This information is current as
of April 3, 2017.
The Inducible Tissue-Specific Expression of
the Human IL-3/GM-CSF Locus Is
Controlled by a Complex Array of
Developmentally Regulated Enhancers
Euan W. Baxter, Fabio Mirabella, Sarion R. Bowers, Sally
R. James, Aude-Marine Bonavita, Elisabeth Bertrand,
Ruslan Strogantsev, Abbas Hawwari, Andrew G. Bert,
Andrea Gonzalez de Arce, Adam G. West, Constanze
Bonifer and Peter N. Cockerill
Supplementary
Material
http://www.jimmunol.org/content/suppl/2012/09/28/jimmunol.120191
5.DC1
Subscription
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Permissions
Email Alerts
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2012 by The American Association of
Immunologists, Inc. All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on April 3, 2017
J Immunol published online 28 September 2012
http://www.jimmunol.org/content/early/2012/09/28/jimmun
ol.1201915
Published September 28, 2012, doi:10.4049/jimmunol.1201915
The Journal of Immunology
The Inducible Tissue-Specific Expression of the Human
IL-3/GM-CSF Locus Is Controlled by a Complex Array of
Developmentally Regulated Enhancers
Euan W. Baxter,* Fabio Mirabella,*,1 Sarion R. Bowers,*,2 Sally R. James,*
Aude-Marine Bonavita,* Elisabeth Bertrand,* Ruslan Strogantsev,†,3 Abbas Hawwari,‡,4
Andrew G. Bert,‡ Andrea Gonzalez de Arce,* Adam G. West,† Constanze Bonifer,*,5 and
Peter N. Cockerill*
T
he closely linked IL-3 and GM-CSF genes are tightly
regulated and are both expressed in a highly inducible and
tissue-specific fashion (1). IL-3 and GM-CSF are closely
related cytokines that activate the same signaling pathways and
have similar functions (2, 3). However, they also have important
*Leeds Institute of Molecular Medicine, University of Leeds, St. James’s University
Hospital, Leeds LS9 7TF, United Kingdom; †Institute of Cancer Sciences, Western
Infirmary, University of Glasgow G11 6NT, Scotland, United Kingdom; and
‡
Centre for Cancer Biology, SA Pathology, Adelaide 5000, South Australia, Australia
1
Current address: Institute of Cancer Research, Sutton, U.K.
2
Current address: Department of Molecular and Cellular Biology, University of Connecticut, Storrs, CT.
3
Current address: Department of Physiology, University of Cambridge, Cambridge,
U.K.
4
Current address: Department of Genetics, King Faisal Specialist Hospital and Research Centre, Riyadh, Saudi Arabia.
5
Current address: School of Cancer Sciences, Institute of Biomedical Research,
University of Birmingham, Birmingham, U.K.
Received for publication July 31, 2012. Accepted for publication August 30, 2012.
This work was supported by the Association for International Cancer Research, the
Biotechnology and Biological Sciences Research Council, Leukaemia and Lymphoma Research, the Medical Research Council, the European Community, and
the National Health and Medical Research Council.
Address correspondence and reprint requests to Prof. Peter N. Cockerill at the current
address: School of Immunity and Infection, College of Medicine and Dentistry,
Institute of Biomedical Research, University of Birmingham, Edgbaston, Birmingham B15 2TT, U.K. E-mail address: [email protected]
The online version of this article contains supplemental material.
Abbreviations used in this article: BAC, bacterial artificial chromosome; ChIP, chromatin immunoprecipitation; CML, chronic myeloid leukemia; CNSa, conserved noncoding sequence a; CsA, cyclosporin A; DHS, DNase I-hypersensitive site; HSC,
hematopoietic stem cell; LCR, locus control region; MEF, mouse embryonic fibroblast; MP, myeloid progenitor; PMA/I, PMA and calcium ionophore; TK, thymidine
kinase; UTR, untranslated region.
Copyright Ó 2012 by The American Association of Immunologists, Inc. 0022-1767/12/$16.00
www.jimmunol.org/cgi/doi/10.4049/jimmunol.1201915
unique roles in vivo. IL-3 has more wide-ranging functions, as it
regulates the proliferation, differentiation, activation, and survival
of hematopoietic progenitor cells, and it promotes the differentiation of mast cells, eosinophils, basophils, neutrophils, monocytes,
megakaryocytes, and erythroid cells (2, 3). Although IL-3 is not
essential for adult hematopoiesis, it can function as a proinflammatory cytokine in vivo, and as a CSF in vitro. During embryogenesis, IL-3 is known to play an important role in mobilizing
and amplifying the earliest hematopoietic stem cells (HSCs)
emerging from the endothelium of the developing aorta, and it has
been shown that IL-3 mutant embryos are deficient in HSCs (4).
Within the lumen of the aorta-gonad-mesonephros region of the
embryo, IL-3 is expressed by cells adhering to the endothelial
wall, but the identity of these cells remains unknown (4). IL-3 is
also required for expansion of hemangioblasts in the aorta-gonadmesonephros region at an even earlier stage of embryogenesis (5).
