238
Lipid rafts remodeling in estrogen receptor–negative breast
cancer is reversed by histone deacetylase inhibitor
Anna Ostapkowicz,1 Kunihiro Inai,1,4 Leia Smith,5
Silvia Kreda,3 and Jozef Spychala1,2
1
Lineberger Comprehensive Cancer Center; 2Department of
Pharmacology; and 3Cystic Fibrosis/Pulmonary Research and
Treatment Center, University of North Carolina at Chapel Hill,
Chapel Hill, North Carolina; 4Faculty of Medical Science,
University of Fukui, Fukui, Japan; and 5Seattle Genetics, Inc.,
Bothell, Washington
Abstract
Recently, we have found dramatic overexpression of
ecto-5V-nucleotidase (or CD73), a glycosylphosphatidylinositol-anchored component of lipid rafts, in estrogen
receptor – negative [ER( )] breast cancer cell lines and
in clinical samples. To find out whether there is a more
general shift in expression profile of membrane proteins,
we undertook an investigation on the expression of
selected membrane and cytoskeletal proteins in aggressive and metastatic breast cancer cells. Our analysis
revealed a remarkably uniform shift in expression of a
broad range of membrane, cytoskeletal, and signaling
proteins in ER( ) cells. A similar change was found in
two in vitro models of transition to ER( ) breast cancer:
drug-resistant Adr2 and c-Jun-transformed clones of MCF7 cells. Interestingly, similar expression pattern was
observed in normal fibroblasts, suggesting the commonality of membrane determinants of invasive cancer cells
with normal mesenchymal phenotype. Because a number
of investigated proteins are components of lipid rafts, our
results suggest that there is a major remodeling of lipid
rafts and underlying cytoskeleton in ER( ) breast cancer.
To test whether this broadly defined ER( ) phenotype
could be reversed by treatment with differentiating agent,
we treated ER( ) cells with trichostatin A, an inhibitor of
histone deacetylase, and observed reversal of mesenchymal and reappearance of epithelial markers. Changes in
gene and protein expression also included increased
capacity to generate adenosine and altered expression
profile of adenosine receptors. Thus, our results suggest
Received 7/5/05; revised 11/29/05; accepted 12/16/05.
Grant support: RO1-CA34085 and Department of Defense grant
DAMD17-01-1-0351.
The costs of publication of this article were defrayed in part by the
payment of page charges. This article must therefore be hereby marked
advertisement in accordance with 18 U.S.C. Section 1734 solely to
indicate this fact.
Requests form reprints: Jozef Spychala, Department of Pharmacology,
University of North Carolina, MEJ Building, CB7365, Chapel Hill,
NC 27599-7365. Phone: 919-493-8996; Fax: 919-493-3299.
E-mail: [email protected]
Copyright C 2006 American Association for Cancer Research.
doi:10.1158/1535-7163.MCT-05-0226
that during transition to invasive breast cancer there is a
significant structural reorganization of lipid rafts and underlying cytoskeleton that is reversed upon histone deacetylase inhibition. [Mol Cancer Ther 2006;5(2):238 – 45]
Introduction
Establishment and clinical use of tumor markers that define
invasive and metastatic breast carcinoma is critical for more
individualized therapeutic strategies in the future. Because
breast cancer is becoming an increasingly heterogeneous
disease, the task of defining specific cancer cell phenotypes
is especially challenging. Several individual breast cancer
markers have been established for target-specific pharmacologic intervention. The clinically proven therapies include targeting estrogen receptor (ER) and progesterone
receptor and more recently Erb2 and epidermal growth
factor receptor (EGFR). Major differences in expression
profiles of wide number of genes has been documented in
ER( ) and ER(+) carcinomas (1). Both in in vitro studies
and in the clinic, these differences were associated with
either more motile and invasive phenotype or more
aggressive course of the disease in the case of ER( ) breast
carcinoma (2). Membrane proteins and associated cytoskeleton mediate the communication with the extracellular
milieu and the composition of membrane proteins is critical
for cell behavior in general and invasive and metastatic
properties in particular.
Among different membrane microdomains, lipid rafts are
one of the least understood subcellular elements. Although
their lipid composition has been investigated in several
studies (3 – 7), protein components were not systematically
compared between invasive and noninvasive cells. Because
several in vitro models of breast cancer exemplify transition
to more invasive and metastatic state, we have chosen
this model to study changes in lipid rafts composition after
loss of ER expression. Our recent finding that ER( ) breast
cancer cells express high level of ecto-5V-nucleotidase, a
glycosylphosphatidylinositol-anchored protein and a
marker of lipid rafts, provides an early argument for the
lipid raft remodeling during transition to more aggressive
breast carcinoma (8). In this study, we aimed to analyze
whether there is a consistent alteration in expression of
cytoskeletal membrane and lipid raft protein components
across a wider population of ER(+) and ER( ) cells that
would suggest a coordinate expression consistent with
the motile and invasive phenotype. Within this phenotype,
we also investigated the expression of genes and proteins
involved in adenosine generation and signaling. Although
limited by the availability of suitable antibodies, our unique
focus on expressed proteins, rather than mRNA profile,
allowed us to directly relate protein expression with the
specific cell phenotype.
Mol Cancer Ther 2006;5(2). February 2006
Downloaded from mct.aacrjournals.org on June 18, 2017. © 2006 American Association for Cancer Research.
