International Immunopharmacology 9 (2009) 1145–1149
Contents lists available at ScienceDirect
International Immunopharmacology
j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / i n t i m p
The anti-inflammatory pharmacology of Pycnogenol® in humans involves COX-2 and
5-LOX mRNA expression in leukocytes
Raffaella Canali a,⁎, Raffaella Comitato a, Frank Schonlau b, Fabio Virgili a
a
b
National Research Institute for Food and Nutrition, via Ardeatina 546, 0178 Rome, Italy
Horphag Research (UK) Ltd. 28 Old Brompton Road Suite 393; South Kensington, London SW7 3SS UK
a r t i c l e
i n f o
Article history:
Received 4 May 2009
Received in revised form 1 June 2009
Accepted 1 June 2009
Keywords:
Flavonoids
5-LOX
COX-2
Gene expression
a b s t r a c t
We investigated the effects of Pycnogenol® supplementation on the arachidonic acid pathway in human
polymorphonuclear leukocytes (PMNL) in response to an inflammatory stimulus. Pycnogenol is a
standardised extract of French maritime pine bark consisting of procyanidins and polyphenolic monomers.
Healthy volunteers aged 35 to 50 years were supplemented with 150 mg Pycnogenol a day for five days.
Before and after the final day of supplementation, blood was drawn and PMNL were isolated. PMNL were
primed with lipopolysaccharide (LPS) and stimulated with the receptor-mediated agonist formyl-methionylleucyl-phenylalanine (fMLP) to activate the arachidonic acid pathway and the biosynthesis of leukotrienes,
thromboxane and prostaglandins. Pycnogenol supplementation inhibited 5-lipoxygenase (5-LOX) and
cyclooxygenase-2 (COX-2) gene expression and phospholipase A2 (PLA2) activity. This effect was associated
with a compensatory up-regulation of COX-1 gene expression. Interestingly, Pycnogenol suspended the
interdependency between 5-LOX and 5-lipoxygenase activating protein (FLAP) expression. Pycnogenol
supplementation reduced leukotriene production but did not leave prostaglandins unaltered, which we
attribute to a decline of COX-2 activity in favour of COX-1. Here we show for the first time that Pycnogenol
supplementation simultaneously inhibits COX-2 and 5-LOX gene expression and reduces leukotriene
biosynthesis in human PMNL upon pro-inflammatory stimulation ex vivo.
© 2009 Elsevier B.V. All rights reserved.
1. Introduction
Inflammation is per se an important response of mammalians aiming
to counter a wide spectrum of potentially harmful stimuli and recover a
homeostatic condition compatible with normal cellular activities and
functions. Similarly to any kind of physiological response, inflammation
requires a delicate and tight feedback regulation in order to avoid the
consequences of a continuous activation which can eventually lead to
chronic inflammatory condition, associated with tissue injury and
dysfunction. Many aspects of inflammation are mediated or modulated
by the mediators arising from the cyclooxygenase (COX) and lipoxygenase (LOX) cascade [1]. The cascade initiates with the release of
arachidonic acid (AA) by phospholipase A2 (PLA2) action; while the
final products are prostaglandins (PGs), thromboxanes (TXB) and
leukotrienes (LTs) that are the members of a group of biologically active
oxygenated fatty acids, named eicosanoids. PGs are potent vasodilators
which account for the increased blood flow in inflamed areas. On the
other hand, TXB acts as a potent vasoconstrictor and a stimulator of
platelet aggregation [2]. LTs (LTB4 and cysteinyl-LT (cys-LT) play a
multifaceted role within the inflammatory process. They are important
⁎ Corresponding author. Tel.: +39 0651494519; fax: +39 0651494550.
E-mail addresses: [email protected] (R. Canali), [email protected] (R. Comitato),
[email protected] (F. Schonlau), [email protected] (F. Virgili).
1567-5769/$ – see front matter © 2009 Elsevier B.V. All rights reserved.
doi:10.1016/j.intimp.2009.06.001
modulator of pain in inflammation and immunomodulatory agents.
