Plant Cell Physiol. 39(8): 795-806 (1998)
JSPP © 1998
Loblolly Pine (Pinus taeda L.) Contains Multiple Expressed Genes Encoding
Light-Dependent NADPHrProtochlorophyllide Oxidoreductase (POR)
Jeffrey S. Skinner1 and Michael P. Timko 2
Department of Biology, University of Virginia, Charlottesville, VA 22903 U.S.A.
NADPHrprotochlorophyllide oxidoreductase (POR)
catalyzes the light-dependent reduction of protochlorophyllide (Pchlide) to chlorophyllide (Chlide), a key regulatory
step in chlorophyll biosynthesis. In most angiosperms,
POR is encoded by a small nuclear gene family, containing
at least two differentially-expressed genes designated porA
and porB. We have demonstrated that the PORs of loblolly
pine (Pinus taeda L.), a gymnosperm, are encoded by a
large multigene family, composed of two distinct subfamilies encoding porA and porB genes similar to those previously described in angiosperms. DNA gel blot analysis of
genomic DNA showed that the two por subfamilies of
loblolly pine have duplicated at different rates, with the
porA subfamily containing two members, and the porB
subfamily containing at least 11 potential members. DNA
sequence analysis and gel blot hybridization studies also
showed that a subset of the por genes present in the loblolly
pine genome are pseudogenes. Based on the results of 5'and 3-RACE analysis, it appears that multiple porA and
porB genes are expressed in loblolly pine cotyledons and
stems during development. Using gene specific probes, no
difference was observed in the steady-state levels of the
different porA and porB transcripts in cotyledons of darkgrown seedlings before and following illumination. However, the steady state levels of the porA and porB transcripts were found to increase at different rates in the stems
of dark-grown seedlings following illumination. The phylogenetic relationship between the por gene family members
in P. taeda and other pine species and the potential significance of the two por subfamilies to the evolution of por
gene function are discussed.
Key words: Chlorophyll — Loblolly pine — Molecular
evolution — Pinus strobus — Pinus taeda — Protochlorophyllide oxidoreductase (EC 1.6.99.1).
Loblolly pine (Pinus taeda L.) is the major forest tree
Abbreviations: UTR, untranslated region.
The nucleotide sequences reported in this paper have been
submitted the GenBank under accession numbers AF027337
through AFO27356.
1
Current address: Department of Forest Science, Oregon State
University, Corvallis, Oregon 97331-7501, U.S.A.
2
Author to whom correspondence should be addressed.
utilized commercially in the United States for the production of wood and paper products (Moffat 1996). Because of
its economic importance, loblolly pine has been the focus
of intensive biochemical and genetic investigation in recent
years. Studies are currently underway in a large number of
laboratories aimed at denning the structure and organization of gene families within the loblolly pine nuclear
genome and the factors required for their differential regulation throughout development. Despite this effort, relatively little is known about the mechanism(s) for temporal,
spatial, and environmental (i.e., light, temperature, etc.)
regulation of gene expression in this and other gymnosperm species, and how the mechanisms for regulation
present in gymnosperms compare to those described for angiosperms. To begin addressing these questions, we have
been examining the structure and expression characteristics
of gene families in loblolly pine involved in the biosynthesis
and accumulation of chlorophyll and its derivatives.
Our understanding of how chlorophyll biosynthesis is
regulated in angiosperms and the role its formation and accumulation play in the regulation of chloroplast development and overall plant photomorphogenesis have advanced considerably in recent years (Reinbothe and Reinbothe
1996a, b, Fujita 1996). It is now generally accepted that
chlorophyll formation is regulated, at least in part, by the
reduction of protochlorophyllide (Pchlide) to chlorophyllide (Chlide). Two distinct biochemical routes for Pchlide
reduction have evolved in nature. One mechanism, found
in cyanobacteria, green algae, non-vascular plants, gymnosperms, and angiosperms, is catalyzed by the enzyme
NADPH:protochlorophyllide oxidoreductase (POR, EC
1.6.99.1). POR is completely dependent on light for its activity and is the dominant pathway for chlorophyll formation in plants. The second mechanism to evolve reduces
Pchlide to Chlide in a light-independent manner. This
mechanism is thought to be evolutionarily older because of
its occurrence in the purple bacteria (Bauer et al. 1993,
Fujita 1996), as well as the cyanobacteria, green algae,
non-vascular plants, and gymnosperms. Light-independent
Pchlide reduction is conspicuously absent in angiosperms.
Although the biochemistry of light-independent chlorophyll formation is unknown, at least three distinct gene
products encoded in the choroplast DNA in photosynthetic
eukaryotes have been identified that are required for this
process (Fujita 1996).
When grown in total darkness, most angiosperms accu795
796
Multiple expressed por genes in loblolly pine
mulate large amounts of Pchlide in their cotyledons and
primary leaves as part of a ternary complex formed by
POR and its cofactor NADPH in the prolamellar body of
etioplasts. It has been known for many years that POR
abundance and activity decreases rapidly upon exposure
of etiolated tissues to light (Santel and Apel 1981). This
decline is regulated in part by proteolytic turnover of
the enzyme following Pchlide photoconversion (Kay and
Griffiths 1983, Griffiths et al. 1985), and is correlated with
both a phytochrome-controlled loss of translatable mRNA
encoding the protein and decreased rates of por gene transcription (Apel 1981, Batschauer and Apel 1984, Mosinger
et al. 1985). The loss of POR protein and activity in
etiolated tissues following illumination appears to be an
almost universal response among vascular plants, although
variation in the extent and rapidity of the decline has been
observed among monocot, dicot, and gymnosperm species
(Reinbothe and Reinbothe 1996a, b, Reinbothe et al.
1996a). The accumulation of por mRNA and protein has
also been shown to be influenced by developmental age
and/or stage of plastid differentiation (Spano et al. 1992a,
He et al. 1994).
The rapid disappearance of POR protein and enzymatic activity during light-induced development was
enigmatic, since it was inconsistent with the observed continued formation of chlorophyll after extended periods of
illumination and chlorophyll synthesis in mature, fully
greened tissues (Mapleston and Griffiths 1980, Kay and
Griffiths 1983, Griffiths et al. 1985). This apparent contradiction was resolved by the demonstration that two
forms of the enzyme are present in most plants. These
forms, termed PORA and PORB, differ in their expression
pattern, abundance, and activity during light-induced development (Holtorf et al. 1995, Armstrong et al. 1995, Runge
et al. 1996). PORA is the predominant form of the enzyme
present in etiolated tissues and along with its substrates,
Pchlide and NADPH, accumulates to high levels in the prolamellar bodies of etioplasts. Since the amounts of PORA
protein and the mRNA that encodes it decrease dramatically upon illumination, it is thought that PORA functions
only during the very early stages of greening. PORB is
thought to be responsible for the reduction of Pchlide during the later stages of greening, and for chlorophyll formation in mature, green tissues. PORB is present only in
minor amounts in the thylakoid membranes of developing
and mature chloroplasts and its expression appears to be
constitutive throughout development. In contrast, transcription of the por A gene is negatively regulated by phytochrome (Holtorf et al. 1995, Armstrong et al. 1995). In
addition to differing in their expression pattern and abundance during light-induced development, in vitro import
studies performed with radioactively-labeled PORA and
PORB precursor polypeptides from barley have shown that
import of prePORA, but not prePORB, is Pchlide-depend-
ent (Reinbothe et al. 1995a, b, 1996b).
We have previously reported the isolation and characterization of a nuclear gene (LP2) encoding a POR from
loblolly pine (P. taeda L.) and two expressed cDNAs encoding this protein from white pine {P. strobus L.) (Spano
et al. 1992a). Two forms of POR have also been reported in
mountain pine (P. mugo) (Forreiter and Apel 1993). In this
latter study, the two por genes were reported to be differentially regulated in response to light treatment in a manner
similar to that observed for the porA and porB genes
present in angiosperms. The identification of two differentially expressed por genes in pine species suggests that the
divergence of the por A and porB genes, or their predecessors, may have occurred prior to the divergence of gymnosperms and angiosperms. This has been suggested to be the
case for several other gene families in pine whose homologs
were first identified in angiosperms (e.g., cab (Jansson and
Gustafsson 1990, Chinn and Silverthorne 1993, Yamamoto
et al. 1993, Chinn et al. 1995, Peer et al. 1996) and phy
(Thummler and Dittrich 1995)).