Molecular Cancer Therapeutics
Materials and Methods
Cell Lines
Breast cancer ER(+) cell lines MDA-MB-474, ZR-75-1,
MCF-7 and negative SK-BR-3, MDA-MB-468, MDA-MB435s, MDA-MB-231, BT-549, Hs578t, nontransformed
MCF-10A, c-Jun-transformed MCF-7/c-Jun clone 2-33
and control MCF-7/neo clone 7-1, and human fibroblasts
WI-38 were obtained from either Tissue Culture Facility
at Lineberger Comprehensive Cancer Center/University
of North Carolina, American Type Culture Collection
(Manassas, VA), or developed as described before (9).
The Adr2 and AdrR MCF-7 Adriamycin-resistant cell
sublines were from Dr. Y.M. Rustum (Roswell Park
Cancer Institute, Buffalo, NY). Cells were maintained in
MEM supplemented with Eagle salts, NaPyr, nonessential
amino acids, and 10% fetal bovine serum (most cell
lines); in McCoy’s supplemented with 15% fetal bovine
serum (SK-BR-3 cells); in Leibowitz L-15 supplemented
with 10% fetal bovine serum (MDA-MB-468 cells); and in
mammary epithelial growth medium supplemented with
bovine pituitary extract, human epidermal growth factor,
insulin, hydrocortisone, and 10% fetal bovine serum
(BioWhittaker medium for MCF-10A cells) in CO2/O2
atmosphere at 37jC, except for MDA-MB-468 cells that
were grown at ambient atmosphere at 37jC. All media
contained penicillin and streptomycin. Original cell stocks
were stored in liquid nitrogen and each sample was kept
in culture for no more than 15 passages.
Reagents
All general reagents were ACS or the highest purity
commercially available. The following antibodies were
used. Rabbit polyclonal anti-ecto-5V-nucleotidase antibodies
(for Western blot) were generated as described before (10)
or purchased from BD Biosciences (PharMingen, San Jose,
CA; for immunofluorescence). Anti-Gas/olf sc-383, Gai-2
sc-7276, Ga12 sc-409, Ga13 sc-410, thy-1 sc-9163, CD24
sc-11406, Gh sc-378, Gh2 sc-380, ankyrin B (clone 2.20),
cyclin D1 sc-8396, integrin h1 sc-8978, integrin h2 sc-6624,
integrin h3 sc-6627, ERa sc-8005, fyn sc-434, lyn sc-15, lck
sc-433, c-fgr sc-130, hck sc-72, MDR1 sc-8313, N-cadherin
sc-8424, OB-cadherin sc-9997, caveolin-1 sc-894, PKCa sc
8393, fascin, sc-16579, lamin B1, sc-6216, and secondary
horseradish peroxidase conjugated against goat and rat
IgG were from Santa Cruz (Santa Cruz, CA). E-cadherin
C20820, fak F15020, integrin h1 I41720, integrin a5 I55220,
PKCh P17720, PKCy P36520, PKCu P15120, moesin M36820,
EBP50 E83020, ezrin M36820, gelsolin G37820, and flotillin-1
F65020 antibodies were from Transduction Laboratories
(Lexington, KY). Anti-CD44s 13-5500 antibody was from
Zymed (San Francisco, CA). Anti-c-Yes antibody 06-514
and c-Src GD11 were from Upstate (Lake Placid, NY); rabbit
anti-uPAR (399R) were from American Diagnostica, Inc.
(Greenwich, CT); anti-h-actin was from Oncogene (Boston,
MA); antifilamin antibody MAB1678, integrin av AB1930,
talin MAB1676, and vimentin AB1620 were from Chemicon
(Temecula, CA); and anti-intestinal alkaline phosphatase
antibodies were from Biogenesis (Kingston, NH). Anti-
bodies against cytoskeletal proteins a-smooth muscle actin
(clone 1A4), cytokeratin (clone K8.13 detecting forms 1, 5, 6,
7, 8, 10, 11, and 18; clone K8.12 detecting forms 13, 15, and
16) were from Sigma (St. Louis, MO).
Lipid Raft Isolation
Cell lysates were prepared by mixing equal volumes of
cell pellets with 2% Triton X-100 on ice for 1 minute and
subsequent dilution twice with PBS and twice further with
35% Nycodenz [5V-(N -2,3-dihydroxypropylacetamido)2,4,6-triiodo-N,N-bis(2,3-dihydroxypropyl)-isophtalamide]
in PBS. At each step, mixing was achieved by pipetting the
lysate up and down several times with Eppendorf pipettor.
A modified procedure for density gradient centrifugation
using Nycodenz from Sigma-Aldrich (St. Louis, MO)
was used to fractionate Triton X-100 – soluble and Triton
X-100 – insoluble membrane and cytoskeletal subdomains
and complexes (11). For the purpose of centrifugation, cell
lysates containing 3 to 4 mg total protein were diluted
2-fold with 35% Nycodenz. Density step gradient was
generated by applying 0.5 mL aliquots of increasing
concentration of Nycodenz (35%, 25%, 22.5%, 20%, lysate
in 17.5%, 15%, 12%, 8%, and 4%) sequentially into Beckman
(Palo Alto, CA) 13 51 mm polyallomer tubes. Lysates
were placed in the middle of Nycodenz gradient premixed
in 17.5% Nycodenz. Tubes were centrifuged at 46,000 g
for 4 hours in a Beckman 55 Ti rotor at 4jC. Following
centrifugation, 0.5 mL fractions were carefully withdrawn
and small pellet was resuspended in PBS containing 0.5%
SDS and 1% Triton X-100 (fraction 10). Total of 10 fractions
and control input lysate were analyzed for the distribution
of proteins by Western blot. Typically, components of light
lipid rafts and caveolae distributed into first four fractions:
Soluble cell components, including cytosolic proteins,
remained in fractions 5 and 6 and cytoskeleton-associated
high-density fractions were distributed in fractions 7 to 9.