LTB4 is a chemoattractant for leukocytes and may initiate the monocytes
recruitment. Cys-LT increase vascular permeability, dilate blood vessels,
contract non-vascular smooth muscle, and cause pain [3]. LTs have been
recognized to play an important role in different chronic inflammatory
disease such as asthma, allergic rhinitis, colitis, dermatitis rheumatoid
arthritis and septic peritonitis [3,4].
Plant phenolic compounds have attracted growing interest as
owing advantageous health effects. Pycnogenol® (PYC) is a patented
standardised extract from the bark of the French maritime pine, Pinus
pinaster (Horphag Research, Ltd, Geneva, Switzerland), mainly
composed of procyanidins and flavonoid monomers and phenolic or
cinnamic acids and their glycosides as minor constituents. About 65–
75% of Pycnogenol components are procyanidins made of catechin and
epicatechin subunits of varying chain lengths [5,6]. In addition to
antioxidant activities resulting from hydroxyl groups of the polyphenol components, Pycnogenol has also been shown to exert a
variety of biological activities [7,8] and in particular it has been
reported to exert anti-inflammatory effects. Pycnogenol metabolites
contained in plasma of human volunteers after ingestion have been
shown to inhibit COX-1 and COX-2 enzyme activity, in vitro [9].
Moreover, two studies have suggested Pycnogenol as a valuable
candidate tool in the management of asthma. A double-blind placebo
controlled crossover study performed on 22 subjects suffering of
1146
R. Canali et al. / International Immunopharmacology 9 (2009) 1145–1149
Table 1
Primer design for quantitative PCR analysis.
mRNA
Primers
5-LOX
FW:5′TGCTGAGCGCAACAAGAAGA
RV:5′ACACCTGCCAGGCAGGA
FW:5′GGCAGGTGGATCACTTGAGG
RV:5′AAGCAATTCTCCTGCCTCAA
FW:5′CCCTTCTGCCTGACACCTTTC
RV:5′AACCCTGCCAGCAATTTGC
FW:5′TCTGGCTACGTGAGCACAAC
RV:5′CTCAGCTGCTGCACGTACTC
FW:5′AGAAAGGATTCCTATGTGGCG
RV:5′CATGTCGTCCCAGTTGGTGAC
FLAP
COX-2
COX-1
β-Actin
5-LOX, 5-lipoxygenase; FLAP, five lipoxygenase activating protein; COX-2,
cyclooxygenase-2; COX-1, cyclooxygenase-1.
asthma, showed that 4 weeks Pycnogenol supplementation induced a
significant recovery of symptoms. The improvement of airway
function paralleled the reduction of LTs levels in the blood [10].
More recently, a randomized, placebo controlled, double-blind study
showed that urinary cys-LTs were significantly reduced after PYC
supplementation [11]. However, the molecular basis of Pycnogenol
activity on LTs biosynthesis is still scarcely known limiting the
utilization of this nutritional supplement as a possible dietary tool
in the management of mild chronic inflammatory diseases such
asthma. Therefore, the purpose of this study was to investigate the
molecular basis of the anti-inflammatory effect of Pycnogenol
supplementation in activated human polymorphonuclear leukocytes
(PMNL).
2. Materials and methods
2.1. Experimental model
6 healthy volunteers (35–50 years) participated to this study
which was approved by the Ethical Committee of the National
Institute for Food and Nutrition Research. The investigation conforms
with the principles outlined in the Declaration of Helsinki. All subjects
underwent a flavonoid free diet for 12 h and then referred to the
Institute for blood withdrawal to obtain PMNL and plasma in basal
condition. All subjects were supplemented for 5 days with 150 mg
tablet per day of Pycnogenol® [9,12]. The supplementation was
ingested every morning in fasting condition before breakfast. Subjects
consumed their usual diet during the 5 days. 60 min after the last
Pycnogenol® supplementation, still in fasting condition, blood was
withdrawn again and plasma and PMNL isolated. The supplementation length and the blood withdrawal time after the last Pycnogenol®
protocol was decided in order to have a combination steady state and
acute effect and on the basis of previous studies indicating that after
5 days a steady state level of circulating constituents is reached and
that polyphenol absorption peaks at about 60 min from ingestion [13].
On each day of blood isolation, PMNL were isolated and activated.