In this present study, we report our results on the further characterization of the por gene family in loblolly
pine. We demonstrate that multiple por genes are present
in the loblolly pine genome and that a subset of these are
differentially expressed in the cotyledons and stem during
seedling development. Our studies suggest that the gene duplication events that subsequently led to specialized functions for various por gene family members in angiosperms
may have already occurred in pines, a less evolutionarily advanced species. The phylogenetic relationship between the
por gene family members in P. taeda and other pine species
and the potential significance of the two por subfamilies to
the evolution of por gene function are discussed.
Materials and Methods
Plant growth and tissue sample preparation—Seeds of loblolly pine (Lots WV103 and WV116, kindly provided by Westvaco
Corp., Summerville, SC) were vernalized for a minimum of 6
weeks in the cold (6-8°C), disinfected with 1% (v/v) H 2 O 2 for 1 h,
and planted in moistened vermiculite. Seedlings were grown at 2528CC in complete darkness or under constant white light (150 W
cm" 2 ; 8,000 lux) for 14 d post-germination. Under our growth
conditions, germination usually occurred within 7-10 d after planting. For light regulation experiments, 14 day-old dark-grown
seedlings were transferred to constant white light for the various
time periods specified in the Results prior to harvesting. For all
growth conditions, the harvested tissue was frozen immediately
in liquid N2, processed immediately or stored at — 80°C until
utilized. Dark-grown tissue was harvested under dim green
safelights.
Genomic DNA isolation and gel blot analysis—Loblolly pine
genomic DNA was prepared by the method of Devey et al. (1991),
with the following modifications: insoluble polyvinylpolypyrrolidone (Sigma) was added to 1.5% (w/v) in the extraction buffer
and chloroform : isoamyl alcohol (24 : 1) was used for organic extractions. Needles of a single one year-old greenhouse grown
Multiple expressed por genes in loblolly pine
plant, that had been dark-adapted for three days to decrease carbohydrate content, was used as starting material.
Total genomic DNA was digested with Dral, EcoRl, Hindlll,
Nsil, or Xbal for 8-12 h using 10 units of restriction enzyme per
fig of DNA. Electrophoretic separation of the digested genomic
DNA (20 tig lane"1) was done in 0.8% agarose/1 x TAE gels and
the resolved DNA was transferred to Nytran nylon membrane
(Schleicher and Schuell) under alkaline conditions (Sambrook et
al. 1989). Blots were prehybridized, hybridized, and washed as described in Devey et al. (1991). Following the final wash, blots were
scanned using a Molecular Dynamics phosphorimager. For reprobing, the blots were stripped according to the manufacturer's protocol (Schleicher and Schuell), then prehybridized, hybridized and
washed as above.
5'- and 3'-RACE analysis of mRNA transcripts—Total RNA
was isolated from dark-grown cotyledons by the method of Chang
et al. (1993). The 5'- and 3'-ends of the por transcripts were determined by rapid amplification of cDNA ends (RACE). For 5RACE analysis, the 5-RACE System (Gibco-BRL) was used according to the manufacturers protocol. First strand cDNA synthesis was carried out on 1 fig of total RNA from 14 d old
dark-grown cotyledons using a gene-specific primer [PINE.027;
5 -CCCGGATCCAGTCTGTGCCCTTATTCT-3'). Following first
strand cDNA synthesis, reaction products were purified and tailed
with dCTP. A portion of the cDNA was then amplified in reactions containing 2 fil cDNA, 1 x Taq Polymerase reaction buffer
(Boehringer Mannheim), 200 fiM dNTPs, 2.5 units Taq polymerase (Boehringer Mannheim), and 125 ng each of the poly(dC)-adapter primer (Gibco-BRL) and the PINE.027 primer. One
microliter of a 100-fold dilution of the amplification products
were reamplified as above except that a different gene-specific
primer (PINE.020; 5'-CCTAGAAAAGCTGAATCCTT-3') was
used to nest the reactions. Both the first and second round
amplifications were done as follows: 6 min at 94°C followed by
35 cycles of denaturation at 94°C for 45 s, annealing at 50°C for
60 s, and extension at 72°C for 90 s, and a final extension period
of 5 min at 72°C. A portion of the reaction was subjected to DNA
gel blot analysis (Sambrook et al. 1989) using an4/?III/.PvMlI fragment derived from the LP2 genomic clone (Fig. 1) as probe. The
remaining portion of the reaction was treated with the Klenow
fragment of DNA Polymerase I and an aliquot of the reaction
separated on a 1% (w/v) low-melting agarose gel (FMC BioProducts). The hybridizing bands were excised and subcloned into
the Smal site of pBluescript KS(—) (Stratagene). Individual positive clones were identified under high stringency conditions by a
colony screen (Sambrook et al. 1989), isolated, and sequenced.
To determine the 3' end of the transcripts, the same darkgrown cotyledon total RNA was used in a 3-RACE protocol
(Frohman et al. 1988) using a poly-d(T)-adapter primer [5'-GGTCGACGCGGCCGCTCTAGA(T)17-3l for first strand cDNA
synthesis. First round amplifications were done as described above
using a gene-specific primer (PINE.016; 5-GAGAAGCTTGTTGGACT-31 and the poly-d(T)-adapter primer in the reaction. Second round amplifications were done using the same primer set or
nested using the PINE.014 primer (5-TACCCAGGATGCATTGC-31 instead of PINE.016. Amplified fragments were purified
by electrophoresis, cloned into a pBluescript plasmid, and analyzed by sequencing.
Gel blot analysis of total RNA— Total RNA was isolated
from pine tissues by the method of Chang et al. (1993). For gel
blot analysis, either 20 ng (blots hybridized with por coding region
probe) or 40//g (blots hybridized withpoM and porB specific probes) of total RNA was fractionated on formaldehyde-agarose gels
797
and transferred to Nytran nylon membranes (Schleicher and
Schuell) by the method of Fourney et al. (1988). Filters were prehybridized in 50% (v/v) formamide, 5 x SSPE, 0.1% (w/v) SDS, 5 x
Denhardt's medium, and 100 fig ml"' salmon sperm DNA at 42°C
for 1-2 h, then hybridized in the same buffer containing 32P-dCTP
labeled probe at 42°C for 16-24 h. Blots were washed twice in 1 x
SSC, 0.1% (w/v) SDS at 23°C, then twice in 0.1 xSSC, 0.1%
(w/v) SDS at 23°C or 37°C.
Nucleic acid sequencing and analysis—Dideoxynucleotide sequencing was carried out using Sequenase Version 2.0 according
to the manufacturer's protocol (United States Biochemical) on
double-stranded plasmid DNA templates. Plasmid DNA for sequencing was prepared either by the method of Stephen et al.
(1990) or utilizing the Qiaprep Spin Plasmid Kit (Qiagen).
Preparation of probes—For RNA and DNA gel blot analysis,
a 1.67 kb i?coRI-///rtdIII fragment of the LP2 gene encompassing
Exons III through V (see Fig. 1) was prepared. This fragment
should be capable of detecting all possible por family members. A
350 bp EcoKl fragment encoding a portion of the P. taeda 18S
rRNA (A. J. Spano, unpublished) was used as control in the RNA
gel blot analyses. Restriction fragments used as probes were purified by electrophoresis through low melting agarose gel (FMC BioProducts) and radiolabeled with 32P-dCTP using the Random
Primed DNA Labeling Kit (Boehringer Mannheim). Single-stranded hybridization probes specific for the porA and porB genes/subfamilies were prepared from the 3-UTRs of the por A and porB
cDNAs contained on plasmids pPt3"UTR.2 and pPt3tJTR.l, respectively, and the corresponding 3-UTR of LP11 contained on
the plasmid pLPGENll-lF (see Fig. 1) using the Prime-A-Probe
DNA labeling system (Ambion) and gene-specific antisense
primers. To verify probe specificity, sense RNAs were synthesized
in vitro using gene-specific sense primers and 3H-UTP for the purpose of transcript quantification (Sambrook et al. 1989).
Phylogenetic analysis—PILEUP alignments, parsimony analysis, Fitch and Margoliash plots, and the neighbor-joining method of tree construction were performed using the PHYLIP 3.5
program available through the GCG package (University of
Wisconsin, Madison WI). For alignments a GapWeight of 1.0 and
a GapLengthWeight of 0.2 were used.
