Journal
of General Virology (1997), 78, 795–800. Printed in Great Britain
...........................................................................................................................................................................................................................................................................................
Infectivity of lion and puma lentiviruses for domestic cats
Sue VandeWoude, Stephen J. O’Brien† and Edward A. Hoover
Department of Pathology, College of Veterinary Medicine, Colorado State University, Fort Collins, CO 80523, USA
Infection of domestic cats with feline immunodeficiency virus (FIV) causes progressive immunological deterioration similar to that caused by
human immunodeficiency virus (HIV). Lentiviruses
related to but phylogenetically distinct from FIV
have been detected in several non-domestic feline
species. Serological cross-reactivity of these viruses
raises the question as to whether inter-species
transmission may occur. To address this issue, we
asked whether lion lentivirus (FIV-Ple) or two strains
of puma lentivirus (FIV-Pco) could replicate or cause
disease in domestic cats. We found that domestic
cats inoculated with FIV-Ple developed persistent
cell-associated viraemia, transient cell-free viraemia
Introduction
Viruses related to human immunodeficiency virus (HIV)
infect several animal species. Feline immunodeficiency virus
(FIV), the lentivirus of domestic cats, and simian immunodeficiency virus (SIV) induce immunodeficiency syndromes
similar to HIV and thus are important models for AIDS
research. Simian lentiviruses do not cause an AIDS-like illness
in their natural host species, likely due to the long period of
host adaptation to the virus which has occurred in the African
monkey species (Hirsch et al., 1989 ; Murphey-Corb et al.,
1986). By contrast, when inoculated into Asian primates, SIV
causes immunodeficiency syndrome in these related, yet nonadapted hosts (Letvin & King, 1990 ; Murphey-Corb et al.,
1986).
Naturally occurring FIV in domestic cats is typically marked
by a long clinical latency period during which a gradual
immunological deterioration occurs. Like HIV, FIV is lymphotropic and induces alterations in circulating T-helper and TAuthor for correspondence : Edward A. Hoover.
Fax ­1 970 491 0523. e-mail ehoover!lamar.colostate.edu
† Current address : Laboratory of Viral Carcinogenesis, National
Cancer Institute, Building 560, Room 21-105, Frederick, Maryland
21702-1201, USA.
and antiviral antibody. Clinical disease was not
detected throughout a 6 month observation period.
Two of four cats inoculated with FIV-Pco developed
cell-associated viraemia, seroconverted and exhibited transient lymphadenopathy. No changes in
white blood cell parameters or other haematological
abnormalities were detected in any of the infected
cats. Virus-specific RNA was detected in cocultivated lymphocytes of all infected cats by RT–
PCR. These findings reveal that non-domestic cat
lentiviruses are infectious for domestic cats and can
establish persistent infection in the absence of
disease.
suppresser cell populations. Naturally infected animals ultimately exhibit a wide variety of opportunistic infections and
haematological abnormalities similar to those described in
humans with AIDS (Pedersen, 1993 ; Sparger, 1993 ; Sparger
et al., 1989).
Serological surveys of non-domestic feline species have
determined that a significant number of these animals have
antibodies cross-reactive with FIV antigens (Barr et al., 1989 ;
Brown et al., 1993 a, b, 1994 ; Carpenter et al., 1996 ; HofmannLehmann et al., 1996 ; Letcher & O’Conner, 1991 ; Lutz et al.,
1992 ; Olmsted et al., 1992 ; Spencer et al., 1992). Genetic
characterization of puma (Puma concolour), lion (Panthera leo),
pallas cat (Felis manul) and bobcat (Lynx rufus) isolates has
determined that these viruses are distinct from each other and
related to FIV (Barr et al., 1995 ; Brown et al., 1994 ; Carpenter
et al., 1996 ; Langley, 1996 ; Olmsted et al., 1992). The
pathogenic nature of these diseases in their natural hosts has
not been fully characterized. While one report associated
lymphoma in a captive lion with an FIV-like lentivirus, other
analyses have not correlated specific disease expression with
seropositivity (Brown et al., 1994 ; Hofmann-Lehmann et al.,
1996 ; Olmsted et al., 1992 ; Poli et al., 1995). Analogous to the
primate biology of SIV, certain populations of African lions
appear to be endemically infected with FIV-Ple, whereas Asian
lions are seronegative (Brown et al., 1994).