Western Blotting
Cell extracts, obtained by scraping cells in PBS in the
presence of protein phosphatase and protease inhibitors
and lysing with ice-cold 1% Triton X-100/PBS, were loaded
on the SDS-PAGE at 30 Ag per lane. Separated proteins
were transferred onto Immobilon-P 0.45 Amol/L (Millipore,
Bedford MA) polyvinylidene difluoride membrane and
used for probing with specific antibodies. Two buffer
systems were used during incubations with antibodies: PBS
supplemented with 5% Carnation fat-free dry milk and
0.2% Tween 20 or 25 mmol/L Tris (pH 8.4) supplemented
with 130 mmol/L NaCl, 5 mmol/L potassium phosphate,
5% fat-free dry milk, and 0.2% Tween 20. Blots were reused
several times after mild stripping by air drying overnight at
room temperature when necessary. Secondary antibodies
conjugated to horseradish peroxidase and BM Chemiluminescence Western Blotting kit (Roche, Indianapolis IN)
were used to develop images on Kodak (Rochester, NY)
X-Mat Blue XB-1 film.
Reverse Transcription-PCR
Extraction of total RNA was done using TRI reagent from
Molecular Research Center (Cincinnati, OH). Reverse
Mol Cancer Ther 2006;5(2). February 2006
Downloaded from mct.aacrjournals.org on June 18, 2017. © 2006 American Association for Cancer Research.
239
240 Lipid Rafts in Breast Cancer
transcription-PCR assays were done using Advantage RT
and Titanium Taq PCR kits from Clontech BD Biosciences
(Mountain View, CA). The following PCR oligonucleotides
for adenosine receptor subtypes were used: A1 forward:
AATTGCTGTGGACCGCTACCTC, reverse: CGACACCTTCTTGTTGAGCTG; A2a forward: TTGACCGCTACATTGCCATCCG, reverse: GAAGATCCGCAAATAGACACC;
A2b forward: ACCAACTACTTCCTGGTGTCC, reverse:
GCAGCTTTCATTCGTGGTTCC: A3 forward: ATCGCTGTGGACCGATACTTG, reverse: AATGCACCTGTCTCTTTGGAG. Amplification reactions were run at the following
conditions: 1 minute each at 94jC, 62jC, and 72jC, total
40 cycles. The size of PCR products were as follows: AR1 344
bp, AR2a 305 bp, AR2b 374 bp, AR3 352 bp, glyceraldehyde3-phosphate dehydrogenase 983 bp, and trypsin inhibitor
407 bp.
Results
We have done a broad survey of the expression of
membrane, cytoskeletal, and signaling proteins in breast
cancer cell lines that represent ER(+) and ER( ) phenotypes. The cell panel consists of well-characterized cell
lines, which invasive and metastatic potential have been
defined in previous studies (12, 13), thus enabling us to
correlate protein expression with specific cell phenotypes.
In this cell panel, MCF-10A cells is an example of
nontumorigenic mammary epithelial control cells and SKBr-3 and MDA-MB-468 represent ER( ) cells that are less
tumorigenic than MDA-MB-435s, MDA-MB-231, BT-549,
and Hs578t cells (12). Recently, we showed dramatic upregulation of ecto-5V-nucleotidase, a glycosylphosphatidylinositol-anchored membrane ecto-protein, in ER( ) breast
cancer cells (8). Here, we compared the expression of ecto5V-nucleotidase with other lipid raft components, such as
CD24 and alkaline phosphatase. The expression of proposed breast cancer marker CD24 concurred with the ER
receptor status and was also found in SK-Br-3 and MDAMB-468 cells. A reciprocal pattern was found for intestinal
alkaline phosphatase (Fig. 1A). The broader membrane and
cytoskeletal protein survey revealed an alteration in
expression of specific proteins in ER(+) and ER( ) cell
lines with somewhat variable expression in SK-Br-3 and
MDA-MB-468 cells (Fig. 1A). Although E-cadherin was
expressed mostly in ER(+) and control cells, other adhesion
receptor integrins h1, a5, and aV; CD44; and OB-cadherin
and N-cadherin tended to coexpress with ecto-5V-nucleotidase in ER( ) cells (Fig. 1B). Similarly, cytoskeletal
Figure 1. Differential expression of membrane and cytoskeletal proteins in hyperplastic MCF-10A cells and in a panel of breast cancer cell lines. A,
representative cytoskeletal and lipid raft – associated proteins. eN, ecto-5’-nucleotidase; ALP, alkaline phosphatase. B, representative membrane and
signaling proteins with roles in adhesion. C, representative cytoskeleton-associated proteins. Note that moesin (bottom ) and ezrin (top band on the
bottom panel ) are detected simultaneously using M36820 antibodies from Transduction Laboratories. Cell lysates were prepared in enough quantity so
different proteins could be compared using the same lysate. They were loaded onto each lane (30 Ag) and processed for SDS-PAGE and Western blotting
procedure as described in Materials and Methods.
Mol Cancer Ther 2006;5(2). February 2006
Downloaded from mct.aacrjournals.org on June 18, 2017. © 2006 American Association for Cancer Research.