Results
Multiple expressed cDNAs encode POR in loblolly
pine—We reported previously the isolation and characterization of a nuclear gene (LP2) from loblolly pine (P. taeda)
encoding a POR protein in this species (Spano et al.
1992a). In this same study, we also showed that white pine
(P. strobus) expressed a homolog of LP2 (represented by
the cDNA pWPnPCR-373) and at least one other highlyrelated por gene product (represented by the cDNA
pWPnPCR-901). The two white pine cDNAs, pWPnPCR373 and pWPnPCR-901, are 9 1 % identical at the nucleotide level within their protein coding regions, but differ
within their 3'-UTR. To further analyze the number of expressed genes present in the loblolly pine genome, a series
of 5'- and 3'-RACE experiments were carried out and the
resulting cDNAs generated in these studies isolated and
characterized. Oligonucleotide primers, designed to recognize conserved regions in Exons I and II of the LP2 gene
(Fig. 1,2A), were used to prime 5-RACE reactions contain-
798
Multiple expressed por genes in loblolly pine
51 RACE
por Coding Region
porA-specific
porS-specific
1kb
LPU-spedfic
Fig. 1 Structure, organization, and partial restriction map of the loblolly pine LP2 gene encoding POR. The open boxes denote the 5'and 3-UTRs, the shaded boxes indicate the transit peptide coding portion, and the black boxes indicate the coding portion of the mature
POR protein. The location of the sequences used for the preparation of the coding region, porA-, porB-, and LP11-specific hybridization probes used in the various genomic DNA and RNA hybridization analyses are indicated in the figure relative to their position on the
LP2 gene. The approximate location of the 5- RACE products are also shown.
cleotide sequences of the cloned cDNAs completely determined. The various cDNAs differed in length, as well as nucleotide sequence, and could be easily grouped into two
categories based upon the presence (designated porB-l) or
absence (designated porB-ll) of a short (29 nucleotide)
insertion/deletion immediately upstream of the starting
methionine codon when compared to the LP2 gene sequence
(Fig. 2A, B). The porB designation was used in nam5Obp
ing these two groups since in our earlier analysis of LP2
n i i
1
mRNA accumulation we found that its expression more
closely resembled that observed for porB genes in angiosperms (Spano et al. 1992a, Skinner and Timko, manuscript in preparation). Based on nucleotide substitutions
porW
B.
and end points of the cDNAs, six different porB-l and five
different porB-ll forms were found. All of the porB-ll
cDNAs contained the same subset of base substitutions
relative to the porB-l cDNAs and the LP2 gene (Fig. 2B).
The 5' ends of the longest of the porB-l and porB-ll
cDNAs initiated 28 nucleotides 3' with respect to the most
distal TATA-like element present in the LP2 gene promoter region (Fig. 2). A transcription initiation site at this
location is within the appropriate distance for RNA Polymerase H-transcribed genes (Joshi 1987). All twenty of the
5-RACE products examined lacked sequences correspondFig. 2 Sequence and organization of the 5'-UTR of loblolly pine
ing to the first intron present in the LP2 sequence, inporB cDNAs. Representative porB-l and porB-ll cDNAs appear
in the GenBank Nucleotide Sequence Database under the accesdicating that they had arisen from processed mRNA. The
sion numbers AF027338-AF027347. (A) Diagram of the 5' flankshorter cDNAs were most likely the result of incomplete exing region of the LP2 gene indicating the location of potential trantension during the RACE procedure. We cannot rule out
scriptional control sequences (CAAT box and TATA box) and
the
possibility that they arose as a result of alternate transtructure of the porB-l and porB-ll cDNAs. The stippled box
scription start sites from other por family members in the
preceding Exon I represents the 29 bp region missing in the porBll clones. The location of the oligonucleotide primer (PINE.020)
loblolly pine genome.
used for 5-RACE is shown. Note in the figure Intron I is not
The 29 nucleotide insertion/deletion located within
shown and only the relevant portion of Exon II is included. (B)
the 5'-UTR does not contain any apparent intron/exon
Alignment of the relevant portions of the 5'-UTRs and coding seborder sequences. Therefore, we believe it is unlikely that
quences of the LP2 gene and representative porB-l and porB-ll
this region is a mini-intron that has failed to be spliced
cDNAs. The coding portion of the LP2 sequence is underlined.
from the mRNA (Mount 1982). Whether the presence or
The position of Intron I is indicated and (••) denote this processed portion of the 5'-RACE cDNAs. Colons denote conserved
absence of this region in the 5'-UTR influences the postbases.
transcriptional properties of the messages is not known.
ing total RNA isolated from the cotyledons of dark-grown
seedlings as template. Following amplification and electrophoresis of the reaction products, the amplified fragments
were isolated and cloned into pBluescript KS(—) vectors.
Twenty independent recombinants were chosen and the nu-
CAAT
Box
TATA-Ulo
Boxes
porB-l
LP2
I
ACTCATATTTTOTCaMCCTOTCACCGTOTTAOCAOOTTCAAOTACATAAGTOAOAGTAOAC
porB-l
porfl-II
: : : : ! ! : : :
C: : : : : : : : : : :
t:
::••••
:J : : : : : : : = !
:::r :
: : : :G: : : :
LP2
GOOAACAOATTCTCATCCACKOGAGOAAAATrcAAAGTTTOaATTACTACGCCAGCJAGGAOO
porS-I
::::::
:••:
porfl-U
:
::::;:
:::::
: : : : :C
::::
:
: : : : : : : : : : : : : : :
: : : : : : : :
LP2
porfl-I
porB-II
AGGAACCTCGAGGCAGCTTCGCTTCGTCTTCAATTATGCGGACACTCCTTCAAACACACATA
: : : : : : : : 1: : : : : : : : : : : : : : : : : : : : :
i : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : :
: : • :C
:
: : : : : : : ! : : : > : : :
LP2 I
porB-1
porB-H
G G C T L l l V r m C A T T T C C T C T G C A A A A A G A G » I n t r o n I«GGAGGACATAGTGCTTCTGCA
: : : : : : : : : : : : ! : : : : : : : : : : : : : : : :
• • • : : : : : : : :
::::::::
: : : : : : :
: : C : : : : : : :
:
:
::::::::::
Multiple expressed por genes in loblolly pine
The sequence itself does not show any tendency to adopt
a stable secondary structure. However, immediately upstream of this region are four direct AGG trinucleotide
repeats of unknown functional significance.
On the basis of the 5'-RACE data described above, it
appears that at least one other por gene, closely related to
LP2 is transcribed in loblolly pine. Since the primer used
for these studies was likely to be biased towards transcripts
closely related to LP2, we also carried out experiments using oligonucleotide primers based on the coding sequences
of the LP2 gene in the conserved regions in Exon IV
(primer PINE.016) and Exon V (primer PINE.014). These
primers were then used in 3'-RACE reactions containing
total RNA from the cotyledons of dark-grown seedlings as
template as described in the Materials and Methods.
Following PCR amplification and electrophoresis of
the reaction products, fragments of the expected sizes were
isolated and subcloned into pBluescript KS(—) vectors.
Following initial characterization, four clones were chosen
and their nucleotide sequence determined. These clones
were divided into two classes based on the sequence of their
3'-UTR and their similarity to the white pine cDNAs encoded in pWPnPCR-373 and pWPnPCR-901 (Fig. 3). All of
the reaction products amplified using the PINE.016 primer
contained a portion of Exon IV and had the intron between
Exon IV and Exon V spliced out, indicating that they had
arisen from mRNA. Two of the cDNAs, p3T<:R.3 and
p3'PCR.4, were identical to each other and homologous to
both the LP2 genomic sequence and the white pine cDNA
pWPnPCR-373. In keeping with our designation of the 5'RACE products, these were classified as porB types. The
coding sequences contained in p3'PCR.3/p3'PCR.4 are
identical to that of LP2, whereas five mismatches are found
between the sequences of the p3'PCR.3/p3'PCR.4 clones
and the LP2 gene in the 3'-UTR. These mismatches may
indicate the presence of a highly related LP2 homolog in
the loblolly pine genome, or they may reflect polymorphic
differences between seed lots, since the genomic library
used to isolate LP2 by Spano et al. (1992a) was prepared
from a different lot of loblolly pine seed than that utilized
for this present work. Alternatively, they could be the
result of cloning artifacts.