0001-4466 # 1997 SGM
HJF
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 16:57:10
S. VandeWoude, S. J. O’Brien and E. A. Hoover
In this study we examined the potential for cross-species
transmission of the feline viruses to determine whether
infection could occur and whether disease would result based
on the precedents observed in the primate lentivirus system.
Methods
+ Animals. Nine weanling cats were obtained from the Colorado State
University specific-pathogen-free cat colony. Animals were housed by
inoculation group in gang rooms. Animals were weighed and blood
samples were collected at 0, 1, 2, 3, 4, 6, 8, 12, 16, 20 and 24 weeks postinoculation. Physical examinations were also performed at these times
and on days 1–6 and 10. Lymph node and bone marrow biopsies were
performed at week 24.
+ Virus stocks. FIV-Ple was an expanded stock of RT- and EMpositive supernatant obtained from a seropositive Serengeti lion (Ple 458 ;
Brown et al., 1994). Three cats were each inoculated with 2¬10' viable
FIV-Ple-infected cat PBMC with 0±7 ml supernatant and 2¬10' viable
FIV-Ple-infected 3201 cells with 1±3 ml of supernatant. Two strains of
FIV-Pco, PLV-14 and PcLV, were used in this study. PLV-14 originated
from an infected Florida Panther (Langley et al., 1994 ; Olmsted et al.,
1992). PBMC from this animal were cultivated in vitro in puma PBMC ;
this supernatant was expanded in 3201 feline lymphoma cells
(VandeWoude et al., 1996). PcLV cell-free and cell-associated virus was
obtained from a persistently infected 3201 cell line originally inoculated
with PBMC from a seropositive British Columbian puma. Two cats were
inoculated with each of these strains of FIV-Pco. Each cat was inoculated
with 1¬10( viable FIV-Pco-infected 3201 cells and 1±0 ml of supernatant.
The two FIV-Pco isolates used represent the two clades of puma
lentivirus (PLV-14, clade A ; PcLV, clade B) which have been distinguished
by phylogenetic analysis of a conserved region of the pol gene (Carpenter
et al., 1996 ; S. VandeWoude, S. J. O’Brien, J. P Slattery, K. Langelier, W.
D. Hardy & E. A. Hoover, unpublished results). Two control cats received
0±5¬10( naive 3201 cells and 2±5¬10' naive cat PBMC in 1±0 ml of
naive 3201 supernatant. Infection of inocula was confirmed by RT assay.
All inoculations were performed intravenously while cats were sedated
with ketamine anaesthesia.
+ Co-cultivation/RT assay. Previous studies indicated that all three
viruses readily infected 3201 cells, and cell-free virus could be detected by
RT assay (VandeWoude et al., 1996). Whole blood was collected from
inoculated cats at the time-points indicated above. Plasma and PBMC
were isolated using standard methodologies (Quackenbush et al., 1990).
Plasma (0±5 ml) and 10' PBMC were co-cultivated with 10' 3201 cells.
Supernatant was collected bi-weekly for 4 weeks. The final collection was
analysed for magnesium-dependent RT activity using a modified microtitre $#P detection assay (Goldstein et al., 1990 ; Willey et al., 1988).
Results were recorded using autoradiography and β emissions of samples
bound to DEAE-81 paper.
+ Flow cytometry. Feline T lymphocyte immunophenotype labelling
was performed with monoclonal antibodies to feline CD4 and CD8
(O’Reilly & Hoover, 1993) as described by Dean et al. (1991).
Lymphocyte subset percentages were analysed with a Coulter EPICS
Profile II flow cytometer. Total CD4+ and CD8+ cell numbers were
calculated from subset percentages, total leukocyte numbers and
lymphocyte percentages of total leukocytes.
+ Western blot. Crude FIV-Ple and FIV-Pco viral protein preparations
were electrophoresed on 12 % polyacrylamide and transferred to
nitrocellulose, similar to previously described methods (Diehl et al., 1996 ;
HJG
VandeWoude et al., 1996). Dilutions (1 : 66 to 1 : 100) of sera from
inoculated cats were incubated with the appropriate immunoblot strips
and Western blot assays performed. FIV-infected cat sera and naive cat
sera served as positive and negative controls.