GM-CSF functions primarily as a powerful proinflammatory cytokine (3, 6), acting more specifically on granulocyte-macrophage
lineage cells and mediating some of the key actions of TNF-a (7).
The IL-3, GM-CSF, and IL-5 genes all evolved from a common
ancestor and remain linked within a 1-Mb cluster of cytokine genes
(8). The human IL-3 and GM-CSF genes remain just 10.5 kb apart
as a single compact locus, whereas the IL-5 gene lies 465 kb
downstream. Although they are coinduced upon activation in some
cell types, such as Th2 cells and mast cells, they are differentially
expressed in other cell types, and are likely to have independent
mechanisms of regulation. Furthermore, the IL-5 gene is functionally linked to the IL-4/IL-13 locus as part of a region known
as the Th2 cluster, which is regulated by a shared locus control
region (LCR) (9, 10).
Despite their close proximity within the same locus, the human
IL-3 and GM-CSF genes appear to be regulated independently of
each other as two distinct genes. Although they are coexpressed in
Downloaded from http://www.jimmunol.org/ by guest on April 3, 2017
The closely linked human IL-3 and GM-CSF genes are tightly regulated and are expressed in activated T cells and mast cells. In this
study, we used transgenic mice to study the developmental regulation of this locus and to identify DNA elements required for its
correct activity in vivo. Because these two genes are separated by a CTCF-dependent insulator, and the GM-CSF gene is regulated
primarily by its own upstream enhancer, the main objective in this study was to identify regions of the locus required for correct
IL-3 gene expression. We initially found that the previously identified proximal upstream IL-3 enhancers were insufficient to
account for the in vivo activity of the IL-3 gene. However, an extended analysis of DNase I-hypersensitive sites (DHSs) spanning
the entire upstream IL-3 intergenic region revealed the existence of a complex cluster of both constitutive and inducible DHSs
spanning the 234- to 240-kb region. The tissue specificity of these DHSs mirrored the activity of the IL-3 gene, and included
a highly inducible cyclosporin A-sensitive enhancer at 237 kb that increased IL-3 promoter activity 40-fold. Significantly,
inclusion of this region enabled correct in vivo regulation of IL-3 gene expression in T cells, mast cells, and myeloid progenitor
cells. The Journal of Immunology, 2012, 189: 000–000.
2
DEVELOPMENTAL REGULATION OF THE IL-3/GM-CSF LOCUS
Materials and Methods
All experiments involving animals or humans were authorized by research
ethics committees.
Transgenic mice
The previously described B38, C42, and D48 IL-3/GM-CSF transgenic mouse
lines contain one to six copies of a 130-kb AgeI DNA fragment of bacterial
artificial chromosome (BAC) clone CTD2004C12 (24). Line E52 contains
one copy of the same BAC fragment, but has a 15.5-kb deletion at the 39 end,
terminating 21 kb downstream of the GM-CSF gene, and lacking the +30 kb
region homologous to mouse CNSa +34-kb enhancer element (18). Copy
number was estimated made by Southern blot hybridization of mouse and
human DNA, with human IL-3 and GM-CSF and mouse CD19 gene probes.
Cell preparation and stimulation
Unless indicated otherwise, all cell stimulation was for 4 h with 20 ng/ml
PMA and 2 mM calcium ionophore A23187 (PMA/I). Human cell lines
Jurkat T cells, HMC-1 mast cells, KG1a myeloblastic cells, and Raji
B cells were all cultured, as previously described (25). HMC-1 mast cells
were obtained from J. Butterfield (Mayo Clinic, Rochester, MN) (26).
Mouse cells used in this study include the following: 1) freshly isolated
thymocytes obtained by passing a thymus through a cell strainer; 2) spleenderived CD19+ve B cells purified on magnetic beads; 3) actively dividing
T blast cells prepared from splenic T cells (24); 4) mast cells grown from
bone marrow by long-term culture in IL-3 and stem cell factor (25); 5)
myeloid progenitor (MP) cells and macrophages derived from fetal liver;
and 6) mouse embryonic fibroblasts (MEFs) cultured from embryos. The
MP cells were grown from day 13.5 transgenic mouse fetal liver by culture
at starting density of 1 3 106 cells/ml for 5–8 d in IMDM supplemented
with 10% FCS, 150 mM monothioglycerol, 500 U/ml penicillin and streptomycin, 10 ng/ml mouse rIL-3, and 10 ng/ml recombinant mouse stem cell
factor. Nonadherent cells were moved into a new flask each time they were
expanded so as to separate them from any emerging adherent macrophages
from the culture. We confirmed that these cells grew as bunches of round
nonadherent cells, stained for ERMP12 Abs, and were not granular, as is
expected for MP cells. In parallel, the adherent macrophages were maintained
in isolation from the MP cells in the presence of 10% L cell-conditioned
media containing M-CSF until they reached confluence. The MEFs were
prepared from decapitated, eviscerated day 13.5 transgenic mouse embryos
dispersed by digestion for several hours with 0.25% collagenase, followed by
culture for 14 d in DMEM plus 5% FCS, splitting the cells each time they
reached confluence. The T lymphoblasts were prepared by culture with CD3/
CD28 Ab beads for 2 d, followed by culture in IL-2 for an additional
2 d without beads. Liver nuclei were prepared by homogenizing liver in
nuclei digestion buffer containing 0.3 M sucrose (25), passing it through a
70 mM strainer, and centrifugation in an angle rotor at 18,500 3 g through
a cushion of digestion buffer containing 1.8 M sucrose for 30 min at 4˚C.