The two other cDNAs cloned, p3'PCR.l and
p3'PCR.2, were nearly identical, except that p3'PCR.l contained an additional 12 nucleotides in its 3'-UTR just
before the poly (A)n tail. These cDNAs likely represent transcripts from the same gene which have used different sites
of polyadenylation (Li and Hunt 1995). They share only
74% similarity in nucleotide sequence in their 3'-UTR with
the porB type of cDNAs described above. The most obvious structural feature distinguishing the two classes
of transcript is the presence of a 10 nucleotide insertion
in the p3'PCR.l and p3'PCR.2 transcripts (Fig. 3). The
two cDNAs are homologous to the white pine cDNA
799
LP2
3PCR3
3PCR1
3PCR2
TGCTTGAAGT
TGCTTGAAGT
TGCATGAAAT
TGCATGAAAT
TCTCCTATAT
TCTCCTATAT
TCTCCAACGT
TCTCCAACGT
TGTCAAGATT
TGTCAAGATT
TGTCAAGATT
TGTCAAGATT
ATGTGTACAT
ATGTGTACAT
AT. . .AGCAT
AT...AGCAT
LP2
3PCR3
3PCR1
3PCR2
TAGGTAGGTC
TGGGTAGGTC
TAGTTAACTC
TAGTTAACTC
AAGATGCCAA
AAGATGCCAA
.AGCTGCCAT
.AGCTGCCAT
ATATTGGTGT
ATATTGGTGT
ATCTTTGTAT
ATCTTTGTAT
G . . TTTTGTA
G..CTTTGTA
GCATTTCGTA
GCATTTCGTA
LP2
3PCR3
3PCR1
3PCR2
GGGTGGAGGA
GGGTGGAGGA
GGGTGGAGGA
GGGTGGGGGA
TTTAGTTTCA
TTTAGTTTCA
TCTAGTTTCA
TCTAGTTTCA
TGTAGAAAAA
TGTAGAAAAA
GGTAGAAATA
GGTAGAAATA
TCAGAAGAGA
TCAGAAGAGA
TGAGAAGAGA
TGAGAAGAGA
LP2
3PCR3
3 PCR1
3 PCR2
AACAGATCTA
AACAGATATA
CATGGAAATA
CATGGAAATA
AATTACTCTG GACTTTTGTG CATGTTTTCA
AATTACTCTG GACTTTTGTG CATGTTTTCA
AATTACTC
GG CATGCTTTCA
AATTACTC
GG CATGCTTTCA
LP2
3PCR3
3PCR1
3PCR2
TTGCAGCGCT
TTGCAGCGCT
TTGCAGAGCC
TTGCAGAGCC
TACTTCGGTA
TACTTCGGTA
TACTTTTGTA
TACTTTTGTA
CTGAGTGGTC
GTGAGTGGTC
GCGACTGGTA
GCGACTGGTA
ATTGAAAAAT
ATTGAAAAAT
ATTCAAAAGA
ATTCAAAAGA
LP2
3PCR3
3PCR1
3PCR2
TTTCTTTGAT
TTTCTTTGAT
TTTCTTGCAA
TTTCTTGCAA
TGTGTAATC
TGTGTAATC
TGCGTAATG
TGCGTAATG
AGGTTAAATT
AGGTTAAATT
AGGTTAAATT
AGGTTAAATT
G 3TCGCAGTT
G 5TCACAGTT
G ^TCGGAGGT
G VTCGGAGGT
LP2
3PCR3
3PCR1
3PCR2
TATATTCTTT TGACTCTCAA TT
TATATTCA
TATATCGTTC TAGA.
TA.
Fig. 3 Alignment of the 3-UTRs of the various por cDNAs and
LP2 gene. The nucleotide sequences of the LP2 gene and various cDNAs (pS'PCR.l—3PCR1, accession number AF027348;
p3"PCR.2—3PCR2, accession number AF027349; and p3'PCR.3
—3PCR3, accession number AF027350) derived from the 3RACE analysis using the PINE.014 primer are shown. Sequences
given extend to the poly (A)n tail. The termination codon of the
POR coding region is shown in bold and the potential polyadenylation signal is boxed. The beginning of the poly (A)n tail is designated by the bold underlined A. The asterisks denote the conserved
gaps observed between all known pinepoM and porB 3-UTRs.
pWPnPCR-901 (Spano et al. 1992a). We have assigned this
group of loblolly pine cDNAs the porA designation. The
por A and porB type transcripts not only differ structurally,
but also show subtle differences in their expression in
young loblolly pine seedlings (see below). Such a designation would also seem appropriate based on our observation
that the porB transcripts (e.g., p3TJCR.3/p3'PCR.4) account for the majority of the mRNAs encoding POR in
mature needles of 1-2 year-old loblolly pine trees, whereas
por A transcripts (e.g., p3'PCR.l and p3"PCR.2) constitute
only a small fraction of the total mRNA in these tissues
(Skinner and Timko, manuscript in preparation).
800
Multiple expressed por genes in loblolly pine
The combined results of the 5'- and 3'-RACE analysis
clearly show that multiple por genes are expressed in loblolly pine, consistent with the earlier observations of Spano et
al. (1992a). Our studies also show that like angiosperms the
por genes in loblolly pine can be divided into two subfamilies which we have assigned the designation of porA-type
andporB-type. At least one por A and two porB genes are
being expressed in dark-grown pine cotyledons.
Complexity of the por A and porB gene families in
loblolly pine—To estimate the complexity of por gene family in loblolly pine, genomic Southern blot analysis was carried out using hybridization probes capable of recognizing either coding sequences within most or all por family
members or genomic fragments containing the 3'-UTRs of
porA- or porB-type genes (see Fig. 1). To avoid possible
confounding effects that could arise as a result of polymorphisms in genomic structure among individual plants
(Devey et al. 1991), the total genomic DNA used in these
studies was isolated from the cotyledons of a single oneyear old loblolly pine tree. As shown in Fig. 4A, when the
Southern blots were hybridized with a coding region probe
capable of detecting por coding sequences, multiple hybridizing bands were identified under high stringency washing
conditions. A large number of hybridizing fragments persist regardless of which enzyme was used to restrict the
DNA. The size of the por LP2 gene is approximately 3.8 kb
Coding
•a 3 i
D
W
£
including the immediate 5- and 3'-UTR and introns. Based
on the EcoRl digest, at least eleven hybridizing bands are
potentially large enough to encode full-length por genes.
Whether all of these contain full length genes is unknown.
Reducing the stringency of the washing conditions did not
reveal additional bands (data not shown).
To discern which of the hybridizing bands also contain
sequences specifying the por A and porB subfamilies,
single-stranded hybridization probes were generated that
were 69% identical and capable of only detecting the 3'UTRs of either the porA- or porB-type genes (Fig. 1, 4).
The porB-specific probe hybridized to a large subset of the
bands hybridizing with the coding region probe (Fig. 4B).
Since there is no overlap between the por coding region probe and the porB-specific probe, the hybridization pattern
varied depending on the particular enzymes used to digest
the DNA. Using the EcoRl digested DNA sample as a
guide, eleven bands hybridized to the porB probe, all of
which are potentially large enough to contain full length
genes. When the same blot was hybridized with a probe
capable of specifically detecting porA -type sequences, only
two hybridizing bands were observed, suggesting that this
subfamily is by comparison smaller (Fig. 4C). This difference can not be attributed to cross hybridization between
the probes, since control blots of in vitro synthesized sense
RNAs prepared from the porA- and /?ori?-specific se-
porB
i r
X
!
' '
a 2
porA
LPll
2
s
X
23'
9.4
6.6
4.4
23'2.0"
0.6
Fig. 4 Genomic DNA hybridization analysis of the por gene family in loblolly pine. Total genomic DNA from loblolly pine (20 ng
lane~') was digested with the restriction enzymes indicated, fractionated by agarose gele electrophoresis and transfrered to nylon membranes as indicated in the Materials and Methods. The membranes were then hybridized with 32P-labeled probes capable of detecting all
POR coding sequences (Panel A—Coding), only the porB ox porA subfamilies (Panel B—porif-specific and Panel C—porA-specific, respectively), or the 3-UTR of the LPll pseudogene (Panel D—LPll) as indicated in Figure 1. Size markers in kb are indicated.