Molecular Cancer Therapeutics
protein vimentin and partially smooth muscle actin, in
contrast to several cytokeratins, coexpressed with ecto-5Vnucleotidase in ER( ) cells. Lamin B1 expression was
independent of cell type; however, a-tubulin tended to
express at higher levels in more aggressive ER( ) cells
(Fig. 1A). Analysis of proteins associated with cytoskeleton
show that although EBP50 and gelsolin were associated
with less invasive cells, fimbrin, talin, filamin, and
especially fascin and moesin tended to express at higher
level in more invasive breast cancer cells (not shown).
Interestingly, caveolin-1 expression strongly coincided
with ecto-5V-nucleotidase, further suggesting that, in addition to ecto-5V-nucleotidase lipid rafts, caveolae may have
specific function in more invasive cells. Other membrane
or membrane-associated signaling molecules, such as EGFR
(not shown), lyn, and PKCa, also showed similar expression
pattern. On the other hand, FAK, PKCy, PKC~, and integrin
a3 did not display cell-specific expression (not shown).
This comprehensive analysis helped us subcategorize our
breast cancer cell panel into three distinct profiles. BT474,
ZR-75-1, and MCF-7 cells having epithelial and MDA-MB435s, MDA-MB-231, BT-549, and Hs578t having more
mesenchymal features. Significantly, cell lines SK-Br-3
and MDA-MB-468 fall in between: Although losing many
epithelial markers, such as E-cadherin and certain cytokeratins, they did not yet acquire full set of mesenchymal
features, and, as have been shown previously, are less
tumorigenic (12). Interestingly, during long cell culture
(>20 cell passages), we occasionally observed temporal
expression of ecto-5V-nucleotidase in SK-Br or lower expression in MDA-MB-468 cells, but no change in expression
in other cell lines, suggesting some intrinsic phenotypic
plasticity in these particular cells. Despite their less
aggressive phenotype, this could explain metastatic behavior of MDA-MB-468 cells in mouse xenograft model (14).
The MCF-10A cell line, on the other hand, expresses more
complex mixture of epithelial and mesenchymal markers,
and thus may likely have myoepithelial origin.
To further test whether transition to ER( ) status and
more invasive phenotype will show similar shift in
expression profile, we used two independent in vitro
models of breast cancer progression. Development of drug
resistance and overexpression of c-Jun in MCF-7 cells were
both shown to correlate with the loss of ER expression and
transition to more invasive and tumorigenic phenotype
(9, 15). Results presented in Fig. 2 show that in these
two models, there is a very similar shift in expression
profile to that in ER( ) cells shown in Fig. 1A-C. To further
analyze whether the expression of membrane or cytoskeletal proteins may differentiate between ‘‘cancer metastatic’’
and normal motile phenotypes, we included in this survey
lysates from normal human fibroblasts WI-38. Normal
fibroblasts are commonly used to represent mesenchymal
phenotype. This comparison revealed that drug-resistant,
c-Jun-transformed, and all other invasive cells shown in
Fig. 1A-C exhibit the expression pattern of membrane and
cytoskeletal proteins that is remarkably similar to fibroblasts. In addition to data presented in Fig. 2, we observed
Figure 2. Differential expression of membrane, adhesion, cytoskeletal,
and regulatory proteins in in vitro models of breast cancer progression:
drug-resistant (Adr2) and c-Jun-transformed MCF-7 cells. Comparison of
expression profiles with human normal fibroblasts WI38. Experimental
conditions as in Fig. 1.
up-regulation of Src, lyn, and EGFR and down-regulation
of Lck in ER( ) cells and in fibroblasts. The expression of
fimbrin and flotillin-1 did not show, however, significant
variation in these cells (not shown).
To determine which membrane, cytoskeletal, and signaling proteins were associated with lipid rafts, we used the
modified density gradient centrifugation with Nycodenz
(11) and used MDA-MB-231 and MCF-7 cell lysates as
representative for ER( ) and ER(+) phenotypes. These two
cell lines are very well characterized in previous studies
and therefore are better suited for comparative analysis.
Furthermore, MDA-MB-231 cells were shown to reexpress
ERa and E-cadherin upon trichostatin A treatment (16),
suggesting an intrinsic plasticity important for the purpose
of this work. Other cell lines shown in Fig. 1, both ER( )
and ER(+), were also tested for lipid raft distribution of
selected membrane proteins and the results were similar to
MCF-7 and MDA-MB-231 cells (not shown). Preliminary
experiments also determined that cholesterol, an important
component of lipid rafts, distributed mostly with lowdensity fractions 2 to 4 (here defined as lipid rafts).
As shown in Fig. 3A, ecto-5V-nucleotidase and flotillin-1,
two independent markers of lipid rafts, were found
predominantly in low-density fractions. On the other
hand, a-tubulin (disassembled to monomers under lowtemperature conditions) and adenosine kinase were distributed predominantly to fractions 5 to 7, which represent
Triton X-100 soluble cell extracts (not shown). Vimentin,
Mol Cancer Ther 2006;5(2). February 2006
Downloaded from mct.aacrjournals.org on June 18, 2017. © 2006 American Association for Cancer Research.
241
242 Lipid Rafts in Breast Cancer
h-actin, and lamin B1 were distributed mostly to fractions
5 to 10, which represent heavier Triton X-100 – soluble and
Triton X-100 – insoluble (cytoskeletal) fractions of cell lysate
(not shown).