+ Lymph node, bone marrow biopsy and culture. Prescapular
lymph nodes were collected aseptically while animals were anaesthetized
with ketamine–acepromazine–halothane anaesthesia. Tissue was homogenized through a fine sieve, washed twice in PBS and resuspended at a
concentration of 10' cells}ml. Bone marrow was aspirated with an 18
gauge bone marrow biopsy needle from the femur at the time of surgery.
Bone marrow mononuclear cells were purified on a Percoll gradient and
washed three times in PBS. Bone marrow and lymph node cells (10' of
each) were cultured and assayed for RT activity as described above.
+ RT–PCR. RNA was isolated from 200 µl of supernatant from week
24 PBMC co-cultivations using QIAmp Blood Kit reagents (Qiagen), as
per product directions, and eluted into RNase-free water. The RNA was
recovered by ethanol precipitation and resuspended in 23 µl of water, half
of which was used for cDNA synthesis using a commercial kit (cDNA
Cycle Kit, Invitrogen). One-third of the cDNA reaction was used as a
substrate in hot start PCR and the following 35 cycle programme : 94 °C
for 1 min, 50 °C for 1 min, 72 °C for 1 min. Nested primers were used to
further amplify FIV-Pco isolates ; these amplifications were performed at
55 °C annealing temperatures. The following virus-specific primers were
designed from a conserved region of the pol gene for each virus and were
synthesized commercially (Gibco BRL Custom Primers).
PLV-14-specific primers (Olmsted et al., 1992) : 1258F (bp 2430), 5«
GAAGCATTAACAGAAATAGTAG 3« ; 1260R (bp 3007), 5«
GTTCTTGTTGTAATTTATCTTC 3« ; 1261R (bp 2990), 5« ATCTTCAGGAGTTTCAAATCCCCA 3« ; 1259 (bp 2466), 5« GAAGGAAAGGTAAAAAGAGCAGATC 3«.
PcLV-specific primers (VandeWoude et al., 1996) : C24F (bp 2449), 5«
GAAGATTAGAAAAGAAGGGAAA 3« ; C530R (bp 2975), 5« AATCCCACCACAGTAATAAA 3« ; C146F (bp 2572), 5« AATGCAAAGACTGAGAAAGG 3« ; C359R (pb 2805), 5’ AGGGGCTTAATATCCATCCT 3«.
FIV-Ple-specific primers (VandeWoude et al., 1996) : L5–23F (bp
2526), 5« AAAAAGAAATCAGGGAAATA 3« ; L5-345R (bp 2868), 5«
ATTGGGATGTTTATCTCTAA 3«.
Each reaction contained 1±5 mM MgCl , 150 µM dNTPs, 8 U of
#
AmpliTaq DNA polymerase (Perkin-Elmer) and each primer at 1 µM.
Results
Physical examination
Mean weight of FIV-Ple-inoculated cats and FIV-Pcoinoculated cats did not vary significantly from the two control
cats during the course of the study. Cats P1 and Pc2 had
palpable peripheral lymphadenopathy at week 6 which lasted
for 6–18 weeks (Fig. 1). No other clinical abnormalities were
noted throughout the course of the study.
Plasma viraemia
See Figs 1 and 2. All three FIV-Ple-inoculated cats had
detectable plasma viraemia at week 1. Cat L2 was also viraemic
at week 2 ; cat L1 had a positive plasma culture at week 12.
None of the FIV-Pco-infected cats had positive plasma cultures
at any time-point.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 16:57:10
Infectivity of lion and puma lentiviruses
Table 1. Presence of FIV-Ple or FIV-Pco in prescapular
lymph node or bone marrow 6 months post-inoculation
Methods are detailed in the text. C1 and 2, control cats ; L1, 2 and 3,
cats inoculated with FIV-Ple ; Pc1 and 2, cats inoculated with British
Columbia isolate of FIV-Pco ; P1 and 2, cats inoculated with PLV-14
isolate of FIV-Pco. Ab indicates seropositive or seronegative status ;
LN indicates presence of virus in 10' lymph node cells as detected by
co-cultivation ; BM indicates presence of virus in 10' bone marrow
mononuclear cells as detected by co-cultivation.
Cat
Fig. 1. Summary of plasma viraemia, cell-associated viraemia,
seroconversion and peripheral lymphadenopathy detected in domestic cats
inoculated with FIV-Ple or FIV-Pco over a 24 week period. Week PI, weeks
post-inoculation ; C1 and 2, control cats ; L1, 2 and 3, FIV-Ple-inoculated
cats ; Pc1 and 2, British Columbia FIV-Pco-inoculated cats ; P1 and 2, PLV14-inoculated cats ; nd, not done. The methodology is detailed in the text.