mRNA analyses
mRNA was extracted from cells using TRIzol (Invitrogen), according to
the manufacturer’s instructions. cDNA was generated from purified mRNA
using Moloney murine leukemia virus reverse transcriptase (Invitrogen),
according to the manufacturer’s recommendation. Unless indicated otherwise, all the gene expression analyses were performed by quantitative
real-time PCR using SYBR Green I reagents (Applied Biosystems, Foster
City, CA) on an ABI Prism 7500. The data from each set of primers were
analyzed against a standard curve made with a serial dilution of cDNA
from PMA/I-stimulated T blast cells or mast cells. Levels of expression of
mRNA encoding both human and mouse GM-CSF and IL-3 were determined relative to mouse GAPDH expression. Semiquantitative analysis of
mRNA was performed using 25 cycles of PCR.
Primers used for mRNA analyses were as follows. Human GM-CSF:
forward, 59-CACTGCTGCTGAGATGAATGAAA-39; reverse, 59-GTCTGTAGGCAGGTCGGCTC-39. Human IL-3: forward, 59-GGACTTCAACAACCTCAATGGG-39; reverse, 59-TTGAATGCCTCCAGGTTTGG-39.
Mouse GM-CSF: forward, 59-ATGCCTGTCACGTTGAATGAAG-39; reverse, 59-CAGATCGTTAAGGTGGACCATG-39. Mouse GAPDH: forward, 59-TGGTGAAGCAGGCATCTGAG-39; reverse, 59-TGTTGAAGTCGCAGGAGACAAC-39. Because the sequences of the mouse and human IL-3 and GM-CSF coding regions have diverged considerably, these
primer sets do not cross-react between the human and mouse mRNAs (and
the human proteins do not recognize the mouse receptors).
DHS analysis
DNase I digestions and analyses were performed on either isolated nuclei or
permeabilized cells, as previously described (24, 25). Samples with optimal
extents of DNase I digestion were selected for Southern blot hybridization
analysis of DHSs using the strategies summarized below.
Probes based on previously published strategies for mapping DHSs
were as follows: 1) DHSs upstream of the IL-3 gene 210.1-kb BamHI site
were probed with a 0.7-kb EcoRI/BamHI fragment of DNA (210.1 to 210.8
kb); 2) DHSs across the IL-3 promoter region were mapped from the
26.6-kb SpeI site with a 0.5-kb SpeI/BamHI fragment of DNA; 3) DHSs
across a 9.4-kb region spanning the GM-CSF enhancer and promoter were
mapped from an EcoRI site 6.8 kb upstream from the GM-CSF gene using
a 1.5-kb BamHI fragment of DNA as a probe (2); 4) DHSs spanning the
insulator downstream of the IL-3 gene were mapped from a BamHI site
using a 1-kb BglII/BamHI fragment of DNA (12, 15).
Downloaded from http://www.jimmunol.org/ by guest on April 3, 2017
T cells and mast cells, just GM-CSF is expressed in many types of
nonhematopoietic cells such as endothelial and epithelial cells (2,
3). This distinct expression pattern is made possible by a CTCFdependent insulator located between the two genes (11). The human IL-3 gene is associated with at least two upstream enhancer
elements. The most significant of these is a conserved inducible
enhancer at 24.5 kb upstream that functions in both mast cells and
T cells, and can therefore help to account for the inducible and
tissue-specific regulation of IL-3 expression (1, 12). An additional
nonconserved T cell-specific enhancer of unknown function exists
14 kb upstream of the IL-3 gene (1, 13, 14). However, there have
never been any in vivo studies performed to determine just which
regulatory elements in this locus are actually either necessary or
sufficient for correct IL-3 gene expression in vivo.
The independent expression of the human GM-CSF gene is
controlled by a conserved 23-kb enhancer that supports its efficient inducible expression in a transgenic mouse model containing
just a 10-kb segment of the human GM-CSF locus (1, 15–17). The
GM-CSF gene is also associated with additional highly conserved
far downstream sequences, one of which is known to function as
a BRG1/NF-kB–dependent enhancer in the mouse, where it was
defined as conserved noncoding sequence a (CNSa) (18). This
element is at +34 kb in the mouse and at +30 kb in the human
genome relative to the start of the GM-CSF gene.
The IL-3 24.5- and 214-kb enhancers, and the GM-CSF 23-kb
enhancer all form inducible DNase I-hypersensitive sites (DHSs)
(1, 12, 14, 16). These enhancers are each activated via cooperation between kinase and calcium signaling pathways, which in
T cells are linked to the TCR, and they each encompass binding
sites for the Ca2+-inducible transcription factor NFAT, which
supports chromatin remodeling (1, 19). Induction of these DHSs
is suppressed by cyclosporin A (CsA), which blocks the Ca2+dependent induction of NFAT by inhibiting calcineurin (12, 14,
16).