Among signaling membrane-associated proteins, srcfamily members, with the exception of c-yes, distributed
almost exclusively to lipid rafts (Fig. 3A). In contrast, protein
kinase Ca was found exclusively in soluble cell compartment and neither associated with lipid rafts nor with
insoluble cytoskeleton (Fig. 3A). CD44 and Gai2, known
lipid raft components, also distributed almost exclusively to
lipid rafts. On the other hand, Gas and Gh2 distributed in
significant part to soluble and cytoskeletal compartments
(Fig. 3B). Integrin h1, EGFR, and OB-cadherin proteins
highly expressed in MDA-MB-231 cells were distributed in
all three cell compartments and FAK was found only in
soluble and cytoskeletal fractions. Analysis of cell lysates
from ER(+) breast cancer MCF-7 cells that express very low
levels of ecto-5V-nucleotidase also showed lipid raft distribution of this protein, along with glycosylphosphatidylinositol-linked CD24, src, lyn, and Gas, suggesting that this
distribution is cell type independent (not shown).
Previous studies showed that histone deacetylase inhibitors caused shift in expression pattern of selective protein
groups. In breast cancer cells, trichostatin A has been
shown to induce the expression of ERa and E-cadherin in
MDA-MB-231 cells (16, 17). Based on these data, we asked
whether trichostatin A may reverse the expression of a
broader range of mesenchymal proteins that define the
invasive and metastatic phenotype in breast cancer cells.
Our preliminary studies revealed that 0.5 Amol/L trichostatin A concentration was most effective without triggering
substantial apoptosis (see also ref. 16). Treatment of MDAMB-231 cells with trichostatin A for 48 hours caused downregulation of ecto-5V-nucleotidase protein (Fig. 4A). Similar
result was seen with ecto-5V-nucleotidase mRNA (not
shown). Other proteins that have been shown to contribute
to invasive cell behavior, such as CD44 (standard form),
PKCa, caveolin-1, integrins h1 and a5, EGFR, OB-cadherin,
and moesin, were all strongly down-regulated by trichostatin A. On the other hand, epithelial markers, such as
cytokeratins (detectable with K8-13 antibody), E-cadherin,
ERa, EBP50, and gelsolin, were up-regulated. The expression of CD24, another marker of lipid rafts in ER(+) cells,
was also significantly increased. The expression of several
other proteins, including lyn (not shown) and vimentin,
was only slightly down-regulated; however, at 48 hours of
drug treatment, there was increased incidence of apoptosis
that may have masked further changes in gene expression.
Along with the complete disappearance of CD44 standard
form, we have noticed an appearance of a higher molecular
form, probably a splice variant (18), that was also seen in
untreated MDA-MB-468 cells (Fig. 1A).
Because ecto-5V-nucleotidase, the major adenosineproducing enzyme in epithelial cells (19), was dramatically
down-regulated in ER( ) cells exposed to trichostatin A
(Figs. 1A and 4A), we tested the expression of adenosine
receptors in MDA-MB-231 cells treated with trichostatin A.
As shown in Fig. 4B, expression of adenosine receptors was
unevenly affected by trichostatin A: Although A2a and A2b
were unchanged, the expression of A1 was decreased and
A3 was increased during this trichostatin A – induced
transition to epithelial phenotype (Fig. 4B). Thus, increased
capacity to produce adenosine seem to correlate with
increased signaling through A1 receptors in aggressive
breast cancer cells and this feature is reversed by histone
deacetylase inhibitors.
Discussion
Analysis of lipid components of membranes in breast cancer
cells was done previously and revealed significantly altered
ratio of phospholipids (3), increased level of gangliosides,
and components of lipid rafts (4 – 6) in ER( ) cells.
Furthermore, increased circulating levels of gangliosides
were found in breast cancer patients when compared with
healthy individuals (7). Although association of few
Figure 3. Distribution of proteins from
MDA-MB-231 cells after density gradient
centrifugation. A and B, analysis of proteins associated with lipid rafts and cytoskeleton in MDA-MB-231 cells. Other
conditions as in Fig. 1.
Mol Cancer Ther 2006;5(2). February 2006
Downloaded from mct.aacrjournals.org on June 18, 2017. © 2006 American Association for Cancer Research.
Molecular Cancer Therapeutics
Figure 4. A, effect of trichostatin A on the expression of selected
membrane, cytoskeletal, and associated proteins in MDA-MB-231 cells.
Cells were treated with 0.5 Amol/L trichostatin A for 48 h, harvested, and
processed as described in Materials and Methods. Note that some Western
blots were exposed much longer than shown in Fig. 1, which caused some
proteins, such as cytokeratins, EBP50, or gelsolin, to be detected in
control MDA-MB-231 cells. Each experiment was repeated at least twice
with similar result. B, effect of trichostatin A on the expression of
adenosine receptor mRNAs determined by reverse transcription-PCR (40
cycles). The sizes of PCR products are as follows: AR1 344 bp, AR2a 305
bp, AR2b 374 bp, AR3 352 bp, glyceraldehyde-3-phosphate dehydrogenase 983 bp, and trypsin inhibitor 407 bp.
membrane and cytoskeletal proteins with the ER status
were reported before, no comprehensive analysis of
membrane and cytoskeletal proteins in a broad cell panel
of breast cancer cells has been done thus far. Among these
proteins, vimentin, EGFR, CD44, fascin, and E-cadherin
were shown to be highly correlated with ER status both in
breast cancer cell lines and in clinical samples (17). EGFR
and vimentin were shown to coexpress in specific subset of
advanced breast carcinoma distinct from both erbB2(+)
and ER(+) cases (17). CD44, moesin, and fascin were also
found to express at higher level in advanced breast cancer
(20 – 22). A number of functional associations between
proteins that overexpress in mesenchymal cells have also
been established. CD44/moesin and CD44/lyn interactions
collaborate in triggering invasiveness and chemoresistance
(23, 24). Vimentin and fimbrin form functional complexes in
macrophages (25). Recent study found a striking correlation
of CD44+ and CD24 cells derived from breast carcinoma
with their tumorigenic potential (26).