Ab
LN
BM
C1
C2
L1
L2
L3
Pc1
Pc2
®
®
®
®
®
®
­
®
­
­
­
®
­
®
­
®
®
®
­
­
®
P1
P2
­ ®
­ ®
® ®
Differential cell counts
White blood cell counts remained within the normal range
(5±5–20±0¬10$ cells}ml) for all animals at all time-points
except for occasional sporadic measurements. Lymphocyte
counts similarly remained within normal range for cats
(1±5–7±0¬10$ cells}ml) for most time-points.
Flow cytometry
Fig. 2. Magnesium-dependent RT assay of FIV-Ple- and FIV-Pco-inoculated
cat plasma and cell co-culture supernatant. Supernatant samples were
collected after 4 weeks of co-cultivation of week 24 post-inoculation
PBMC and processed as described in the text. The figure shows
autoradiography (overnight exposure) of radiolabelled RT-generated
product bound to DEAE-81 filter paper ; exposure indicates a positive RT
reaction. C1 and 2, control cats ; L1, 2 and 3, FIV-Ple-inoculated cats ; P1
and 2, PLV-14-inoculated cats ; Pc1 and 2, British Columbia origin FIVPco-inoculated cats. -, RT-negative control (naive 3201 supernatant) ; ­,
positive-RT control (supernatant from a 3201 cell line persistently infected
with PcLV) ; F, domestic cat FIV Crandell cell supernatant.
PBMC viraemia
See Figs 1 and 2. All three FIV-Ple-inoculated cats had
detectable cell-associated viraemia at nearly all time-points.
Cats Pc2 and P1 were positive by week 4 and remained
positive throughout the monitoring period. Cat Pc1 had a
marginally elevated RT activity at week 6 ; cat P2 was culture
negative throughout the study. Both control cats had negative
plasma and PBMC cultures at all time-points.
CD4, CD8 and total lymphocyte counts of FIV-Ple- or FIVPco-infected cats did not differ significantly from control
animals. CD4 counts remained above 400}ml for all animals at
all time-points, and no downward trends were seen in infected
cats. The CD4}CD8 ratio remained above 2 for nearly all timepoints in all animals ; when the value approached 2 or below it
was due to an increase in CD8 cells rather than a decline in
CD4 cells. In contrast, studies with FIV have documented a
significant decline in CD4 count (less than 400}ml) and
inversion in CD4}CD8 ration within 4–8 weeks postinoculation, (Bendinelli et al., 1995 ; Dua et al., 1994 ; O’Neil et
al., 1995 ; M. H. Myles & E. A. Hoover, unpublished results)
though attenuated strains of FIV-Fca may be less capable of
altering lymphocyte subset kinetics (Sparger et al., 1994).
Western blot
Seroconversion was detected in all three FIV-Ple-inoculated
cats by week 3 (Figs 1 and 3). Cats Pc2 and P1 seroconverted
by week 6 and week 12, consecutively, as determined by
Western blot analysis.
Lymph node and bone marrow
RT–PCR
Virus was detected in bone marrow samples from cats L1
and L3 and prescapular lymph node samples from cats L2, Pc2
and P1 (Table 1).
FIV-Ple primers amplified an approximately 340 bp fragment in supernatant from PBMC cultures of cats L1, L2 and L3
but not from controls or naive supernatant. PLV-14-specific
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 16:57:10
HJH
S. VandeWoude, S. J. O’Brien and E. A. Hoover
Fig. 3. Week 16 post-inoculation Western
blot results. Immunoblotting was done as
indicated in the text. ­, positive control
(domestic cat FIV immune sera from
chronically infected cat) ; ®, negative
control (naive cat sera) ; PcLV 1 and 2,
British Columbia origin FIV-Pco-inoculated
cats ; PLV 1 and 2, PLV-14-inoculated
cats ; C1 and 2, control cats ; FIV-Ple 1, 2
and 3, FIV-Ple-inoculated cats. Arrows
indicate major Gag proteins recognized ;
p46 and p26 for PLV and P26 and P17
for FIV-Ple.