Multiple expressed por genes in loblolly pine
quences showed no cross hybridization between the two
probes under conditions identical to those used for the
genomic Southern blot analysis (data not shown). While
the bands hybridizing with the porA-type gene specific
probe were of equal intensity, those detected by the porBspecific probe displayed different intensities. The observed
variations in hybridization intensity most likely reflect the
degree of nucleotide sequence divergence among the subfamily members and/or differences in gene copy numbers.
Similar observations have been made in the analysis of
other pine gene families (Kinlaw et al. 1990, 1994).
In the process of screening the loblolly pine genomic
library for additional por genes, a phage (designated LP11)
was isolated that contains sequences 87% similar to the Exon V coding region of LP2. In LP11, the Exon V coding sequences contain a base substitution that introduces a premature stop codon into the open reading frame encoding
the POR homologous sequences and a nucleotide insertion
that causes a frameshift mutation resulting in two additional stop codons in succession (Fig. 5). Although the remaining portion of Exon V sequence is unaltered, the nucleotide
LP2
V
V
S
N
P
S
L
T
K
S
G
V
Y
W
LPll
V
V
N
D
P
S
L
T
K
S
G
V
Y
W
LP2
GTTGTGAGTAATCCAAGTTTGACCAAGTCCGGTGTATATTGG
LP11
GTTGTTAATGATCCAAGTTTGACCAAGTCCGGTGTATATTGG
LP2
S
W
N
N
N
S
A
S
F
E
N
Q
L
S
LPll
S
W
N
N
D
S
T
S
F
E
N
Q
L
S
801
insertion changes the reading frame such that the normal
termination codon is no longer used. No similarity to
known por sequences or any other gene present in the
Genbank/EMBL database was found in the 2.2 kb region
upstream of the LP11 Exon V homologous regions, and no
obvious sequence homology to either of the por subfamilies isolated and described above was found for the sequences located downstream of this region (i.e., the analogous 3 -UTR). Therefore, we concluded that LP11 must be
a por pseudogene. To confirm that L P l l arose from sequences present in the loblolly pine genome and not as a
cloning artifact during construction of the genomic library,
Southern blot analysis was carried out with a hybridization
probe prepared from the L P l l clone that contained
sequences analogous to the 3-UTR of the LP2 gene
(see Fig. 1). When this probe was hybridized to the same
genomic Southern blots used in the studies described
above, 2-4 hybridizing bands were observed (Fig. 4D), including fragments of identical size to those found in the
porB
porA
Pml
Pt3PCR:
LP2
AGCTGGAATAACAACTCGGCTTCCTTTGAGAATCAGTTATCT
LPll
AGTTGGAACAACGATTCAACTTCCTTTGAGAACCAGTTATCT
LPll*
LP2
LPll
I
E
E
A
E
Z
S
A
D
P
E
K
A
K
K
S
D
P
G
K
A
K
K
N
W E
L W E
M
G
LP2
GAAGAAGCCAGTGATCCCGAGAAAGCTAAAAAAT-TATGGGA
LPll
GAATAAGCCAGTGATCCAGGCAAAGCTAAAAAAAATATGGGA
LPll*
LP2
LPll
S
V
K
S
S
^
E
E
^
K
K
E
L
L
A
V
V
C
G
G
R
L
L
T
A
A
C
Z
Z
L
R
LP2
AGTTAGTGAAAAGCTTGTTGGACTTGCTTGA
LPll
AAGTAGTGAGAAGCTTGTCGGACTTGCTTGA
Fig. 5 Coding sequences in the loblolly pine LPll pseudogene.
Shown is an alignment of the nucleotide and derived amino acid sequences of the LPll pseudogene (GenBank accession number
AF027337) with Exon V of the LP2 gene. Stop codons are noted
in bold and underlined. The single base insertion in LPll is double underlined. LP11* shows the shifted reading frame affected by
the base insertion that is still highly conserved to por.
Ps373
Pt3012s
Fig. 6 Parsimonious unrooted phylogenetic tree showing relationship among thepor genes from three pine species. The relationship among the por genes from three pine species is shown based
upon a comparison of nucleotide sequences in their 3-UTRs. The
values at the nodes indicate the number of times a particular branching occurred out of 100 bootstrap datasets. In the tree, sequences derived from P. taeda, P. strobus, and P. mugo are designated as Pt, Ps, and Pm, respectively. Abbreviations and
references are: Pt3PCRl, Pt3PCR2, and Pt3PCR3 {P. taeda
cDNA clones 3TPCR.1, 3 * ^ . 2 , and 3'PCR.3, respectively, this
work); PtLP2, Ps373, and Ps901 (P. taeda genomic clone LP2,
P. strobus cDNA clones pWPnPCR-373 (GenBank accession number AF027355), and pWPnPCR-901 (GenBank accession number
AF027356), respectively, Spano et al. 1992a); PsCT clones
(P. strobus cDNA clones, A.J. Spano, unpublished, GenBank accession numbers AF027351-AF027354); Pt3012s (P. taeda cDNA
clone PtIFG-3012s, C.S. Kinlaw, GenBank accession number
H75262); and Pml and Pm2 {P. mugo cDNA clones pPml and
pPm2; Forreiter and Apel 1993).
Multiple expressed por genes in loblolly pine
802
phage DNA. Hybridization of the LP11 probe to RNA prepared from the cotyledons and stems of pine seedlings did
not detect any expressed RNA (data not shown), suggesting
that this is an unexpressed pseudogene. Therefore, it is possible that some of the bands hybridizing with the por
probes in the Southern analysis may not contain fulllength functional and/or expressed genes.
Phylogenetic analysis of genes encoding POR in pine
—Nucleotide sequence information is now available for a
number of expressed por genes from three different pine
species: loblolly pine (Spano et al. 1992a, S. Kinlaw, an expressed sequence tag: PtIFG-3012s, Genbank Accession
Number H75262, and this present study), white pine
(Spano et al. 1992a, A. Spano, unpublished data), and
mountain pine (Forreiter and Apel 1993). Using the nucleotide sequences of the 3'-UTRs from the various pine
cDNAs and the loblolly pine LP2 gene, a phylogenetic parsimony tree was generated (Fig. 6). Two major phylogenetic groups are found, consistent with our above analyses.
One grouping consists of porB-type genes, the other is
formed by por A -type genes. A topography identical to that
shown in Fig. 6 was also obtained using a Kimura two parameter DNA distance tree (Kimura 1980) constructed according to either the Fitch and Margoliash (1967) or the
neighbor-joining method (Saitou and Nei 1987) of tree construction (data not shown).
A GCG PILEUP alignment of all of the known por 3'UTR from pine revealed that the same nucleotide substitutions, insertions and/or deletions found to distinguish the
loblolly pine porA and porB cDNAs also distinguish the
two types of por genes in other pine species. Within the
porA-type, the three white pine cDNAs (PsCT5, PsCT6,
A.
por Coding
Cotyledon
| D 6 12 24 48 L | | P
and PsCT9) form a small sidebranch on the tree. PsCT5,
PsCT6, and PsCT9 contain the same nucleotide substitutions, insertions and/or deletions observed for the porAtype sequences of loblolly pine, but also some additional
changes. However, since no outgroup is available, it is
difficult to unambiguously identify this as a separate
branch within the porA subfamily.
Expression of the porA and porB in dark- and lightgrown seedlings—In angiosperms, porA and porB show
distinct patterns of expression during light-induced plant
development (Reinbothe and Reinbothe 1996a, b, Reinbothe et al. 1996a). To determine whether the two different
por gene subfamilies observed in loblolly pine show distinct
patterns of temporal and spatial expression during development, RNA gel blot analysis was carried out using total
RNA prepared from cotyledons of dark-grown seedlings
and seedlings grown in the dark and then exposed to white
light for various lengths of time. As shown in Fig. 7, an approximately 1.5 kb transcript can be detected in RNA isolated from either dark- or light-grown cotyledons hybridized
with a 32P-radiolabeled probe prepared against a conserved
coding region of the por gene. The steady-state levels of
por transcript increased slightly in cotyledons following illumination.
The effect of light on por message abundance was
more evident in stem tissue. The steady-state level of por
mRNA is low in dark-grown stem tissue, whereas upon exposure of dark-grown seedlings to light a steady increase in
por mRNA is observed with por mRNA levels approaching that observed in tissue grown under continuous white
light (Fig. 7A). Since the relative abundance of the por
mRNA was lower in the stems than in the cotyledon, it
Stem
6 12 24 48 L [
c.