Our analysis of the expression of membrane, cytoskeletal,
and associated proteins in 12 breast cancer cell lines show
that there is a consistent shift in expression pattern between
noninvasive and invasive cell phenotypes. The use of widely
characterized cell lines allowed us to directly correlate the
expression pattern with well-defined specific cellular
phenotypes. Remarkably, the expression profile, common
to all six more aggressive cell lines (MDA-MB-435s, MDAMB-231, BT549, Hs578t, MCF-7/Adr2, and MCF-7/c-Jun),
was to large extent recapitulated in normal fibroblasts. The
extent of similarities, including increased expression of
signaling molecules, such as EGFR, PKCa, lyn, and Gai-2,
suggests that both membrane structural proteins and a
number of proteins representing regulatory circuitry has
been adopted from normal mesenchymal cells. The downregulation of EBP50 and gelsolin, two proteins independently associating with actin cytoskeleton, correlate with upregulation of moesin, fascin, and, to a lesser extent, talin and
filamin. EBP50 may associate with ERM proteins (ezrin,
radixin, and moesin) and thereby regulate anchoring of lipid
rafts to cytoskeleton (27). Overall, our results may provide a
direct evidence for epithelial to mesenchymal transdifferentiation in breast cancer.
We found that several membrane proteins residing in
lipids rafts are differentially expressed in invasive breast
cancer cells, suggesting that there is a major remodeling
of this membrane microdomain during breast cancer
progression. Glycosylphosphatidylinositol-linked proteins
are typically considered markers of lipid rafts. In our
study, they show most dramatic shift in expression
profile. The complete down-regulation of CD24 in ER( )
cells and the emergence of ecto-5V-nucleotidase and
alkaline phosphatase most likely have physiologic consequences. CD24 is a new marker for breast and ovarian
carcinoma (28, 29) that coincides with ER(+) status (30).
This mucin-like heavily glycosylated protein was shown
to be a ligand for P-selectin and proposed to mediate
rolling in endothelium (31). On the other hand, ecto-5Vnucleotidase and alkaline phosphatase, which seem to
replace CD24 during breast cancer progression, both have
phosphohydrolase activity and participate in dephosphorylation of extracellular nucleotides (mostly AMPs) and
generation of signaling adenosine (32). Adenosine, the
product of both ecto-5V-nucleotidase and alkaline phosphatase enzymatic activities (19), acting through a family of
receptors, has well-established roles in adhesion, growth
regulation, vasodilation, and angiogenesis. These activities
are likely to be relevant for breast cancer progression
(reviewed in refs. 32, 33). Although ecto-5V-nucleotidase
was also reported to participate in cell adhesion (34, 35),
it is at present unclear how ecto-5V-nucleotidase would
specifically contribute to invasive cell behavior. Nonetheless, increased capacity to generate adenosine on one hand,
and increased expression of A1 and decreased expression
of A3 on the other hand, support the view that adenosine
signaling may have distinct roles in epithelial and
mesenchymal cells. Recent demonstration of increased
ecto-5V-nucleotidase expression and adenosine formation
upon wnt-1 pathway activation further collaborate this
notion (36).
Mol Cancer Ther 2006;5(2). February 2006
Downloaded from mct.aacrjournals.org on June 18, 2017. © 2006 American Association for Cancer Research.
243
244 Lipid Rafts in Breast Cancer
Inhibitors of histone deacetylases, including trichostatin
A, have potent effects on global gene expression, inhibit cell
proliferation, and induce differentiation and apoptosis
(37 – 39). Although histone deacetylase inhibitors caused
changes in many different cell types, mesenchymal cells
were proposed to be particularly sensitive (40). In
particular, previous studies have shown that MDA-MB231 cells induced the expression of E-cadherin and ERa
after treatment with histone deacetylase inhibitor trichostatin A (16). Given the known genome-wide effects of
histone deacetylase inhibitors, such response suggested
that trichostatin A may have induced differentiation, which
in the context of mesenchymal cells may be regarded as
mesenchymal to epithelial transdifferentiation. Indeed, the
expression of most markers that differentiate ER( ) and
ER(+) cells were affected in a reciprocal manner. Thus,
our expression profiling of a broader set of membrane and
cytoskeletal proteins provide a strong evidence for the
mesenchymal to epithelial transdifferentiation after treatment of breast cancer cells of mesenchymal phenotype with
trichostatin A. Previous studies have shown that histone
deacetylase inhibitors increased the expression of metastasis suppressors, such as breast metastasis suppressor 1 (41),
tissue inhibitor of metalloproteinase 3 (42), and nm23 (43)
and thereby may have therapeutic activity in metastatic
phase of breast and other carcinomas. In this context, our
results suggest that such antimetastatic activity, at least in
the subset of ER( ) breast cancer cells, may be due to the
reversion of intrinsically invasive and metastatic mesenchymal phenotype.
Acknowledgments
We thank Dr. Elzbieta Kulig for performing reverse transcription-PCR for
this study.
References
1. Martin KJ, Kritzman BM, Price M, et al. Linking gene expression
patterns to therapeutic groups in breast cancer. Cancer Res 2000;60:
2232 – 8.