PMNL (1 × 107/ml) were resuspended in RPMI 1640 w/o phenol red
plus 10% autologous plasma and primed with 1 µg/ml lipopolysaccharides (LPS) for 30 min at 37 °C. At the end of LPS priming, PMNL
were centrifuged, resuspended in RPMI 1640 w/o phenol red plus 10%
autologous plasma and stimulated by adding 0.1 µM formylmethionyl-leucyl-phenylalanine (fMLP), an agonist mimicking the
structure of bacterial wall peptides. Priming of human granulocytes
with LPS enhances the biosynthesis of leukotrienes in response to
soluble agonist like fMLP, due to a transient increase in the potential
for both arachidonic acid (AA) mobilization via cPLA2 (cytoplasmatic
PLA2) and activation of 5-LOX [14]. Cells were incubated in the
presence of fMLP for 15 s, 1.5 and 5 min. At the end of the incubations,
the medium was collected and stored at − 80 °C for LT, PG and TXB
measurement by ELISA. Cells were pelleted and treated for RNA or
protein isolation. The results obtained with PMNL isolated after
Pycnogenol® supplementation were compared with those obtained
with PMNL isolated in fasting condition in each subject.
2.2. PMNL isolation
PMNL were isolated from blood as previously described [15].
Briefly, venous blood was obtained from healthy volunteers using
heparin as anticoagulant. Blood was centrifuged (250 ×g for 20 min)
and plasma separated for further uses. Erythrocytes were removed by
dextran sedimentation. The leukocyte rich supernatant was centrifuged and the remaining erythrocytes were removed by hypotonic
lysis. Cells were layered over Ficoll-Paque and centrifuged to separate
mononuclear cells from PMNL. The PMNL rich pellet was recovered
and washed in PBS/EDTA. PMNL preparation was checked by trypan
blue dye exclusion analysis for cell viability and purity. Neutrophils are
the most representative cell population of PMNL (N95%) as assessed
by May-Grunwald Giemsa staining.
2.3. Real time PCR
RNA was isolated using RNeasy Mini kit (QIAGEN) according to the
manufacturer protocol. The quantification of gene expression was
determined by real-time quantitative PCR with the ABI PRISM® 7900
HT Instrument (Applied Biosystem, Foster City CA, USA) using the Sybr
green JumpStart™ Taq Ready Mix kit (SIGMA). The oligonucleotide
used for PCR studies are listed in Table 1. Data were collected and
processed with SDS2.2 software and given as threshold cycle (Ct). Ct
values for each target and reference genes were obtained and their
difference was calculated (ΔCt). Primer efficiencies for the test genes
and β-actin (reference gene) were similar. Transforming Ct values to
absolute value considering the efficiency of the primers of target genes
(2− ΔCt) was the last step in the quantification of gene expression. The
results are expressed as arbitrary units, normalized for β-actin level.
Fig. 1. Effect of fMLP agonist stimulation on 5-LOX and FLAP gene expression in PMNL
isolated before (A) and after (B) Pycnogenol® supplementation. Before fMLP activation
cells were primed with LPS for 30 min at 37 °C. Data are expressed as fold of changes
with respect to control. Control is gene expression before any treatments. ⁎P b 0.05
compared to PMNL isolated before Pycnogenol® supplementation.
R. Canali et al. / International Immunopharmacology 9 (2009) 1145–1149
1147
2.4. LTB4 PGE2 and TXB assay
LTB4, PGE2 and TXB levels in the supernatant of PMNL challenged
with inflammatory stimuli was measured using EIA kit (CAYMAN
chemical).
2.5. PLA2 activity
Cells, pelleted after all treatments, were homogenized in buffer
containing 50 mM HEPES pH 7.4, EDTA 1 mM and a protease inhibitor
mix. PLA2 activity was assessed by using arachidonoyl thio-PC
(CAYMAN chemicals) as a synthetic substrate. Free thiols released
by PLA2 after hydrolysis of the arachidonoyl thioester bond in the sn-2
position was detected by DTNB (Elmann's reagent) at 415 nm.
2.6. Statistical analysis
Data are expressed as mean ± SEM. Statistical analysis of the data
was performed by using paired t-test. Data are normalized to the
results obtained with the untreated cells isolated before and after
Pycnogenol® supplementation. A P b 0.05 was considered significant.