IL-3 and GM-CSF can also be aberrantly expressed in myeloid
leukemia, where they function as autocrine growth factors (20). For
example, IL-3 functions as a mediator of autocrine growth in
chronic myeloid leukemia (CML) (21), but the mechanisms responsible for its aberrant expression remain unknown. Additional
studies are, therefore, needed to identify the significant in vivo
sources of IL-3, and the DNA elements underlying the normal
induction of activation of IL-3 expression in mature hematopoietic
cells and in the developing hematopoietic system, as well as the
aberrant induction of IL-3 expression by BCR-ABL signaling in
early myeloid progenitor cells in CML patients (21–23).
In this study, we aimed to identify mechanisms controlling the
correct inducible and developmental regulation of the human IL-3
gene. We initially found that the proximal 214- and 24.5-kb enhancer regions were not sufficient to direct efficient IL-3 promoter
activation in transgenic mice. However, a more expansive analysis
revealed that a transgene incorporating a powerful 237-kb inducible enhancer was able to direct the correct pattern of inducible and
developmentally regulated IL-3 gene expression in vivo.
The Journal of Immunology
Primers used to amplify DNA segments as probes for mapping novel
DHSs are described in Supplemental Table I.
Transient transfection assays
Transfection assays and luciferase assays were performed using the luciferase reporter gene plasmid pXPG (27) containing either the 2559- to
+50-bp segment of the human IL-3 promoter (pIL3H) or a 229-bp fragment of the thymidine kinase (TK) promoter, plus the indicated upstream
DNA fragments, as described previously (25), or a DNA segment spanning
the human IL-3 +4.5-kb DHS. All transfection assays were performed by
electroporation using 4.5 3 106 cells and 5 mg test plasmid. With the
exception of Fig. 5D, in each assay cells were cotransfected with 1 mg of
an appropriate Renilla luciferase plasmid to control for transfection efficiency. Transfected cells were first cultured for 21 h to equilibrate and then
stimulated for 8 h with 20 ng/ml PMA and 1 or 2 mM A23187.
Construction of plasmids used in transfection assays
FIGURE 1. Developmental regulation
of human IL-3/GM-CSF transgenes. (A)
Map of the 130-kb BAC transgene with
the intact genomic locus showing previously defined enhancers (E), the insulator (Ins), and a region homologous to
the mouse CNSa enhancer. Lines B38,
C42, and D48 contain the complete 130kb transgene, and line E50 has a 15.5-kb
39 deletion, as indicated by the bracket
underneath. Underneath is the map of the
minimal IL-3/Enhancer transgenic construct
containing just the proximal human IL-3
gene elements plus the 214-kb enhancer
linked to a human CD4 reporter gene. (B)
Copy number determination of the 130-kb
transgenes based on segments of the human
IL-3 and GM-CSF genes, using the mouse
CD19 locus as an internal reference, and
human genomic DNA as a two-copy control. (C) Human IL-3 and GM-CSF mRNA
expression in stimulated transgenic mouse
T blast cells, expressed relative to expression
of the mouse IL-3 and GM-CSF genes,
corrected for copy number. (D) Hematopoietic differentiation pathway showing
the predicted sources of IL-3 and GM-CSF.
(E) Inducible expression of human GM-CSF
and IL-3 mRNA in line C42. Columns depict mRNA expression in stimulated cells
relative to mouse GAPDH and corrected
for copy number. Fold induction relative to
nonstimulated cells is shown underneath.
pIL3H at the same time and maintain the natural order of these elements in
the genome relative to the IL-3 promoter. The combination of BglII and
KpnI made it possible to clone the +4.5-kb DHS in the sense orientation
relative to the human IL-3 and GM-CSF genes in the human genome, and
relative to the luciferase gene in pXPG.
The additional derivatives of the 684-bp X37 segment (the 237-kb
element plus XhoI adapters) as used in Fig. 7B were as follows: 1) The
123–684 fragment was generated by BamHI digestion, and the 1–305 and
305–684 fragments were generated by PvuII digestion. 2) PCR-generated
subfragments of the X37 segment were engineered using primers containing BglII and KpnI cloning sites, as follows. The 274-bp 84–357
segment was created with 59-TTTATAGATCTCTGGGGAAGGGACATC39 and 59-AATTAGGTACCGGCTAGGTTAGGAAGGAC-39. The 184-bp
84–267 segment was created with 59-TTTATAGATCTCTGGGGAAGGGACATC-39 and 59-AATTAGGTACCATGAGATGACACTGACTC-39.
Primers used for site-directed mutagenesis of X37 were as follows:
GATA forward, 59-GGGTGTGGGATCCAGgcAACACAGGATGAGAGG39 and reverse, 59-CCTCTCATCCTGTGTTgcCTGGATCCCACACCC-39;
ETS-1#1 forward, 59-GGGATCCAGATAACACActATGAGAGGTGGGAGG-39 and reverse, 59-CCTCCCACCTCTCATagTGTGTTATCTGGATCCC-39; ETS-1#2 forward, 59-GAAAGAAAGTTCAGGCAAAGctACATCTTGCAGGTCTTTCTC-39 and reverse, 59-GAGAAAGACCTGCAAGATGTagCTTTGCCTGAACTTTCTTTC-39; EGR-1 forward, 59-CAAACAACCTggtgaACAAAATCATATTG-39 and reverse, 59-CAATATGATTTTGTtcaccAGGTTGTTTG-39.