Probe:
lOfmoles j
2.5fmoles j
0.625 fmoles
Fig. 7 Effect of light and tissue type on por mRNA levels in loblolly pine seedlings. Loblolly pine seedlings were grown for 14 d postgermination in constant dark (D) or constant light (L) and total RNA was prepared for RNA gel blot analysis as described in the
Materials and Methods. For light-induction studies, dark-grown seedlings were transferred to constant light and tissue harvested after 6
h (6), 12 h (12), 24 h (24) and 48 h (48). The RNA blots were then hybridized with 32P-labeled probes capable of detecting all por encoding transcripts (Panel A), or messages specific for porB or porA cDNAs (Panel B). Hybridization probes were identical to those described in the legend to Figure 4. The 18S rRNA probe is as described in the Materials and Methods. Each lane contains 20//g (Panel A)
or 40 fig (Panel B) total RNA. The fluorographs showing hybridization to total stem RNA shown in Panels A and B were given a slightly
longer exposure time relative to cotyledon samples to enhance the quality of the low abundance signals. Panel C shows the results of control hybridizations of the gene specific probes to in vitro transcribed sense porA and porB transcripts in order to verify probe specificity.
Multiple expressed por genes in loblolly pine
was necessary to use longer exposures to obtain the comparative hybridization profiles shown in the figure. Even under prolonged exposures, no por gene expression was observed in root tissue (data not shown).
When hybridization probes specific for the por A- and
porB-type transcripts were used (Fig. 7C), patterns of expression similar to that observed with the coding region probe were found (Fig. 7B). The change in steady-state levels
of the porB-type transcripts in greening stem tissue was
equivalent to that observed for the coding region probe,
whereas it appeared to take a longer amount of time following illumination for porA-type transcript levels to reach
levels observed in light-grown stem tissue. Thus, while both
por A- and porB-type transcripts are expressed, the kinetics
of their accumulation differ in some tissues under the
limited set of growth conditions reported here. In a more
comprehensive analysis of por gene expression during development in loblolly pine, RNA gel blot analysis showed that
porB-type transcripts constitute of majority of por message
in the needles of light-grown mature plants (Skinner and
Timko, manuscript in preparation). Along with the observed divergence in nucleotide sequence, such subtle differences in the expression of por gene family members in
loblolly pine, further support our interpretation that the
LP2 gene corresponds to the porB-type gene described in
angiosperms, and that the loblolly pine homologs of
pWPnPCR-901 correspond to the possible predecessors of
porA-type genes.
Discussion
In both dicotyledonous and monocotyledonous angiosperms the size of the por gene family appears to be relatively small with 2-4 members present in those plant
species examined thus far (He 1994, Spano et al. 1992b,
Armstrong et al. 1995, Holtorf et al. 1995, Kuroda et al.
1996). Based upon their differential expression during photomorphogenesis, the structure of their encoded proteins,
and the ability of these proteins to be imported into developing chloroplasts in the absence of substrate (Pchlide),
the por genes present in angiosperms have been separated
into two forms, designated as porA and porB (Armstrong
et al. 1995, Runge et al. 1996, Reinbothe and Reinbothe
1996a, b). In contrast, the results of our genomic DNA hybridization analysis and 5'- and 3-RACE experiments show
that a large gene family encodes the PORs in loblolly pine.
This gene family consists of two distinct subfamilies that,
by analogy to the terminology developed in angiosperms,
we have designated as por A and porB. A substantial difference exists in the complexity of the two subfamilies in
loblolly pine. While the por A subfamily appears to consist
of two or a relatively small number of genes, the porB subfamily contains 10 or more members. We have also found
that pseudogenes may account for a small portion of the
803
complexity of the por gene family in loblolly pine.
Multiple expressed forms of POR have been reported
previously in other pine species, including white pine
(P. strobus L.) and mountain pine (P. mugo) (Spano et al.
1992a, Forreiter and Apel 1993). In Norway spruce, two
POR proteins were detected immunologically following fractionation of whole cell extracts by SDS-PAGE,
whereas six immunoreactive POR proteins could be found
using two-dimensional PAGE (Stabel et al. 1991). Although it is not possible to exclude the possibility that such
POR isoforms derive from differential modification of a
single gene product, it is more likely that they represent the
products of distinct genes.
The larger size of the por gene family in loblolly pine
and other conifers relative to that found in angiosperm species is not suprising. In general, gene families in angiosperms are reported to have fewer members than the corresponding gene families in gymnosperms (Kinlaw et al. 1990,
1994, Kvarnheden et al. 1995, Kinlaw and Neale 1997). For
example, approximately 29% of randomly selected cDNA
probes used in mapping studies of the loblolly pine genome
have been shown to detect 10 or more bands in DNA
genomic blots, indicating that these transcripts arise from
members of multigene families (Devey et al. 1991, 1994,
Ahuja et al. 1994, Kinlaw et al. 1994). A subset of these
cDNAs also cross-hybridized with multiple fragments from
genomic DNA from other pine and conifer species suggesting that gene duplication is not unique to loblolly pine.
It has been previously suggested that pseudogenes
might contribute substantially to the formation of the
larger gene family sizes in pines and other gymnosperms.
For example, Kvarnheden et al. (1995) reported that in Norway spruce, genomic Southern hybridization analysis detected at least ten potential family members using a coding
region probe to the cdc2 gene encoding P34cdc2 protein
kinase. However, additional studies using PCR amplification-based analysis of genomic DNA showed that a substantial fraction (50% or more) are likely to be nonfunctional
since they have characteristics of processed retrospeudogenes. Similarly, Voo et al. (1995) have reported the presence of a 4-coumarate:CoA ligase pseudogene in loblolly
pine following cleavable amplified polymorphism analysis
of the genome. Kinlaw et al. (1990) have also noted that,
while genomic DNA hybridization analysis indicates that a
large gene family encodes alcohol dehydrogenase (ADH) in
Pinus radiata (Monterey pine), only 2-4 ADH isoforms
have been observed by gel electrophoretic analysis.
The presence of two por subfamilies in pine suggests
that gene duplication and perhaps specialization of function within the por gene family likely occurred prior to the
divergence of angiosperms and gymnosperms. A number
of multigene families have been characterized in gymnosperms, the composition of which suggests that gene duplication and specialization of family members occurred prior
804
Multiple expressed por genes in loblolly pine
to the split of gymnosperms and angiosperms (Jansson and
Gustafsson 1990, Karpinski et al. 1992, Yamamoto et al.
1993, Chinn and Silverthorne 1993, Chinn et al. 1995,
Kolukisaoglu et al. 1995, Peer et al. 1996). For example,
homologs of angiosperm genes encoding type I and type II
CAB proteins have been characterized in a number of
gymnosperms, and cab genes encoding all three CAB isoforms found in angiosperms (i.e., type I, type II, and type
III CAB proteins) have been identified in Ginkgo biloba
(Jansson and Gustafsson 1990, Yamamoto et al. 1993,
Chinn and Silverthorne 1993, Chinn et al. 1995, Peer et al.
1996). Genes encoding three distinct phytochrome isotypes
have been identified in Norway spruce (Thummler and Dittrich 1995). Phylogenetic analysis indicated that the phyA
and phyB genes likely diverged prior to the evolution
of gymnosperms, whereas phyC likely originated later
(Kolukisaoglu et al. 1995). In Scots pine (Pinus sylvestris
L.), distinct gene families encoding cytosolic and chloroplast isoforms of CuZn-superoxide dismutases (CuZnSOD) have been found, an organization similar to that observed in angiosperms (Karpinski et al. 1992).