Fig. 3. Effect of fMLP agonist stimulation on COX-1 gene expression in PMNL isolated
before and after Pycnogenol® supplementation. Before fMLP activation cells were
primed with LPS for 30 min at 37 °C. Data are expressed as fold of changes compared
with control. Control is gene expression before any treatments. Pre-PYC are PMNL
isolated before Pycnogenol® supplementation, post-PYC are PMNL isolated after
Pycnogenol® supplementation.⁎P b 0.05 compared to pre-PYC PMNL.
maintained at the level of untreated control cells for 3 min after fMLP
stimulation in PMNL obtained after Pycnogenol® administration. After
5 min an increased LTB4 production was observed which remained
significantly lower compared to LTB4 released from PMNL obtained
before Pycnogenol® consumption (see Fig. 2).
3. Results
3.1. Kinetic of 5-LOX and FLAP mRNA expression after LPS-fMLP
stimulation
In PMNL collected in fasting conditions before Pycnogenol®
supplementation, LPS priming (30 min at 37 °C) determines an increase
of 5-LOX expression (about 2 times of untreated control cells). After
cell priming, fMLP stimulation induced a further increase of 5-LOX
mRNA transcription at 3 min of incubation (Fig. 1, panel A). The increase
of 5-LOX mRNA expression is associated with a decrease of FLAP mRNA
levels at all the experimental time points. Interestingly, following 5 days
of Pycnogenol® supplementation an inhibition of the LPS-fMLP induced
up-regulation of 5-LOX was found (Fig. 1, panel B) and this coincided
with a lack of down-regulation of FLAP gene expression.
3.2. Kinetic of LTB4 generation after LPS-fMLP stimulation
3.3. Kinetic of PMNL COX-1 expression after LPS-fMLP stimulation
To have a better picture of the effect of Pycnogenol® supplementation on AA pathway in human activated PMNL, the expression of COX-1
and COX-2 was analysed. COXs are key rate limiting enzymes in the
biosynthesis of prostaglandins and thromboxane from AA. COX-1 is
usually considered to be constitutively expressed and its mRNA is very
stable [16]. However, in PMNL collected before Pycnogenol® administration and primed for 30 min with LPS, as early as 15 s after fMLP
stimulation, a 4-fold up-regulation of COX-1 mRNA expression was
observed (Fig. 3). Pycnogenol® supplementation, initially, does not
interfere with the effect of LPS-fMLP stimulation on COX-1 mRNA
expression (see Fig. 3); but after 1.5 and 5 min of fMLP stimulation a
significantly higher COX-1 up-regulation in comparison with PMNL
collected before the administration of Pycnogenol®, was observed.
The release of LTB4 from PMNL obtained from donors before
Pycnogenol® administration began to increase 15 s after fMLP
stimulation (about 40% of increase compared to untreated control
cells). The highest level of LTB4 production was measured 5 min after
fMLP stimulation. As expected from the inhibitory effect of Pycnogenol® supplementation on the LPS-fMLP dependent increase of 5LOX mRNA expression, the generation of the final product LTB4 was
3.4. Kinetic of PMNL COX-2 transcription activation subsequent to LPS-fMLP
stimulation
Fig. 2. Effect of fMLP agonist stimulation on LTB4 release in PMNL isolated before and
after Pycnogenol® supplementation. Before fMLP activation cells were primed with LPS
for 30 min at 37 °C. Data are expressed as % compared with control. Control is LTB4
released in the supernatant of PMNL before any treatments. Pre-PYC are PMNL isolated
before Pycnogenol® supplementation, post-PYC are PMNL isolated after Pycnogenol®
supplementation. ⁎P b 0.05 compared to pre-PYC PMNL.
Fig. 4. Effect of fMLP agonist stimulation on COX-2 gene expression in PMNL isolated
before and after Pycnogenol® supplementation. Before fMLP activation cells were
primed with LPS for 30 min at 37 °C. Data are expressed as fold of changes compared
with control. Control is gene expression before any treatments. Pre-PYC are PMNL
isolated before Pycnogenol® supplementation, post-PYC are PMNL isolated after
Pycnogenol® supplementation.⁎P b 0.05 compared to pre-PYC PMNL.