Fig. 4. Week 24 PBMC co-culture supernatant RT–PCR. Supernatant samples were identical to those shown in Fig. 3. The
methodology for performing RT–PCR is described in text. PCR reactions were run on 1 % agarose gel and stained with ethidium
bromide. FIV-Ple primers were used to amplify supernatant from FIV-Ple-inoculated cats (L1, 2 and 3), control cats (C1 and 2),
no DNA (H ¯ H2O) and a positive control (L­ ; FIV-Ple pol plasmid clone). PLV-14 primers were used to amplify supernatant
from PLV-14-inoculated cats (P1 and 2), control cats, no DNA and a positive control (P ¯ ; PLV-14-inoculated 3201 cells).
PcLV primers were used to amplify supernatant from PcLV-inoculated cats (Pc1 and 2), control cats, no DNA and a positive
control (Pc­ ; PcLV pol plasmid clone). M, DNA ladder. Arrows indicate approximate migration of 500 and 200 bp fragments.
PLV-14 and PcLV reactions were second round nested reaction products. RT–PCR was also done on naive 3201 supernatant
with each set of primers ; all these samples were negative for DNA by agarose gel electrophoresis and ethidium staining (not
shown).
primers amplified an approximately 525 bp product from cat
P1 after nested PCR with primers 1259 and 1261. PcLVspecific primers amplified an approximately 230 bp fragment
after nested RT–PCR in Pc2 but not other supernatants (Fig. 4).
These sizes are consistent with the predicted amplification
products from these primers. Previous work (VandeWoude et
al., 1996) has shown that FIV-Ple and FIV-Pco primers do not
cross-amplify each other in this type of RT–PCR reaction, even
when annealing temperatures of 37 °C are used. This RT–PCR
confirmed that viruses cultivated were consistent with the
input virus for each seropositive cat.
Discussion
Previous attempts at infection of domestic cats with FIVPle have been unsuccessful (Lutz et al., 1992) whereas in this
study three of three inoculated cats became persistently
infected. Our ability to detect infection in these animals may
have been enhanced by an in vitro propagation}RT assay
system, although infection was also detectable by sero-
HJI
conversion and PCR assays. The FIV-Ple isolate used may have
been better able to replicate in domestic cats than other field
isolates. This is suggested by the observation that the FIV-Ple
used in this study was only one of five isolates that could be cocultivated in lion PBMC (Brown et al., 1994) and was readily
expanded in cat PBMC and a feline lymphoma cell line
(VandeWoude et al., 1996). Because this FIV-Ple could be
cultured in vitro, the input inoculum was likely higher than that
previously used. In addition, it is possible that amplification of
this virus in domestic cat PBMC and a domestic cat cell line
allowed selection of a strain of FIV-Ple that can readily infect
domestic cats in vivo.
Olmsted et al. (1992) found that one domestic cat inoculated
with PBMC from a seropositive puma became persistently
infected but did not show obvious clinical signs of disease.
Additionally, analysis of lentiviral sequences obtained from
PBMC of 44 seropositive pumas identified one animal (a
captive puma from Peru) that was apparently infected with a
strain of domestic cat FIV (Carpenter et al., 1996). Two of four
cats inoculated with FIV-Pco in the current study became
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 16:57:10
Infectivity of lion and puma lentiviruses
infected, one each with PcLV and PLV-14. Although serological cross-reactivity between PcLV and FIV-C has been
reported (Langelier et al., 1995) PcLV did not appear to be any
more infectious or pathogenic for domestic cats than the
Florida Panther strain of FIV-Pco. This is consistent with the
finding that this virus was classified phylogenetically as a clade
B puma lentivirus similar to other FIV-Pco strains from this
geographical region (VandeWoude et al., 1996).
All three cats inoculated with FIV-Ple-infected cells and
cell-free virus seroconverted rapidly and developed transient
viraemia in 1 week. In contrast, only two of four cats inoculated
with FIV-Pco seroconverted. These two FIV-Pco-infected
animals had persistent cell-associated virus 2–4 weeks postinoculation, lymphadenopathy, virus in prescapular lymph
node cells, but no detectable plasma viraemia. These findings
suggest a subtle difference between the course of infection of
these strains of FIV-Pco and FIV-Ple in domestic cats.