The functional significance of having two different por
gene subfamilies in gymnosperms remains to be determined. In angiosperms, PORA accumulates to high levels
in etiolated tissues but is absent in mature, fully greened tissues. It is thought that PORA functions only at the initial
stages of light-induced development, during the transition
from etiolated to de-etiolated growth. On the other hand,
PORB is constitutively expressed during development and
is presumed to be responsible for the reduction of Pchlide
during the later stages of greening, and for chlorophyll formation in mature, green tissues (Armstrong et al. 1995,
Holtorf et al. 1995). We have assigned the por A or porB
designation to the various pine cDNAs based on our observation that porB transcripts account for the majority of the
mRNAs encoding POR in mature needles of 1-2 year-old
loblolly pine trees, whereas por A transcripts constitute
only a small fraction of the total mRNA in these tissues
(Skinner and Timko, manuscript in preparation). A lack of
PORA and the presence of PORB in mature, green tissues
is consistent with what has been reported in most angiosperms. However, other aspects of porA and porB expression in gymnosperms did not follow the general pattern of
expression observed in angiosperms during light-induced
development. Exposure of dark-grown loblolly pine seedlings to continuous white light resulted in a small increase
in total por transcript abundance in cotyledons and a
marked increase in dark-grown stem tissue. Both por A and
porB transcript levels were affected similarly, suggesting
that the two gene subfamilies are not under grossly different regulatory mechanism. Our observation that it takes
longer for por A mRNAs to attain their maximum levels of
accumulation in the stems of dark-grown seedlings transitioned to light compared to porB mRNAs under identical
conditions may reflect the observed difference in size of
the two subfamilies and/or number of expressed family
members.
The expression pattern of por A and porB in the cotyledons and stems of loblolly pine was essentially identical to
that previously reported in white pine (Spano et al. 1992a),
but differed from that observed in mountain pine (Forreiter
and Apel 1993). Using a gene-specific probe, Forreiter and
Apel (1993) reported that the Pml gene of mountain pine
encoded a product that decreased upon exposure of darkgrown cotyledon tissue to light. Based on the nucleotide sequence of its 3-UTR (see Fig. 6), Pml is aporB-type gene
and nearly identical to Pt3'PCR-3. The difference in expression observed for Pml and PtS'PCR-S may represent a
species-specific difference in the manner is which these
two highly homologous genes are regulated. Alternatively,
since PtS'PCR-S is only one of many porB-type genes in
loblolly pine, we may be observing the combined expression of several highly homologous genes in the loblolly pine
genome not distinguishable by this specific probe.
Like most other gymnosperms, loblolly pine has the capacity to form chlorophyll in both a light-dependent and
light-independent manner. The light-independent formation of chlorophyll in dark-grown loblolly pine cotyledons
accounts for approximately 25% of the total chlorophyll
formed in light-grown cotyledons (Spano et al. 1992a).
Despite the ability to form substantial amounts of chlorophyll in the dark, some gymnosperms buildup pools of
Pchlide and form prolamellar bodies within etiochloroplasts, in a manner similar to that found in angiosperms
(Selstam and Widell 1986). Since Pchlide and other metalloporphyrins are known to be extremely susceptible to photooxidation when free in solution, it has been proposed that
one possible driving force behind the evolution of two separate POR enzymes was the necessity to secure the large
pools of Pchlide accumulated in angiosperm etioplasts in a
state that prevented rapid photooxidative damage during
de-etiolation, but allowed for continued chlorophyll formation in mature tissues in the light (Reinbothe et al. 1996c).
The pattern of PORA expression in angiosperms is thought
to reflect its evolved primary role in preventing photooxidative damage during early light-induced development. Although gymnosperms are capable of chlorophyll formation
in the dark, substantial amounts of Pchlide can still accumulate. Therefore, selective pressures would also have existed in these less evolutionarily advanced organisms to develop mechanisms for stabilizing the accumulated Pchlide.
Accomodating such a need might have contributed to the
observed duplication and divergence in the por gene family
in gymnosperms.
In angiosperms, the expression of many nuclear genes
involved in photomorphogenesis, including por A, is under
the control of a complex phytochrome-mediated signal
transduction pathway (Reinbothe and Reinbothe, 1996a,
Multiple expressed por genes in loblolly pine
b, Reinbothe et al. 1996a). In gymnosperms, the role of
phytochrome in controlling light-regulated processes is
thought to be less dominant. What factors control por expression in loblolly pine and other gymnosperms are not
known at present. Further studies are also necessary to
determine how the light-dependent and light-independent
mechanisms for chlorophyll formation are coordinated in
organisms where they operate concurrently. The studies
presented here provide a basis for designing experiments to
answer these questions.
We wish to thank Anthony Spano and Graham Teakle for
their helpful- suggestions during the course of this work,
Mollianne McGahren for her excellent technical assistance,
Howard Goodman and Jacques Retief for their help with the
phylogenetic analysis, and Bruce Cahoon and Nikolai Lebedev
for their comments on the manuscript. This work was supported
by a grant from the US Department of Energy (DEFG0594ER20144) awarded to M.P.T. J.S.S. was the recipient of a UVA
Graduate School of Arts and Sciences Dissertation Year
Fellowship.
References
Ahuja, M.R., Devey, M.E., Groover, A.T., Jermstad, K.D. and Neale,
D.B. (1994) Mapped DNA probes from loblolly pine can be used for
restriction fragment length polymorphism mapping in other conifers.
Theor. Appl. Genet. 88: 279-282.
Apel, K. (1981) The protochlorophyllide holochrome of barley (Hordeum
vulgare L.). Phytochrorne-induced decrease of translatable mRNA
coding for the NADPH-protochlorophyllide oxidoreductase. Eur. J. Biochem. 120: 89-93.
Armstrong, G.A., Runge, S., Frick, G., Sperling, U. and Apel, K. (1995)
Identification of NADPH:protochlorophyllide oxidoreductases A and
B: a branched pathway for light-dependent chlorophyll biosynthesis in
Arabidopsis thaliana. Plant Physiol. 108: 1505-1517.
Batschauer, A. and Apel, K. (1984) The inverse control by phytochrome of
the expression of two nuclear genes in barley (Hordeum vulgare L.).
Eur. J. Biochem. 143: 593-597.
Bauer, C.E., Bollivar, D.W. and Suzuki, J.Y. (1993) Genetic analysis of
photopigment biosynthesis in eubacteria: a guiding light for algae and
plants. /. Bacteriol. 175: 3919-3925.
Chang, S., Puryear, J. and Cairney, J. (1993) A simple and efficient
method for isolating RNA from pine trees. Plant Mol. Biol. Rep. 11:
113-116.
Chinn, E. and Silverthorne, J. (1993) Light-dependent chloroplast development and expression of a light-harvesting chlorophyll a/6-binding protein gene in the gymnosperm Ginkgo biloba. Plant Physiol. 103: 727732.
Chinn, E., Silverthorne, J. and Hohtola, A. (1995) Light-regulated and
organ-specific expression of types 1, 2 and 3 light-harvesting complex b
mRNAs in Ginkgo biloba. Plant Physiol. 107: 593-602.
Devey, M.E., Fiddler, T.A., Liu, B.-H., Knapp, S.J. and Neale, D.B.
(1994) An RFLP linkage map for loblolly pine based on a three-generation outbred pedigree. Theor. Appl. Genet. 88: 273-278.
Devey, M.E., Jermstad, K.D., Tauer, C.G. and Neale, D.B. (1991) Inheritance of RFLP loci in a loblolly pine three-generation pedigree.
Theor. Appl. Genet. 83: 238-242.
Fitch, W.M. and Margoliash, E. (1967) Construction of phylogenetic trees.
Science 155: 279-284.
Forreiter, C. and Apel, K. (1993) Light-independent and light-dependent
protochlorophyllide-reducing activities and two distinct NADPH-protochlorophyllide oxidoreductase polypeptides in mountain pine (Pinus
mugo). Planta 190: 536-545.
Fourney, R.M., Miyakoshi, J., Day III, R.S. and Paterson, M.C. (1988)
805
Northern blotting: efficient RNA staining and transfer. Focus 10: 5-7.
Frohman, M.A., Dush, M.K. and Martin, G.R. (1988) Rapid production
of full-length cDNAs from rare transcripts: amplification using a single
gene-specific oligonucleotide primer. Proc. Natl. Acad. Sci. USA 85:
8998-9002.
Fujita, Y. (1996) Protochlorophyllide reduction: a key step in the greening
of plants. Plant Cell Physiol. 37: 411-421.
Griffiths, W.T., Kay, S.A. and Oliver, R.P. (1985) The presence and photoregulation of protochlorophyllide reductase in green tissues. Plant Mol.
Biol. 4: 13-22.
He, Z.-H. (1994) Molecular structure of pea NADPHprotochlorophyllide
oxidoreductase and its regulation during development. Ph.D. Thesis,
University of Virginia.