COX-2 expression is typically inducible and its mRNA has a
relatively short half life compared to COX-1. After, PMNL priming
with LPS, fMLP stimulation induced a 3-fold increase of COX-2 mRNA
expression after 3 min of incubation in baseline PMNL. Pycnogenol®
supplementation was associated with a significant down-regulation of
LPS-fMLP induced COX-2 gene expression at any time points (Fig. 4).
1148
R. Canali et al. / International Immunopharmacology 9 (2009) 1145–1149
Fig. 5. Effect of fMLP agonist stimulation on TXB2 release in PMNL isolated before and
after Pycnogenol® supplementation. Before fMLP activation cells were primed with LPS
for 30 min at 37 °C. Data are expressed as % compared with control. Control is TXB2
released in the supernatant of PMNL before any treatments. Pre-PYC are PMNL isolated
before Pycnogenol® supplementation, post-PYC are PMNL isolated after Pycnogenol®
supplementation. ⁎P b 0.05 compared to pre-PYC PMNL.
3.5. Kinetic of PMNL TXB2 generation after LPS-fMLP treatment
The increase of COX-1 and COX-2 gene expression in PMNL
collected before Pycnogenol® administration to the donors was
associated with the increase of TXB2 synthesis and release (+40%
of untreated cells) into the culture supernatant (Fig. 5). Pycnogenol®
supplementation lead to the inhibition of TXB2 release during the first
2 min after fMLP stimulation. However, 5 min after stimulation the
amount of TXB2 in the supernatant was higher than that found in LPSfMLP treated PMNL, isolated before Pycnogenol® supplementation.
3.6. Kinetic of PMNL PGE2 generation after LPS-fMLP treatment
As shown in Fig. 6, PGE2 production increases after LPS-fMLP
stimulation in PMNL collected before Pycnogenol® supplementation. In
fact, PGE2 levels were 50% higher than in untreated control cells, at
5 min after stimulation. Moreover, PGE2 production doubled compared
to baseline values (207%) 30 min after fMLP stimulation (data not
shown). Pycnogenol® supplementation was associated to a 3-fold
increase of PGE2 release with a peak of production 2 min after fMLP
stimulation. The decrease of PGE2 release after 5 min could be the result
of a dynamic balance between inside and outside of the cells [17].
3.7. Kinetic of PMNL PLA2 after LPS-fMLP treatment
The availability of AA, the substrate of 5-LOX and COX enzymes, is
the rate limiting step in leukotriene, thromboxane and prostaglandin
Fig. 6. Effect of fMLP agonist stimulation on PGE2 release in PMNL isolated before and
after Pycnogenol® supplementation. Before fMLP activation cells were primed with LPS
for 30 min at 37 °C. Data are expressed as % compared with control. Control is PGE2
released in the supernatant of PMNL before any treatments. Pre-PYC are PMNL isolated
before Pycnogenol® supplementation, post-PYC are PMNL isolated after Pycnogenol®
supplementation.⁎P b 0.05 compared to pre-PYC PMNL.
Fig. 7. Effect of fMLP agonist stimulation on PLA2 enzyme activity in PMNL isolated
before and after Pycnogenol® supplementation. Before fMLP activation cells were
primed with LPS for 30 min at 37 °C. Data are expressed as % compared with control.
Control is PLA2 activity before any treatments. Pre-PYC are PMNL isolated before
Pycnogenol® supplementation, post-PYC are PMNL isolated after Pycnogenol®
supplementation.⁎P b 0.05 compared to pre-PYC PMNL.
biosynthesis and the release of AA, following cell activation, depends
on PLA2 activation. In PMNL isolated in fasting condition, before
Pycnogenol® administration, PMNL priming with LPS and the
following stimulation with fMLP was associated with an increased
PLA2 activity (Fig. 7). Pycnogenol® supplementation for 5 days
inhibits the increased PLA2 activity induced by LPS priming and
fMLP treatment in isolated PMNL.