Although domestic cats became infected with both FIV-Pco
and FIV-Ple, none of the animals developed T cell deficits and
clinical symptoms were mild (lymphadenopathy in the two
FIV-Pco-infected cats). The viruses may have become
attenuated by propagation in cell culture ; PcLV in particular
had been passaged in 3201 cells for several months prior to
inoculation. Due to the sero-relatedness of PcLV and FIV-C
(K. M. Langelier, W. M. Hardy & K. E. Atkinson, unpublished
results) further examination of the potential infectivity of
uncultured isolates may be warranted. A second explanation
for lack of virulence is based on phylogenetic analysis of these
viruses. The degree of pol gene sequence divergence between
highly conserved regions of FIV-Pco, FIV-Ple and FIV is
20–30 % (Brown et al., 1994 ; Carpenter et al., 1996 ; Olmsted
et al., 1992). Such diversity suggests these viruses have been
present in their respective feline hosts for many generations,
perhaps since divergence of the felid species from a common
feline ancestor (Carpenter et al., 1996 ; Olmsted et al., 1992).
During this time-span, the viruses may have become less
virulent due to immunological adaptation and host selection
(Carpenter & O’Brien, 1995).
Epidemiological studies have shown that women infected
with the relatively non-virulent HIV-2 are less susceptible than
are uninfected cohorts to infection with HIV-1 (Travers et al.,
1995). Chickens infected with herpesvirus of turkeys are
protected from challenge with the virulent Marek’s disease
herpesvirus of chickens (Bu$ low, 1977 ; Okazaki et al., 1970 ;
Purchase et al., 1972). Similarly, attenuated measles virus will
replicate in dogs without adverse effects and then protect these
dogs against canine distemper virus challenge (Brown et al.,
1972 ; Greene, 1990 ; Wilson et al., 1976). By analogy, it is
possible that non-domestic cat lentivirus could protect cats
against FIV challenge, thereby providing a model system for
inter-species lentiviral vaccination.
This work was supported in part by a grant from the Colorado State
University College of Veterinary Medicine and Biomedical Sciences. We
thank Dr Ken Langelier who identified the cougar lentivirus infection in
British Columbia and Dr William Hardy who developed and provided the
original PcLV-3201 cell line used to produce virus inoculum for PcLVchallenged animals. We also thank Ms Candace Mathiason-DuBard for
advice during assay development.
References
Barr, M. C., Calle, P. P., Roelke, M. E. & Scott, F. W. (1989). Feline
immunodeficiency virus infection in nondomestic felids. Journal of Zoo and
Wildlife Medicine 20, 265–272.
Barr, M. C., Zou, L., Holzschu, D. L., Phillips, L., Scott, F. W., Casey,
J. W. & Avery, R. J. (1995). Isolation of a highly cytopathic lentivirus
from a nondomestic cat. Journal of Virology 69, 7371–7374.
Bendinelli, M., Pistello, M., Lombardi, S., Poli, A., Garzelli, C.,
Matteucci, D., Ceccherini-Nelli, L., Malvaldi, G. & Tozzini, F. (1995).
Feline immunodeficiency virus : an interesting model for AIDS studies
and an important cat pathogen. Clinical Microbiology Reviews 8, 87–112.
Brown, A. L., Vitamvas, J. A., Merry, D. L. & Beckenhauer, W. H.
(1972). Immune response of pups to modified live-virus canine
distemper–measles vaccine. American Journal of Veterinary Research 33,
1447–1456.
Brown, E. W., Miththapala, S. & O’Brien, S. J. (1993 a). Prevalence of
exposure to feline immunodeficiency virus in exotic felid species. Journal
of Zoo and Wildlife Medicine 24, 357–364.
Brown, E. W., Olmsted, R. A. & Martenson, J. S. (1993 b). Exposure to
FIV and FIPV in wild and captive cheetahs. Zoo Biology 12, 135–142.
Brown, E. W., Yuhki, N., Packer, C. & O’Brien, S. J. (1994). A lion
lentivirus related to feline immunodeficiency virus : epidemiologic and
phylogenetic aspects. Journal of Virology 68, 5953–5968.
Bu$ low, V. V. (1977). Cross-protection between JMV Marek’s diseasederived tumour transplant, Marek’s disease and turkey herpesviruses.
Avian Pathology 6, 353–366.
Carpenter, M. A. & O’Brien, S. J. (1995). Coadaptation and immunodeficiency virus ; lessons from the Felidae. Current Opinion in Genetics &
Development 5, 739–745.