EMSAs and chromatin immunoprecipitation
EMSAs of the IL-3 237-kb enhancer EGR-1 site were performed, as
previously described (28), and used the following primers: forward strand,
59-AGGTCTTTCTCAAACAACCTCCCCCACAAAATCATATTGA-39; reverse strand, 59-TCAATATGATTTTGTGGGGGAGGTTGTTTGAGAAAGACCT-39.
EMSAs employed nuclear extracts from Jurkat T cells, cultured with
and without stimulation for 4 h with 20 ng/ml PMA and 0.57 mM calcium
ionophore A23187. The supershift EMSAs included Abs against Sp1
(Millipore; 17-601), Sp3 (Santa Cruz Biotechnology; sc644X), or EGR-1
(Santa Cruz Biotechnology; sc110X).
Downloaded from http://www.jimmunol.org/ by guest on April 3, 2017
DNA fragments spanning the human IL-3 240-, 237-, 234-kb, and +4.5kb DHSs were amplified from the BAC CTD2004C12 by PCR using
primers with restriction enzyme sites added to allow cloning, as follows.
IL-3 237-kb DHS with XhoI linkers (defined in this study as the X37
element because of the XhoI sites): forward, 59-CCCGCTCGAGCTAAATGCATTTCCCACC-39; reverse, 59-CCCGCTCGAGCTGAGGAGTGGAGATTACAGG-39. IL-3 234-kb DHS with KpnI linkers: forward,
59-GGGGGGTACCGGCCATCATAGAAGCAGAAGG-39; reverse, 59-GGGGGGTACCTGAATCACAGAGTGCCCACC-39. IL-3 240-kb DHS
with BamHI linkers: forward, 59-CGCGGGATCCAGGGCTCAAAACCAACTATGC-39; reverse, 59-CGCGGGATCCGGTGTTTACACCTGCTCAAGG-39. IL-3 +4.5-kb DHS with BglII and KpnI linkers: forward,
59-TTCCCTAGATCTCGCACGTGACAGCTAGTC-39; reverse, 59-CTTGGTTCTGGTACCAGTCTGGCTTTAAGCTGCAG-39. After amplification
and restriction enzyme digestion, DNA fragments were cloned into either
pIL3H (12), containing the 2559- to +50-bp segment of the human IL-3
promoter in pXPG; pTK229 (12), containing a 229-bp fragment of the TK
promoter in pXPG; or, in the case of the IL-3 +4.5-kb DHS, just the luciferase vector pXPG (27). The combination of BamHI, XhoI, and KpnI
made it possible to clone each of the 240-, 237-, and 234-kb DHSs into
3
4
DEVELOPMENTAL REGULATION OF THE IL-3/GM-CSF LOCUS
EGR-1 chromatin immunoprecipitation (ChIP) assays of the human IL-3
promoter in Jurkat cells were performed, as described (28), with enrichment
levels normalized against a negative control within the human VEZF1
gene body, using the following primers: IL-3 promoter forward, 59GGTTGTGGGCACCTTGCT-39; IL-3 promoter reverse, 59-TCTGTCTTGTTCTGGTCCTTCGT-39; VEZF forward, 59-GACAGCAGCCGAACTTCGTT-39; VEZF reverse, 59-TGGTGCCCGAGGAAGATG-39.
Results
A 130-kb segment spanning the human IL-3/GM-CSF locus
supports correct developmentally regulated and inducible IL-3
and GM-CSF gene expression
Our initial aim was to determine whether the previously defined
regulatory regions of the human IL-3 locus are sufficient to support
its correct inducible and tissue-specific expression in vivo. We
created eight independent mouse lines from a transgene containing
the IL-3 214- and 24.5-kb enhancers and promoter linked to
a human CD4 reporter gene (Fig. 1A). However, this combination
of DNA elements was clearly insufficient for in vivo expression
Downloaded from http://www.jimmunol.org/ by guest on April 3, 2017
FIGURE 2. Distribution of tissuespecific and inducible DHSs in the IL-3/
GM-CSF locus. (A and B) Strategies
employed for mapping DHSs. The indirect end-labeling probes used to map
DHSs are marked as horizontal black
arrows. Brackets define the regions between specific restriction enzyme sites
covered by each probe. (A) Map of
the previously defined inducible DHSs
(vertical black arrows) and constitutive DHSs (vertical gray arrows) located
within proximal regions of the human
IL-3 and GM-CSF genes, as defined in
T cells. The black boxes indicate the
previously defined conserved 24.5-kb
IL-3 and 23-kb GM-CSF enhancers. (B)
UCSC genome browser view of conserved regions upstream of the human
IL-3 gene (http://genome.cse.ucsc.edu),
with the strategies for mapping DHSs
shown underneath. The vertical arrows
indicate the three conserved regions that
were the principal targets for analyses of
DHSs and enhancer function. (C) Summary of DHS mapping data. Inducible
DHSs are black, stable DHSs are gray,
and weak DHSs are shown as thin arrows.