4. Discussion
Human neutrophils play an important role in inflammation; they
are attracted to the inflammation loci and release inflammatory
mediators, such as lytical enzymes, AA derivatives, cytokines,
metabolites, and toxic oxygen derivatives. Many aspects of inflammation are mediated or modulated by the upstream mediators arising
from the COX and LOX cascade. The generation of free AA, is the
product at the top of the cascade, which is subsequently converted by
LOX enzymes to LTs or PGs and TXB by COX enzymes. The distribution
of 5-LOX is limited to a specific number of myeloid cells: neutrophils,
eosinophils monocytes, macrophages, mast cells, basophils and B
lymphocytes. Following stimulation, 5-LOX translocates to the nuclear
membrane where it co-localizes with FLAP and cPLA2. FLAP activates
5-LOX by specifically binding and transferring AA to the enzyme [18].
Acting in concert these proteins generate LTs [19,20]. Neutrophils are
equipped with an LTA4 hydrolase that converts the intermediate LTA4
into the dihydroxy acid leukotriene LTB4. Unaltered LTA4 leaves the
originating cell and circulates available for other cells expressing LTC4
synthase, such as mast cells, eosinophils or endothelial cells to form
LTC4, the first product of the cys-LTs [21]. The evidence for the
importance of LTs in disease development was often obtained from
the detections of these mediators in inflammatory exudates and
further supported by the efficacy of LT antagonists for abolishing or
reducing the inflammatory condition [22]. Pycnogenol® has been
demonstrated to possess a variety of anti-inflammatory effects. In
asthmatic patients, Pycnogenol® was found to significantly lower
leukotriene levels [10,11]. The lowered leukotriene levels in asthmatic
patients may, however, have been secondary effects. To date there is
no data available suggesting a pharmacologic effect of Pycnogenol® for
inhibition of the AA pathway on a molecular level. Our experiments
show that LPS-fMLP stimulation of PMNL, obtained from healthy
fasting volunteers before Pycnogenol® administration, up-regulate 5LOX and down-regulate FLAP mRNA transcription. These observations
are in agreement with previous reports of increased levels of FLAP
mRNA generally overlapping a decrease of 5-LOX and vice versa [23].
5-LOX and FLAP co-regulated expression determine the increase of
LTB4 production. Pycnogenol® supplementation suspended the
R. Canali et al. / International Immunopharmacology 9 (2009) 1145–1149
interdependency between 5-LOX and FLAP mRNA expression. Therefore, Pycnogenol® supplementation appears to be associated with a
different regulation of 5-LOX and FLAP expression in turn leading to a
decreased LTB4 production as opposed to stimulated PMNL collected
before Pycnogenol® supplementation.
COX-1 enzyme is ubiquitously expressed and is responsible for the
production of PGs involved in the maintenance of homeostatic functions. In contrast, COX-2 is usually induced in response to inflammatory stimuli [24]. Nevertheless, it has been described that COX-1 can
be regulated during development or by specific hormones and growth
factors. COX-2 is constitutively expressed in specific tissues such as the
brain, reproductive organs, kidney and thymus [25]. Moreover,
available data also suggest that COX-1 may be induced at the site of
inflammation [26].
Our results show that LPS priming and fMLP treatment induce
mRNA expression of both COX-1 and COX-2 in PMNL collected before
Pycnogenol® administration to blood donors. The highest levels of
COX-1 were induced 15 s after fMLP stimulation, while the highest
COX-2 expression was observed 3 min after fMLP stimulation.
Pycnogenol® supplementation was associated with a down-regulation
of COX-2 transcription and with a significantly higher expression of
COX-1 compared to pre-PYC stimulated PMNL.
Moreover, our results indicate that the increase of PGE2 and TXB2
release, in PMNL collected after Pycnogenol® oral administration is the
result of the increase of COX-1 mRNA levels. In fact Pycnogenol®
supplementation is associated with a lack of induction of COX-2.
mRNA and baseline protein concentration is obviously absent.
A functional coupling between brain cPLA2 and COX-2 was
suggested by 50–60% decrease of COX-2 mRNA and protein levels in
cPLA2 knockout mice [27]. Our data show a decrease of PLA2 activity
in stimulated PMNL obtained after Pycnogenol® supplementation. NFκB transcription factor has been reported to act as transcriptional
regulator of both PLA2 and COX-2 but also of 5-LOX expression [28–
30]. We can, therefore, hypothesize that Pycnogenol® supplementation is associated to a decrease of NF-κB-mediated response triggered
by the inflammatory stimuli, correlated to the observed lack of
induction of 5-LOX and COX-2 expression and possibly to the decrease
of PLA2 activity. These findings are associated with a compensatory
up-regulation of COX-1 expression [31].This hypothesis is supported
by data indicating a Pycnogenol® dependent inhibition of NF-κB in
endothelial cells and macrophages, in inflammatory condition [12,32].
