. Weber, G., Lui, M. S., Takeda, E., and Denton, J. E. (1980) Life Sci. 27,
793–799
22. Weber, G., Olah, E., Lui, M. S., and Tzeng, D. (1979) Adv. Enzyme Regul. 17,
1–21
23. Kang, G. J., Cooney, D. A., Moyer, J. D., Kelley, J. A., Kim, H.-Y., Marquez,
V. E., and Johns, D. G. (1989) J. Biol. Chem. 264, 713–718
24. Zhang, H., Cooney, D. A., Zhang, M. H., Ahluwalia, G., Ford, H., Jr., and
Johns, D. G. (1993) Cancer Res. 53, 5714 –5720
25. Rose, M. D., Winston, F., and Heiter, P. (1990) Methods in Yeast Genetics: A
Laboratory Course Manual, Cold Spring Harbor Laboratory, pp. 1–198,
Cold Spring Harbor, NY
26. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning, A
Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor,
NY
27. Culbertson, M. R., and Henry, S. A. (1975) Genetics 80, 23– 40
28. Greenberg, M., Reiner, B., and Henry, S. A. (1982) Genetics 100, 19 –33
29. McGee, T. P., Skinner, H. B., and Bankaitis, V. A. (1994) J. Bacteriol. 176,
6861– 6868
30. Ito, H., Yasuki, F., Murata, K., and Kimura, A. (1983) J. Bacteriol. 153,
163–168
31. Schiestl, R. H., and Gietz, R. D. (1989) Curr. Genet. 16, 339 –346
32. Innis, M. A., and Gelfand, D. H. (1990) in PCR Protocols: A Guide to Methods
and Applications (Innis, M. A., Gelfand, D. H., Sninsky, J. J., and White,
T. J., eds) pp. 3–12, Academic Press, Inc., San Diego, CA
33. Schmitt, M. E., Brown, T. A., and Trumpower, B. L. (1990) Nucleic Acids Res.
18, 3091–3092
34. Kawasaki, E. S. (1990) in PCR Protocols: A Guide to Methods and Applications
(Innis, M. A., Gelfand, D. H., Sninsky, J. J., and White, T. J., eds) pp. 21–27,
Academic Press, Inc., San Diego, CA
35. Sikorski, R. S., and Boeke, J. D. (1991) Methods Enzymol. 194, 302–318
36. Guarente, L. (1983) Methods Enzymol. 101, 181–191
37. Bradford, M. M. (1976) Anal. Biochem. 72, 248 –254
38. Haid, A., and Suissa, M. (1983) Methods Enzymol. 96, 192–205
39. Atkinson, K., Fogel, S., and Henry, S. A. (1980) J. Biol. Chem. 255, 6653– 6661
40. Atkinson, K. D., Jensen, B., Kolat, A. I., Storm, E. M., Henry, S. A., and Fogel,
S. (1980) J. Bacteriol. 141, 558 –564
41. Homann, M. J., Poole, M. A., Gaynor, P. M., Ho, C.-T., and Carman, G. M.
19001
(1987) J. Bacteriol. 169, 533–539
42. Morlock, K. R., Lin, Y.-P., and Carman, G. M. (1988) J. Bacteriol. 170,
3561–3566
43. Bligh, E. G., and Dyer, W. J. (1959) Can. J. Biochem. Physiol. 37, 911–917
44. Esko, J. D., and Raetz, C. R. H. (1980) J. Biol. Chem. 255, 4474 – 4480
45. Henderson, R. J., and Tocher, D. R. (1992) in Lipid Analysis (Hamilton, R. J.,
and Hamilton, S., eds) pp. 65–111, IRL Press at Oxford University Press,
Oxford
46. Teegarden, D., Taparowsky, E. J., and Kent, C. (1990) J. Biol. Chem. 265,
6042– 6047
47. Whelan, J., Phear, G., Yamauchi, M., and Meuth, M. (1993) Nat. Genet. 3,
317–321
48. Yamauchi, M., Yamauchi, N., and Meuth, M. (1990) EMBO J. 9, 2095–2099
49. Weng, M., Makaroff, C. A., and Zalkin, H. (1986) J. Biol. Chem. 261,
5568 –5574
50. Tipples, G., and McClarty, G. (1995) J. Biol. Chem. 270, 7908 –7914
51. Trach, K., Chapman, J. W., Piggot, P., Lecoq, D., and Hoch, J. A. (1988)
J. Bacteriol. 170, 4194 – 4208
52. Becker, D. M., Fikes, J. D., and Guarente, L. (1991) Proc. Natl. Acad. Sci.
U. S. A. 88, 1968 –1972
53. Paltauf, F., Kohlwein, S. D., and Henry, S. A. (1992) in The Molecular and