He, Z.-H., Li, J., Sundqvist, C. and Timko, M.P. (1994) Leaf developmental age controls expression of genes encoding enzymes of chlorophyll
and heme biosynthesis in pea (Pisum sativum L.). Plant Physiol. 106:
537-546.
Holtorf, H., Reinbothe, S., Reinbothe, C , Bereza, B. and Apel, K. (1995)
Two routes of chlorophyllide synthesis that are differentially regulated
by light in barley (Hordeum vulgare L.). Proc. Natl. Acad. Sci. USA 92:
3254-3258.
Jansson, S. and Gustafsson, P. (1990) Type I and Type II genes for the
chlorophyll a/6-binding protein in the gymnosperm Pinus sylvestris
(Scots pine): cDNA cloning and sequence analysis. Plant Mol. Biol. 14:
287-296.
Joshi, C.P. (1987) An inspection of the domain between putative TATA
box and translation start site in 79 plant genes. Nucl. Acids Res. 15:
6643-6653.
Karpinski, S., Wingsle, G., Olsson, O. and Hallgren, J.-E. (1992) Characterization of cDNAs encoding CuZn-superoxide dismutases in Scots
pine. Plant Mol. Biol. 18: 545-555.
Kay, S.A. and Griffiths, W.T. (1983) Light-induced breakdown of
NADPH-protochlorophyllide oxidoreductase in vitro. Plant Physiol.
72: 229-236.
Kimura, M. (1980) A simple model for estimating evolutionary rates of
base substitutions through comparative studies of nucleotide sequences.
/ . Mol. Evol. 16: 111-120.
Kinlaw, C.S., Gerttula, S.M. and Carter, M.C. (1994) Lipid transfer protein genes of loblolly pine are members of a complex gene family. Plant
Mol. Biol. 26: 1213-1216.
Kinlaw, C.S., Harry, D.E. and Sederoff, R.R. (1990) Isolation and characterization of alcohol dehydrogenase cDNAs from Pinus radiata. Can. J.
For. Res. 20: 1343-1350.
Kinlaw, C.S. and Neale, D.B. (1997) Complex gene families in pine
genomes. Trends Plant Sci. 2: 356-359.
Kolukisaoglu, H.O., Marx, S., Wiegmann, C , Hanelt, S. and SchneiderPoetsch, H.A.W. (1995) Divergence of the phytochrome gene family
predates angioserm evolution and suggests that Selaginella and
Equisetum arose prior to Psilotum. J. Mol. Evol. 41: 329-337.
Kuroda, H., Masuda, T., Ohta, H., Shioi, Y. and Takamiya, K. (1996)
Effects of light, developmental age and phytohormones on the expression of NADPH-protochlorophyllide oxidoreductase in Cucumis
sativus. Plant Physiol. Biochem. 34: 17-22.
Kvarnheden, A., Tandre, K. and Engstrom, P. (1995) A cdc2 homologue
and closely related processed retropseudogenes from Norway spruce.
Plant Mol. Biol. 27: 391-403.
Li, Q. and Hunt, A.G. (1995) A near-upstream element in a plant polyadenylation signal consists of more than six nucleotides. Plant Mol.
Biol. 28: 927-934.
Mapleston, E.R. and Griffiths, W.T. (1980) Light modulation of the activity of the protochlorophyllide oxidoreductase. Biochem. J. 189: 125133.
Moffat, A.S. (1996) Moving forest trees into the modern genetics era.
Science 271: 760-761.
Mosinger, E., Batschauer, A., Schafer, E. and Apel, K. (1985) Phytochrome control of in vitro transcription of specific genes in isolated
nuclei from barley (Hordeum vulgare). Eur. J. Biochem. 147: 137-142.
Mount, S.M. (1982) A catalogue of splice junction sequences. Nucl. Acids
Res. 10: 459-472.
Peer, W., Silverthorne, J. and Peters, J.L. (1996) Developmental and
806
Multiple expressed por genes in loblolly pine
light-regulated expression of individual members of the light-harvesting
complex b gene family in Pinuspalustris. Plant Physiol. I l l : 627-634.
Reinbothe, S. and Reinbothe, C. (1996a) The regulation of enzymes involved in chlorophyll biosynthesis. Eur. J. Biochem. 237: 323-343.
Reinbothe, S. and Reinbothe, C. (1996b) Regulation of chlorophyll biosynthesis in angiosperms. Plant Physiol. I l l : 1-7.
Reinbothe, S., Reinbothe, C , Apel, K. and Lebedev, N. (1996c) Evolution
of chlorophyll biosynthesis—The challenge to survive photooxidation.
Cell 86: 703-705.
Reinbothe, S., Reinbothe, C , Lebedev, N. and Apel, K. (1996a) PORA
and PORB, two light-dependent protochlorophyllide-reducing enzymes
of angiospenn chlorophyll biosynthesis. Plant Cell 8: 763-769.
Reinbothe, S., Reinbothe, C , Neumann, D. and Apel, K., (1996b) A
plastid enzyme arrested in the step of precursor translocation in vivo.
Proc. Natl. Acad. Sci. USA 93: 12026-12030.
Reinbothe, S., Reinbothe, C , Runge, S. and Apel, K. (1995b) Enzymatic
product formation impairs both the chloroplast receptor-binding function as well as translocation competence of the NADPH:protochlorophyllide oxidoreductase, a nuclear-encoded plast precursor protein. /.
CellBioI. 129: 299-308.
Reinbothe, S., Runge, S., Reinbothe, C , van Cleve, B. and Apel, K.
(1995a) Substrate-dependent transport of the NADPH:protochlorophyllide oxidoreductase into isolated plastids. Plant Cell 7: 161-172.
Runge, S., Sperling, U., Frick, G., Apel, K. and Armstrong, G.A. (1996)
Distinct roles for light-dependent NADPH:protochlorophyllide oxidoreductases (POR) A and B during greening in higher plants. Plant J. 9:
513-523.
Saitou, N. and Nie, M. (1987) The neighbor-joining method: a new
method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4: 406425.
Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular cloning: a
laboratory manual, 2nd edn. Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, New York.
Santel, H.-J. and Apel, K. (1981) The protochlorophyllide holochrome of
barley (Hordeum vulgare L.). The effect of light on the NADPH:protochlorophyllide oxidoreductase. Eur. J. Biochem. 120: 95-103.
Selstam, E. and Widell, A. (1986) Characterization of prolamellar bodies,
from dark-grown seedlings of Scots pine, containing light- and
NADPH-dependent protochlorophyllide oxidoreductase. Physiol. Plant.
67: 345-352.
Spano, A.J., He, Z.-H., Michel, H., Hunt, D.F. andTimko, M.P. (1992b)
Molecular cloning, nuclear gene structure and developmental expression
of NADPH:protochlorophyllide oxidoreductases in pea (Pisum sativum
L.) Plant Mol. Biol. 18: 967-972.
Spano, A.J., He, Z.-H. and Timko, M.P. (1992a) NADPH:protochlorophyllide oxidoreductases in white pine (Pinus strobus) and loblolly pine
(P. taeda). Evidence for light and developmental regulation of expression and conservation in gene organization and protein structure between angiosperms and gymnospenns. Mol. Gen. Genet. 236: 86-95.
Stabel, P., Sundas, A. and Engstrom, P. (1991) Cytokin treatment of embryos inhibits the synthesis of chloroplast proteins in Norway spruce.
Planta 183: 520-527.
Stephen, D., Jones, C. and Schofield, J.P. (1990) A rapid method for isolating high quality plasmid DNA suitable for DNA sequencing. Nucl.
Acids Res. 18: 7463-7464.
Thummler, F. and Dittrich, P. (1995) Phytochrome represents a small gene
family in Picea abies: six partial sequences (Accession No. U38363 to
U38368) encoding at least three different phytochrome isotypes. Plant
Physiol. 109: 1498.
Voo, K.S., Whetten, R.W., O'MaUey, D.M. and Sederoff, R.R. (1995) 4Coumarate:Coenzyme A ligase from loblolly pine xylem. Isolation, characterization and complementary DNA cloning. Plant Physiol. 108: 8597.
Yamamoto, N., Kojima, K. and Matsuoka, M. (1993) The presence of two
types of gene that encode the chlorophyll a/6-binding protein (LHCPII)
and their light-independent expression in pine (Pinus thunbergii). Plant
Cell Physiol. 34: 457-463.
(Received November 18, 1997; Accepted May 7, 1998)