Our results indicate that Pycnogenol® supplementation in humans
is able to modulate the AA cascade, blocking COX-2 and 5-LOX
pathways and leading to a shift of the metabolic pathways in favour of
COX-1 activity. Future studies should elucidate the molecular effects of
Pycnogenol® on the translation of COX and LOX enzymes in myeloid
cell lines in response to pro-inflammatory stimuli. This would help to
better understand the kinetics of prostaglandin and leukotriene
synthesis involved in the anti-inflammatory activity of Pycnogenol®.
Acknowledgment
This study was supported by Horphag Research, Geneva Switzerland.
References
[1] Martel-Pelletier J, Lajeunesse D, Reboul P, Pelletier JP. Therapeutic role of dual
inhibitors of 5-LOX and COX, selective and non-selective non steroidal antiinflammatory drugs. Ann Rheum Dis 2003;62:501–9.
[2] Furst DE. Pharmacology and efficacy of cyclooxygenase inhibitors. Am J Med
1999;107(suppl):18S–26S.
[3] Hendersen R. The role of leukotrienes in inflammation. Ann Int Med 1994;121(9):
684–97.
1149
[4] Wenzel SE. Arachidonic acid metabolites: mediators of inflammation in asthma.
Pharmacotherapy 1997;17:3S–12S.
[5] Rohdewald P. A review of the French maritime pine bark extract (Pycnogenol), a
herbal medication with a diverse clinical pharmacology. Int J Clin Pharmacol Ther
2002;40(4):158–68.
[6] Karonen M, Hamalainen M, Nieminen R, Klika KD, Loponen J, Ovcharenko VV, et al.
Phenolic extractives from the bark of Pinus sylvestris L. and their effects on
inflammatory mediators nitric oxide and prostaglandin E2. J Agric Food Chem
2004;52(25):7532–40.
[7] Belcaro G, Cesarone MR, Rohdewald P, Ricci A, Ippolito E, Dugall M, et al.
Prevention of venous thrombosis and thrombophlebitis in long-haul flights with
Pycnogenol. Clin Appl Thromb Hemost 2004;10(4):373–7.
[8] Wang S, Tang D, Zaho Y, Gao G, Gao X, Hu L. The effects of Pycnogenol on the
microcirculation, platelet function and ischemic myocardium in patients with
coronary artery diseases. Eur Bull Drug Res 1999;7:19–25.
[9] Schafer A, Chovanova Z, Muchova J, Sumegova K, Liptakova A, Durackova Z, et al.
Inhibition of COX-1 and COX-2 activity by plasma of human volunteers after
ingestion of French maritime pine bark extract (Pycnogenol). Biomed Pharmacother
2006;60(1):5–9.
[10] Hosseini S, Pishnamazi S, Sadrzadeh SM, Farid F, Farid R, Watson RR. Pycnogenol in
the management of asthma. J Med Food 2001;4(4):201–9.
[11] Lau BHS, Riesen SK, Truong KP, Lau EW, Rohdewald P, Barreta BS. Pycnogenol as an
adjunct in the management childhood asthma. J Asthma 2004;41(8):825–32.
[12] Grimm T, Chovanova Z, Muchova J, Sumegova K, Liptakova A, Durackova Z, et al.
Inhibition of NF-kappaB activation and MMP-9 secretion by plasma of human
volunteers after ingestion of maritime pine bark extract (Pycnogenol). J Inflamm
(Lond) 2006;3:1.
[13] Goldberg DM, Yan J, Soleas GJ. Absorption of three wine-related polyphenols in
three different matrices by healthy subjects. Clin Biochem 2003;36(1):79–87.
[14] Surette ME, Dallaire N, Jean N, Picard S, Borgeat P. Mechanisms of the priming
effect of lipopolysaccharides on the biosynthesis of leukotriene B4 in chemotactic
peptide-stimulated human neutrophils. Faseb J 1998;12(14):1521–31.