Carpenter, M. A., Brown, E. W., Culver, M., Johnson, W. E., PeconSlattery, J., Brousset, D. & O’Brien, S. J. (1996). Genetic and
phylogenetic divergence of feline immunodeficiency virus in the puma
(Puma concolor). Journal of Virology 70, 6682–6693.
Dean, G. A., Quackenbush, S. L., Ackley, C. D., Cooper, M. D. &
Hoover, E. A. (1991). Flow cytometric analysis of T-lymphocyte subsets
in cats. Veterinary Immunology and Immunopathology 28, 327–335.
Diehl, L. J., Mathiason-DuBard, C. K., O’Neil, L. L. & Hoover, E. A.
(1996). Plasma viral RNA load predicts disease progression in an
accelerated feline immunodeficiency virus model. Journal of Virology 70,
2503–2507.
Dua, N., Reubel, G., Moore, P. F., Higgins, J. & Pedersen, N. C. (1994).
An experimental study of primary feline immunodeficiency virus infection
in cats and a historical comparison to acute simian and human
immunodeficiency virus diseases. Veterinary Immunology and Immunopathology 43, 337–355.
Goldstein, S., Engle, R., Olmsted, R. A., Hirsch, V. M. & Johnson, P. R.
(1990). Detection of SIV antigens by HIV-1 antigen capture immuno-
assays. Journal of Acquired Immune Deficiency Syndromes 3, 98–102.
Greene, C. E. (1990). Vaccine Interference. In Infectious Diseases of the
Dog and Cat, pp. 227–241. Philadelphia : W. B. Saunders.
Hirsch, V. M., Olmsted, R. A., Murphey-Corb, M., Purcell, R. H. &
Johnson, P. R. (1989). An African primate lentivirus (SIVsm) closely
related to HIV-2. Nature 339, 389–391.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 16:57:10
HJJ
S. VandeWoude, S. J. O’Brien and E. A. Hoover
Hofmann-Lehmann, R., Fehr, D., Grob, M., Elgizoli, M., Packer, C.,
O’Brien, S. J. & Lutz, H. (1996). Antibodies to feline immunodeficiency
Pedersen, N. C. (1993). The feline immunodeficiency virus. In The
Retroviridae, pp. 181–228. Edited by J. A. Levy. New York : Plenum Press.
virus and other feline viruses in free-ranging lions in East Africa. In Third
International Feline Retrovirus Research Symposium, p. 45. Edited by E. A.
Hoover. Fort Collins : Colorado State University.
Langley, R. (1996). Nucleotide sequence analysis of lentiviral DNA
from bobcat (Lynx rufus) peripheral blood mononuclear cells (PBMC). In
Third International Feline Retrovirus Research, p. 74. Edited by E. A.
Hoover. Fort Collins : Colorado State University.
Poli, A., Abramo, F., Cavicchio, P., Bandecchi, P., Ghelardi, E. &
Pistello, M. (1995). Lentivirus infection in an African lion : a clinical,
Langley, R. J., Hirsch, V. M., O’Brien, S. J., Adger-Johnson, D., Goeken,
R. M. & Olmsted, R. A. (1994). Nucleotide sequence analysis of puma
lentivirus (PLV-14) : genomic organization and relationship to other
lentiviruses. Virology 202, 853–864.
Letcher, J. & O’Conner, T. (1991). Incidence of antibodies reacting to
feline immunodeficiency virus in a population of Asian lions. Journal of
Zoo and Wildlife Medicine 22, 324–329.
Letvin, N. L. & King, N. W. (1990). Immunologic and pathologic
manifestations of the infection of rhesus monkeys with simian immunodeficiency virus of macaques. Journal of Acquired Immune Deficiency
Syndromes 3, 1023–1040.
Lutz, H., Isenbugel, E., Lehmann, R., Sabapara, R. H. & Wolfensberger,
C. (1992). Retrovirus infections in non-domestic felids : serological
studies and attempts to isolate a lentivirus. Veterinary Immunology and
Immunopathology 35, 215–224.
Murphey-Corb, M., Martin, L. N., Rangan, S. R. S., Baskin, G. B.,
Gormus, B. J., Wolf, R. H., Andes, W. A., West, M. & Montelaro, R. C.
(1986). Isolation of an HTLV-III-related retrovirus from macaques with
simian AIDS and its possible origin in asymptomatic mangabeys. Nature
321, 435–436.