Cellular Biology of the Yeast Saccharomyces: Gene Expression (Jones, E. W.,
Pringle, J. R., and Broach, J. R., eds) pp. 415–500, Cold Spring Harbor
Laboratory, Cold Spring Harbor, NY
54. Carman, G. M., and Henry, S. A. (1989) Annu. Rev. Biochem. 58, 635– 669
55. Greenberg, M. L., and Lopes, J. M. (1996) Microbiol. Rev. 60, 1–20
56. McGee, T. P., Skinner, H. B., Whitters, E. A., Henry, S. A., and Bankaitis, V. A.
(1994) J. Cell Biol. 124, 273–287
57. McMaster, C. R., and Bell, R. M. (1994) J. Biol. Chem. 269, 28010 –28016
58. McMaster, C. R., and Bell, R. M. (1994) J. Biol. Chem. 269, 14776 –14783
59. Vance, D. E. (1991) in Biochemistry of Lipids, Lipoproteins and Membranes
(Vance, D. E., and Vance, J., eds) pp. 205–240, Elsevier Science Publishers
B.V., Amsterdam
60. Hirsch, J. P., and Henry, S. A. (1986) Mol. Cell. Biol. 6, 3320 –3328
61. Henry, S. A. (1982) in The Molecular Biology of the Yeast Saccharomyces:
Metabolism and Gene Expression (Strathern, J. N., Jones, E. W., and
Broach, J. R., eds) pp. 101–158, Cold Spring Harbor Laboratory, Cold
Spring Harbor, NY
62. Carman, G. M. (1989) in Phosphatidylcholine Metabolism (Vance, D. E., ed) pp.
165–183, CRC Press, Inc., Baca Raton, FL
63. Patton-Vogt, J. L., Griac, P., Sreenivas, A., Bruno, V., Dowd, S., Swede, M. J.,
and Henry, S. A. (1997) J. Biol. Chem. 272, 20873–20883
64. Sreenivas, A., Patton-Vogt, J. L., Bruno, V., Griac, P., and Henry, S. A. (1998)
J. Biol. Chem. 273, 16635–16638
65. Trotter, P. J., and Voelker, D. R. (1995) J. Biol. Chem. 270, 6062– 6070
66. Trotter, P. J., Pedretti, J., Yates, R., and Voelker, D. R. (1995) J. Biol. Chem.
270, 6071– 6080
67. Kodaki, T., and Yamashita, S. (1987) J. Biol. Chem. 262, 15428 –15435
68. Kodaki, T., and Yamashita, S. (1989) Eur. J. Biochem. 185, 243–251
69. Summers, E. F., Letts, V. A., McGraw, P., and Henry, S. A. (1988) Genetics
120, 909 –922
70. McGraw, P., and Henry, S. A. (1989) Genetics 122, 317–330
71. Cleves, A. E., McGee, T. P., Whitters, E. A., Champion, K. M., Aitkin, J. R.,
Dowhan, W., Goebl, M., and Bankaitis, V. A. (1991) Cell 64, 789 – 800
72. Bankaitis, V. A., Malehorn, D. E., Emr, S. D., and Greene, R. (1989) J. Cell
Biol. 108, 1271–1281
73. Sha, B., Phillips, S. E., Bankaitis, V. A., and Luo, M. (1998) Nature 391,
506 –510
74. Skinner, H. B., McGee, T. P., McMaster, C. R., Fry, M. R., Bell, R. M., and
Bankaitis, V. A. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 112–116
75. Kearns, B. G., McGee, T. P., Mayinger, P., Gedvilaite, A., Phillips, S. E.,
Kagiwada, S., and Bankaitis, V. A. (1997) Nature 387, 101–105
76. Shen, H., and Dowhan, W. (1996) J. Biol. Chem. 271, 29043–29048
77. Shen, H., and Dowhan, W. (1997) J. Biol. Chem. 272, 11215–11220
78. Henry, S. A., and Patton-Vogt, J. L. (1998) Prog. Nucleic Acid Res. 61, 133–179
79. Taylor, F. R., and Parks, L. W. (1979) Biochim. Biophys. Acta 575, 204 –214
80. Taylor, F. R., and Parks, L. W. (1978) J. Bacteriol. 136, 531–537
81. Lopes, J. M., Hirsch, J. P., Chorgo, P. A., Schulze, K. L., and Henry, S. A.
(1991) Nucleic Acids Res. 19, 1687–1693
82. Thomas, B., and Rothstein, R. (1989) Cell 56, 619 – 630
83. Sclafani, R. A., and Fangman, W. L. (1994) Proc. Natl. Acad. Sci. U. S. A. 81,
5821–5825
84. Alani, E., Cao, L., and Kleckner, N. (1987) Genetics 116, 541–545
85. Gietz, R. D., and Sugino, A. (1988) Gene (Amst.) 74, 527–534