Levels of inducible IL-3 and GM-CSF
expression relative to GAPDH, taken
from Fig. 1E, are indicated at the left of
each row.
because three lines displayed low-level variegated expression,
whereas the remaining five lines showed no expression upon
stimulation in T blast cells (Supplemental Fig. 1).
To aid identification of additional essential IL-3 gene regulatory elements, we performed detailed analyses of a much larger
transgene spanning the intact human IL-3/GM-CSF locus. We
created several lines of transgenic mice from a 130-kb AgeI genomic DNA fragment (lines B38, C42, D48, and E50; Fig. 1A),
which includes the entire upstream 49-kb intergenic region separating the IL-3 gene from the upstream ACSL6 gene. Lines B38,
C42, and D48 also include sequences extending to 36 kb downstream of the start of the GM-CSF gene, whereas line E50 has
a 15-kb 39 deletion and terminates 21 kb downstream. Transgene
activity was assessed in actively proliferating T blast cells generated by stimulating spleen T lymphocytes with CD3 and CD28
Abs and then culturing them for several days with IL-2 in the
absence of stimulus. These cells were then restimulated with
PMA/I to activate TCR signaling pathways and induce cytokine
The Journal of Immunology
FIGURE 3. DHS analysis of the human IL-3/
GM-CSF locus in transgenic line C42. (A–F)
Southern blot hybridization analysis of DHSs, as
summarized in Fig. 2C, using the probes defined in
Fig. 2A and 2B. DHSs were mapped before and
after stimulation for 4 h with PMA/I in line C42
mast cells, B cells, thymocytes (Thy), T blast cells
(T BI), MP cells, macrophages (MF), fibroblasts
(MEF), and liver. DHSs are marked by arrows plus
their distances in kb relative to the IL-3 gene
transcription start site.
CSF genes were efficiently induced in activated T blast cells and
mast cells. The level of expression was substantially higher in
mast cells than in T cells, possibly because of the following: 1)
mast cells express GATA-2 in addition to T cell factors such as
Runx1, NFAT, and AP-1, and 2) the IL-3/GM-CSF locus includes
many regulatory elements containing GATA motifs (1, 25). This is
consistent with our findings that the GM-CSF enhancer is more
active, and GM-CSF expression is higher, in cells expressing
GATA factors (25).
MP cells also produced high levels of GM-CSF mRNA,
equivalent to T blast cells, and moderate levels of IL-3 mRNA. In
agreement with previous studies (3), IL-3 was not expressed in
macrophages or MEFs. However, macrophages and MEFs similarly produced barely detectable levels of GM-CSF mRNA, in the
order of 1000-fold lower than T blast cells. This was consistent
with our previous studies of primary CD11b+ myeloid cells derived directly from the spleens of GM-CSF transgenic mice, where
the mouse and human GM-CSF genes were both expressed at
similar low levels (25). Hence, our findings are inconsistent with
the prevailing dogma that macrophages and fibroblasts are assumed
to be significant sources of GM-CSF.
Properties of DHSs located between the IL-3 and GM-CSF
genes
To both identify novel potential regulatory elements, and define the
pattern of developmental and inducible regulation of the IL-3/GM-
Downloaded from http://www.jimmunol.org/ by guest on April 3, 2017
gene expression. For all four lines, the IL-3 and GM-CSF genes
were efficiently induced in a copy number-dependent fashion (Fig.
1C). The average level of expression was in each case slightly
higher than the levels determined for the endogenous mouse IL-3
and GM-CSF genes (24). Line E50, which lacks the CNSa 39 GMCSF region, supported approximately the same level of IL-3 expression as the other three lines, and a slightly lower level of GMCSF expression, but this difference was not considered significant.
To define the pattern and mechanisms of developmentally
regulated inducible human IL-3 and GM-CSF gene expression
during different stages of hematopoietic differentiation, we used
transgenic mouse line C42 as a model and prepared the following
cell types: 1) thymocytes as a model of immature T cells; 2) actively dividing spleen-derived T blast cells; 3) nonadherent MP
cells cultured from fetal liver; 4) mast cells cultured from the
bone marrow; 5) adherent macrophages derived from MP cells;
and 6) fibroblasts cultured from MEFs. The differentiation pathways linking these cells are depicted in Fig. 1D. Within this
scheme, HSCs and MP cells potentially give rise to both macrophages, expected to express just GM-CSF, and mast cells that
efficiently express both IL-3 and GM-CSF.