2. Daidone MG, Coradini D, Martelli G, Veneroni S. Primary breast cancer
in elderly woman: biological profile and relation with clinical outcome. Crit
Rev Oncol Hematol 2003;45:313 – 25.
3. Le Moyec L, Tatoud R, Eugene M, et al. Cell and membrane lipid
analysis by proton magnetic resonance spectroscopy in five breast cancer
cell lines. Br J Cancer 1992;66:623 – 8.
4. Lavie Y, Cao H, Bursten SL, Giuliano AE, Cabot MC. Accumulation of
glucosylceramides in multidrug-resistant cancer cells. J Biol Chem 1996;
271:19530 – 6.
5. Nohara K, Wang F, Spiegel S. Glycosphingolipid composition of MDAMB-231 and MCF-7 human breast cancer cell lines. Breast Cancer Res
Treat 1998;48:149 – 57.
6. Lucci A, Cho WI, Han TY, Giuliano AE, Morton DL, Cabot MC.
Glucosylceramide: a marker for multiple-drug resistant cancers. Anticancer
Res 1998;18:475 – 80.
7. Wiesner DA, Sweeley CC. Circulating gangliosides of breast-cancer
patients. Int J Cancer 1995;60:294 – 9.
8. Spychala J, Lazarowski E, Ostapkowicz A, Ayscue LH, Jin A, Mitchell
BS. Role of estrogen receptor in the regulation of ecto-5V-nucleotidase (eN)
expression and extracellular adenosine generation in breast cancer. Clin
Cancer Res 2004;10:708 – 17.
9. Smith LM, Wise SC, Hendricks DT, et al. cJun overexpression in MCF-7
breast cancer cells produces a tumorigenic, invasive and hormone
resistant phenotype. Oncogene 1999;18:6063 – 70.
10. Yegutkin GG, Henttinen T, Samburski SS, Spychala J, Jalkanen S.
The evidence of two opposite, ATP-generating and ATP-consuming,
extracellular pathways on endothelial and lymphoid cells. Biochem J 2002;
367:121 – 8.
11. Hostager BS, Catlett IM, Bisghop GA. Recruitment of CD40 and
tumor necrosis factor receptor-associated factors 2 and 3 to membrane
microdomains during CD40 signaling. J Biol Chem 2000;275:15392 – 8.
12. Sommers CL, Byers SW, Thompson EW, Torri JA, Gelmann EP.
Differentiation state and invasiveness of human breast cancer cell lines.
Breast Cancer Res Treat 1994;31:325 – 35.
13. Zajchowski DA, Bartholdi MF, Gong Y, et al. Identification of gene
expression profiles that predict the aggressive behavior of breast cancer
cells. Cancer Res 2001;61:5168 – 78.
14. Walsh MD, Luckie SM, Cummings MC, Antalis TM, McGuckin MA.
Heterogeneity of MUC1 expression by human breast carcinoma cell lines
in vivo and in vitro . Breast Cancer Res Treat 2000;58:255 – 66.
15. Vickers PJ, Dickson RB, Shoemaker R, Cowan KHA. Multidrugresistant MCF-7 human breast cancer cell line which exhibits crossresistance to antiestrogens and hormone-independent tumor growth
in vivo. Mol Endocrinol 1988;2:886 – 92.
16. Yang X, Ferguson AT, Nass SJ, et al. Transcriptional activation of
estrogen receptor a in human breast cancer cells by histone deacetylase
inhibition. Cancer Res 2000;60:6890 – 4.
17. Wilson KS, Roberts H, Leek R, Harris AL, Geradts J. Differential gene
expression patterns in HER2/neu-positive and -negative breast cancer cell
lines and tissues. Am J Pathol 2002;161:1171 – 85.
18. Oliferenko S, Paiha K, Harder T, et al. Analysis of CD44-containing
lipid rafts: recruitment of Annexin II and stabilization by the actin
cytoskeleton. J Cell Biol 1999;146:843 – 54.
19. Picher M, Burch LH, Hirsch AJ, Spychala J, Boucher RC. Ecto 5Vnucleotidase and nonspecific alkaline phosphatase. Two AMP-hydrolyzing
ectoenzymes with distinct roles in human airways. J Biol Chem 2003;278:
13468 – 79.
20. Kaufmann M, Heider KH, Sinn HP, von Minckwitz G, Ponta H, Herrlich
P. CD44 variant exon epitopes in primary breast cancer and length of
survival. Lancet 1995;345:615 – 9.
21. Bankfalvi A, Terpe HJ, Breukelmann D, et al. Gains and losses of
CD44 expression during breast carcinogenesis and tumour progression.
Histopathology 1998;33:107 – 16.
22. Grothey A, Hashizume R, Sahin AA, McCrea PD. Fascin, an actinbundling protein associated with cell motility, is upregulated in hormone
receptor negative breast cancer. Br J Cancer 2000;83:870 – 3.
23. Herrlic P, Morrison H, Sleeman J, et al. CD44 acts both as a growthand invasiveness-promoting molecule and as a tumor-suppressing cofactor. Ann N Y Acad Sci 2000;910:106 – 18.
24. Bates RC, Edwards NS, Burns GF, Fisher DEA. CD44 survival
pathway triggers chemoresistance via lyn kinase and phosphoinositide
3-kinase/Akt in colon carcinoma cells. Cancer Res 2001;61:5275 – 83.
25. Correia I, Chu D, Chou Y-H, Goldman RD, Matsudaira PT. Integrating
the actin and vimentin cytoskeletons: adhesion-dependent formation of
fimbrin-vimentin complexes in macrophages. J Cell Biol 1999;146:831 – 42.