[15] Gasser O, Schifferli JA. Activated polymorphonuclear neutrophils disseminate antiinflammatory microparticles by ectocytosis. Blood 2004;104:2543–8.
[16] Lukiw WJ, Bazan NG. Cyclooxygenase 2 RNA message abundance, stability, and
hypervariability in sporadic Alzheimer neocortex. J Neurosci Res 1997;50(6):937–45.
[17] Chan BS, Satriano JA, Pucci M, Schuster VL. Mechanism of prostaglandin E2 transport
across the plasma membrane of HeLa cells and Xenopus oocytes expressing the
prostaglandin transporter “PGT”. J Biol Chem 1998;273(12):6689–97.
[18] Abramovitz M, Wong E, Cox ME, Richardson CD, Li C, Vickers PJ. 5-Lipoxygenaseactivating protein stimulates the utilization of arachidonic acid by 5-lipoxygenase.
Eur J Biochem 1993;215(1):105–11.
[19] Peters-Golden M, Brock TG. Intracellular compartmentalization of leukotriene
synthesis: unexpected nuclear secrets. FEBS Lett 2001;487(3):323–6.
[20] Radmark OP. The molecular biology and regulation of 5-lipoxygenase. Am J Respir
Crit Care Med 2000;161(2 Pt 2):S11–5.
[21] Sala A, Bolla M, Zarini S, Muller-Peddinghaus R, Folco G. Release of leukotriene A4
versus leukotriene B4 from human polymorphonuclear leukocytes. J Biol Chem
1996;271(30):17944–8.
[22] Jala VR, Haribabu B. Leukotrienes and atherosclerosis: new roles for old mediator.
Trends Immunol 2004;25(6):315–22.
[23] Kaminski WE, Jendraschak E, Baumann K, Kiefl R, Fischer S, Marcus AJ, et al.
Human mononuclear cells express 12-LX: coordinated mRNA regulation with 5-LX
and FLAP genes. Blood 1996;87(1):331–40.
[24] Kaufmann WE, Andreasson KI, Isakson PC, Worley PF. Cyclooxygenases and the
central nervous system. Prostaglandins 1997;54(3):601–24.
[25] Secchiero P, Gonelli A, Ciabattoni G, Melloni E, Grill V, Rocca B, et al. TNF-related
apoptosis-inducing ligand (TRAIL) up-regulates cyclooxygenase (COX)-1 activity and
PGE(2) production in cells of the myeloid lineage. J Leukoc Biol 2002;72(5):986–94.
[26] Wallace JL, Bak A, McKnight W, Asfaha S, Sharkey KA, MacNaughton WK.
Cyclooxygenase 1 contributes to inflammatory responses in rats and mice:
implications for gastrointestinal toxicity. Gastroenterology 1998;115(1):101–9.
[27] Tanabe T, Tohnai N. Cyclooxygenase isozymes and their gene structures and
expression. Prostaglandins Other Lipid Mediat 2002;68–69:95–114.
[28] Andreani M, Olivier JL, Berenbaum F, Raymondjean M, Bereziat G. Transcriptional
regulation of inflammatory secreted phospholipases A(2). Biochim Biophys Acta
2000;1488(1–2):149–58.
[29] Ahn KS, Aggarwal BB. Transcription factor NF-kappaB: a sensor for smoke and
stress signals. Ann N Y Acad Sci 2005;1056:218–33.
[30] Choi SH, Langenbach R, Bosetti F. Cyclooxygenase-1 and -2 enzymes differentially
regulate the brain upstream NF-kappa B pathway and downstream enzymes
involved in prostaglandin biosynthesis. J Neurochem 2006;98(3):801–11.
[31] Peng Q, Wei Z, Lau BH. Pycnogenol inhibits tumor necrosis factor-alpha-induced
nuclear factor kappa B activation and adhesion molecule expression in human
vascular endothelial cells. Cell Mol Life Sci 2000;57(5):834–41.
[32] Peng Q, Wei Z, Lau BH. Pycnogenol inhibits tumor necrosis factor-alpha induced
nuclear factor kappa B activation and adhesion molecule expression in human
vascular endothelial cells. Cell Mol Life Sci 2000;57(5):834–41.