Cells were stimulated with PMA/I, and human IL-3 and GMCSF gene mRNA expression was measured relative to mouse
GAPDH mRNA (Fig. 1E). The level of induction relative to
unstimulated cells is shown underneath this graph depicting levels
measured in stimulated cells. As anticipated, the IL-3 and GM-
5
6
DEVELOPMENTAL REGULATION OF THE IL-3/GM-CSF LOCUS
FIGURE 4. DHSs associated with a LILINE repeat element upstream of the IL-3
gene. (A) UCSC browser view and map
spanning the conserved and repeat regions
upstream of the IL-3 gene (http://genome.
cse.ucsc.edu). Probes used for mapping
DHSs in (B) and (C) are indicated by horizontal arrows, with locations of DHSs indicated as vertical arrows. The 216.4-kb
DHS lies within the 59 UTR of the L1PA13
LINE, and includes motifs for factors such
as NFAT, AP-1, ETS, PU.1, and RUNX1,
similar to the enhancers in this locus. The
223.3-kb DHS lies just outside the LIPA13
LINE, within a coding region segment of
a separate incomplete L1 LINE repeat. The
223.3-kb DHS was also detected using
the 234-kb BamHI probe used in Fig. 3E,
which employed the same BamHI Southern
blot filter as the one depicted here in (C). (B)
Higher resolution mapping of the 223.3-kb
IL-3 DHS in stimulated C42 blast cells
probed from an upstream KpnI site, and
using internal EcoRI and EcoRV sites as
size markers. The sizes of these markers are
indicated on the right-hand side, and the
positions of each band relative to the IL-3
transcription start site are shown on the left.
(C) Mapping DHSs in transgenic tissues
across the repeat-region spanning the 214kb enhancer from a BamHI site at 210.3
kb. Shown underneath is an additional DHS
identified at 210.3 kb mapped in the same
DNase I-digested samples, but assayed in a
parallel analysis from a SpeI site at 28.8 kb.
GM-CSF expression. This element may, therefore, function as a
chromatin opening element for the intergenic region separating
the GM-CSF gene from the high-affinity CTCF sites within the
insulator.
IL-3 gene activation is associated with a cluster of far
upstream DHSs
The above results suggested that the 130-kb BAC transgene is
a reliable model to study the regulation of the IL-3/GM-CSF locus.
To search for additional essential IL-3 gene regulatory elements
within this transgene, we used the mapping strategies depicted in
Figs. 2B and 4A to identify DHSs within the entire 39-kb region
between the 214-kb enhancer and the upstream ACSL6 gene.
These assays identified a tightly regulated complex cluster of
novel far upstream DHSs present only in cells capable of IL-3
gene expression (summarized in Fig. 2C) and colocalizing with
conserved noncoding sequences (Fig. 2B). This region included
a highly inducible DHS at 237.5 kb, which was strongest in mast
cells and T blast cells, weak in MP cells, and absent in all other
cell types (Fig. 3C). The 237.5-kb–inducible DHS was flanked by
stable T blast-specific DHSs located at 240.3 and 233.7 kb, and
additional inducible DHSs present in activated mast cells and T
blast cells at 240.6 and 234.0 kb, which were weak in stimulated
MP cells, and absent in other cell types (Fig. 3D, 3E). Parallel
assays of the IL-3 proximal region identified tissue-specific DHSs
at 24.1 and 24.5 kb in mast cells, T blast cells, and MP cells;
a DHS at 21.5 kb specifically in T blast cells; and inducible DHSs
at the 24.5-kb enhancer and promoter in T blasts and mast cells
(Fig. 3F). The IL-3 234.0-, 237-, and 240.6-kb–inducible DHSs
Downloaded from http://www.jimmunol.org/ by guest on April 3, 2017
CSF locus, we performed an exhaustive analysis of DHSs in line
C42 in the cell types employed above, both before and after
stimulation (Figs. 2–4), and after stimulation in the presence of
CsA (Supplemental Fig. 2). As additional nonexpressing controls,
we included splenic B cells and liver nuclei. For each cell type, the
optimal DNase I-digested samples were selected from a series of
DNase I titrations, and the same set of samples was then used for
each subsequent analysis. This selection was based on the efficiency of DNase I digestion and PMA/I induction, as confirmed by
examining the intensities of the DHS bands detected across the
ubiquitous CTCF sites within the insulator downstream of the IL-3
gene (Fig. 3A) and the inducible DHS within the GM-CSF enhancer (Fig. 3B). DHSs were mapped using the strategies depicted
in Fig. 2A. These assays demonstrated strong induction of the 23kb GM-CSF enhancer DHS in T blast cells and mast cells;
somewhat weaker induction of this DHS in MP cells, macrophages, and MEFs; and no induction in thymocytes or B cells that
do not express GM-CSF.
Within the insulator region, we also identified an inducible CsAresistant DHS at IL-3 +4.5-kb in GM-CSF–expressing cells in
addition to the ubiquitous DHSs (Supplemental Fig. 2A). Unlike
the other PMA/I-inducible DHSs in the IL-3/GM-CSF locus, this
DHS was not suppressed by CsA, which functions by blocking the
Ca2+/calcineurin-dependent induction of NFAT. Furthermore, this
DHS functioned as a noncoding RNA promoter that is transcribed
toward the +4.9-kb DHS and the GM-CSF gene (Supplemental
Fig. 2B). Interestingly, the +4.9-kb DHS, which encompasses a
low-affinity CTCF site, was weakest in the cell types that have
the weakest induction of the +4.5-kb DHS and show the lowest
The Journal of Immunology
7
were each substantially suppressed by CsA, suggesting a NFATdependent mechanism of activation (Supplemental Fig. 2C).