26. Al-Hajj M, Wicha MS, Benito-Hernandez A, Morrison SJ, Clarke MF.
Prospective identification of tumorigenic breast cancer cells. Proc Natl
Acad Sci U S A 2003;100:3983 – 8.
27. Itoh K, Sakakibara M, Yamasaki S, et al. Cutting edge: negative
regulation of immune synapse formation by anchoring lipid raft to
cytoskeleton through Cbp-EBP50-ERM assembly. J Immunol 2002;168:
541 – 4.
28. Fogel M, Friederichs J, Zeller Y, et al. CD24 is a marker for human
breast carcinoma. Cancer Lett 1999;143:87 – 94.
29. Kristiansen G, Denkert C, Schluns K, Dahl E, Pilarsky C, Hoauptmann
S. CD24 is expressed in ovarian cancer and is a new independent
prognostic marker of patient survival. Am J Pathol 2002;161:1215 – 21.
30. Schindelmann S, Windisch J, Grundmann R, Kreienberg R, Zeillinger
R, Deissler H. Expression profiling of mammary carcinoma cell lines:
correlation of in vitro invasiveness with expression of CD24. Tumour Biol
2002;23:139 – 45.
31. Aigner S, Ramos CL, Hafezi-Moghadam A, et al. CD24 mediates rolling
of breast carcinoma cells on P-selectin. FASEB J 1998;12:1241 – 51.
32. Spychala J. Tumor-promoting functions of adenosine. Pharmacol
Ther 2000;87:161 – 73.
Mol Cancer Ther 2006;5(2). February 2006
Downloaded from mct.aacrjournals.org on June 18, 2017. © 2006 American Association for Cancer Research.
Molecular Cancer Therapeutics
33. Merighi S, Mirandola P, Varani K, et al. A glance at adenosine
receptors: novel target for antitumor therapy. Pharmacol Ther 2003;100:
31 – 48.
34. Airas L, Hellman J, Salmi M, et al. CD73 is involved in lymphocyte
binding to the endothelium: characterization of lymphocyte-vascular
adhesion protein 2 identifies it as CD73. J Exp Med 1995;182:1603 – 8.
35. Airas L, Jalkanen S. CD73 mediates adhesion of B cells to follicular
dendritic cells. Blood 1996;88:1755 – 64.
36. Spychala J, Kitajewski J. Wnt and h-catenin signaling target the
expression of ecto-5V-nucleotidase and increase extracellular adenosine
generation. Exp Cell Res 2004;296:99 – 108.
37. Sambucetti LC, Fischer DD, Zabludoff S, et al. Histone deacetylase
inhibition selectively alters the activity and expression of cell cycle
proteins leading to specific chromatin acetylation and antiproliferative
effects. J Biol Chem 1999;274:34940 – 7.
38. Marks P, Rifkind RA, Richon VM, Breslow R, Miller T, Kelly WK.
Histone deacetylases and cancer: causes and therapies. Nat Rev Cancer
2001;1:194 – 202.
39. Fuino L, Bali P, Wittmann S, et al. Histone deacetylase inhibitor
LAQ824 down-regulates Her-2 and sensitizes human breast cancer cells to
trastuzumab, taxotere, gemcitabine and epothilone B. Mol Cancer Res
2003;2:971 – 84.
40. Ailenberg M, Silverman M. Differential effects of trichostatin A on
gelatinase A expression in 3T3 fibroblasts and HT-1080 fibrosarcoma
cells: implications for use of TSA in cancer therapy. Biochem Biophys Res
Commun 2003;302:181 – 5.
41. Meehan WJ, Welch DR. Breast cancer metastasis suppressor 1:
update. Clin Exp Metastasis 2003;20:45 – 50.
42. Gagnon J, Shaker S, Primeau M, Hurtubise A, Momparler RL.
Interaction of 5-aza-2V-deoxycytidine and depsipeptide on antineoplastic
activity and activation of 14-3-3j, E-cadherin and tissue inhibitor of
metalloproteinase 3 expression in human breast carcinoma cells. Anticancer Drugs 2003;14:193 – 202.
43. Yasui W, Oue N, Ono S, Mitani Y, Ito R, Nakayama H. Histone
acetylation and gastrointestinal carcinogenesis. Ann N Y Acad Sci 2003;
983:220 – 31.
Mol Cancer Ther 2006;5(2). February 2006
Downloaded from mct.aacrjournals.org on June 18, 2017. © 2006 American Association for Cancer Research.
245
Lipid rafts remodeling in estrogen receptor−negative breast
cancer is reversed by histone deacetylase inhibitor
Anna Ostapkowicz, Kunihiro Inai, Leia Smith, et al.
Mol Cancer Ther 2006;5:238-245.
Updated version
Cited articles
Citing articles
E-mail alerts
Reprints and
Subscriptions
Permissions
Access the most recent version of this article at:
http://mct.aacrjournals.org/content/5/2/238
This article cites 42 articles, 16 of which you can access for free at:
http://mct.aacrjournals.org/content/5/2/238.full.html#ref-list-1
This article has been cited by 6 HighWire-hosted articles. Access the articles at:
/content/5/2/238.full.html#related-urls
Sign up to receive free email-alerts related to this article or journal.
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Department at [email protected].
To request permission to re-use all or part of this article, contact the AACR Publications
Department at [email protected].
Downloaded from mct.aacrjournals.org on June 18, 2017. © 2006 American Association for Cancer Research.