Okazaki, W., Purchase, H. G. & Burmester, B. R. (1970). Protection
against Marek’s disease by vaccination with a herpesvirus of turkeys.
Avian Diseases 14, 413–429.
pathologic and virologic study. Journal of Wildlife Diseases 31, 70–74.
Purchase, H. G., Okazaki, W. & Burmester, B. R. (1972). Long-term
field trials with the herpesvirus of turkeys vaccine against Marek’s
disease. Avian Diseases 16, 57–71.
Quackenbush, S. L., Donahue, P. R., Dean, G. A., Myles, M. H., Ackley,
C. D., Cooper, M. D., Mullins, J. I. & Hoover, E. A. (1990). Lymphocyte
subset alterations and viral determinants of immunodeficiency disease
induction by the feline leukemia virus FeLV-FAIDS. Journal of Virology
64, 5465–5474.
Sparger, E. E. (1993). Current thoughts on feline immunodeficiency
virus infection. Veterinary Clinics of North America : Small Animal Practice
23, 173–191.
Sparger, E. E., Luciw, P. A., Elder, J. H., Yamamoto, J. K., Lowenstine,
L. J. & Pedersen, N. C. (1989). Feline immunodeficiency virus is a
lentivirus associated with an AIDS-like disease in cats. AIDS 3, S43–S49.
Sparger, E. E., Beebe, A. M., Dua, N., Himathongkam, S., Elder, J. H.,
Torten, M. & Higgins, J. (1994). Infection of cats with molecularly
cloned and biological isolates of the feline immunodeficiency virus.
Virology 205, 546–553.
Spencer, J. A., Van Dijk, A. A., Horzinek, M. C., Egberink, H. F., Bengis,
R. G., Keet, D. F., Morikawa, S. & Bishop, D. H. L. (1992). Incidence of
feline immunodeficiency virus reactive antibodies in free-ranging lions of
the Kruger National Park and the Etosha National Park in Southern Africa
detected by recombinant FIV p24 antigen. Onderstepoort Journal of
Veterinary Research 59, 315–322.
Travers, K., Mboup, S., Marlink, R., Gue' ye-Ndiaye, A., Siby, T., Thior,
I., Traore, I., Dieng-Sarr, A., Sankale! , J., Mullins, C., Ndoye, I., Hsieh,
C., Essex, M. & Kanki, P. (1995). Natural protection against HIV-1
infection provided by HIV-2. Science 268, 1612–1615.
Olmsted, R. A., Langley, R., Roelke, M. E., Goeken, R. M., AdgerJohnson, D., Goff, J. P., Albert, J. P., Packer, C., Laurenson, M. K.,
Caro, T. M., Scheepers, L., Wildt, D. E., Bush, M., Martenson, J. S. &
O’Brien, S. J. (1992). Worldwide prevalence of lentivirus infection in
cat cells. In Third International Feline Retrovirus Research Symposium, p. 74.
Edited by E. A. Hoover. Fort Collins : Colorado State University.
wild feline species : epidemiologic and phylogenetic aspects. Journal of
Virology 66, 6008–6018.
Willey, D. L., Smith, D. H., Lasky, L. A., Theodore, T. S., Earl, P. L.,
Moss, B., Capon, D. J. & Martin, M. A. (1988). In vitro mutagenesis
O’Neil, L. L., Burkhard, M. J., Diehl, L. J. & Hoover, E. A. (1995).
identifies a region within the envelope gene of the human immunodeficiency virus that is critical for infectivity. Journal of Virology 62,
139–147.
Wilson, J. H. G., Pereboom, W. J. & Leemans, S. (1976). Combined
distemper}measles vaccine. Veterinary Record 98, 32–33.
Vertical transmission of feline immunodeficiency virus. AIDS Research and
Human Retroviruses 11, 171–182.
O’Reilly, K. L. & Hoover, E. A. (1993). Characterization of a panel of
monoclonal antibodies specific for subsets of feline leukocytes. In The
Second International Feline Retrovirus Symposium, p. 38. Edited by W. A.
Tompkins. Raleigh : North Carolina State University.
IAA
VandeWoude, S., O’Brien, S., Langelier, K., Hardy, W. D. & Hoover,
E. A. (1996). In vitro growth of lion and puma lentiviruses in domestic
Received 15 October 1996 ; Accepted 31 December 1996
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 18 Jun 2017 16:57:10