We also made the unexpected observation that a full-length LILINE repeat element, embedded within a 25-kb cluster of repeat
elements, was associated with inducible DHSs located at 223.3 kb
in mast cells and T blast cells, and 216.4 kb in mast cells, MP
cells, and macrophages (Fig. 4). The 216.4-kb DHS was located
within the 59 untranslated region (UTR), which represents the
promoter of the ancestral retrotransposon. An additional inducible
DHS was detected at 210.3 kb as a prominent DHS in mast cells,
and a weaker DHS in MP cells and macrophages (Fig. 4C). The
214-kb region, which functions as an enhancer in Jurkat and
CEM T cells (12), was not detected as a DHS in any of the cell
types examined in this study.
The IL-3 237-kb DHS functions as a powerful inducible
enhancer
firefly luciferase. (D) Depicts just the Firefly luciferase data so as to make it
possible to show the level of induction of the TK promoter. Error bars
indicate SD.
Downloaded from http://www.jimmunol.org/ by guest on April 3, 2017
FIGURE 5. Analysis of enhancers upstream of the IL-3 gene. (A)
Luciferase reporter gene assays in stimulated Jurkat T cells transiently
transfected with the luciferase plasmid pIL3H containing human IL-3
promoter alone or in conjunction with DNA segments containing the
indicated DHSs. For 237/240 and 234/237/240, the order of elements relative to the IL-3 promoter is as in the genome. In each case,
values represent the average of two independent constructs. (B) DHS
mapping of the IL-3 237-kb region as in Fig. 3C in human cell lines
before and after stimulation for 4 h with PMA/I. (C) Transient transfection assays of a luciferase plasmid containing the TK promoter alone,
or with either the SV40 or the IL-3 237-kb enhancer in stimulated cell
lines. (D) Transient transfection assays of a luciferase plasmid containing the TK promoter alone, or with the IL-3 237-kb enhancer, in
nonstimulated and stimulated Jurkat cells. In (A) and (C), cotransfected
Firefly luciferase activity is used to correct for transfection efficiency of
Overall, it was clear that the level of inducible IL-3 expression in
different cell types correlated very closely with the presence of
a highly complex cluster of tissue-specific DHSs occupying much
of the upstream intergenic region. Because the pattern of induction
of the 237-kb IL-3 DHS closely paralleled the induction of the
gene itself, we tested the function of this element as an inducible
enhancer of the IL-3 promoter in luciferase reporter gene assays
in Jurkat T cells stimulated with PMA/I. Parallel assays were
performed with the adjacent 234- and 240-kb DHSs, and the
previously defined 214- and 24.5-kb–inducible enhancers. We
found that the 237-kb element functioned as an exceptionally
powerful enhancer, which increased IL-3 promoter activity by 40fold (Fig. 5A). This was in the order of 20 times more powerful
than the 214- and 24.5-kb IL-3 enhancers, and 10 times greater
than the 23-kb GM-CSF enhancer (11). In contrast, the 234and 240-kb DHSs contributed no enhancer activity, even when
in combination with the 237-kb enhancer (240 plus 237, and
240 plus 237 plus 234). The 237-kb enhancer was equally active
in the reverse orientation, whereas the 240-kb DHS remained
inactive when reversed (data not shown).
Because the IL-3 promoter is itself both inducible and tissue
specific, the above assays are unable to assess either of these
parameters for the 237-kb enhancer. To find a model system in
which we could test these properties, we first screened a panel of
human cell lines for the inducible 237-kb DHS. These included
Jurkat T cells, HMC1 mast cells, and KG1a myeloid progenitor
cells, where in each case the 237-kb DHS was inducible, and Raji
B cells and 5637 epithelial cells, where this DHS could not be
induced (Fig. 5B). To assess both tissue specificity and inducibility of the 237-kb enhancer, it was assayed in plasmids containing the constitutively active TK promoter in parallel with the
well-defined SV40 enhancer, which was used as the reference
point. The 237-kb enhancer showed the greatest activity in Jurkat
T cells, where it was twice as active as the SV40 enhancer, and
increased TK promoter activity by 25-fold (Fig. 5C). The 237-kb
enhancer was also active, but to a lesser degree, in HMC1 and
KG1a cells, where it increased promoter activity by 3- to 6-fold,
whereas it was inactive in Raji B cells. The function of the 237kb enhancer was also strictly inducible because it did not support
any significant increase in TK promoter activity in the absence of
stimulation (Fig. 5D).
8
DEVELOPMENTAL REGULATION OF THE IL-3/GM-CSF LOCUS
The 237-kb enhancer encompasses conserved motifs for
inducible and developmentally regulated factors
FIGURE 6. Regulatory elements within the
237-kb IL-3 enhancer. (A) Sequence of the 684-bp
region encompassing the IL-3 237-kb enhancer,
which is termed here as the X37 element. Consensus transcription factor-binding motifs are
highlighted in gray. Each of these highlighted
motifs was found to be conserved in the genomes
of from 5 to 10 different species (average = 7) in
an alignment of the genomes of 18 placental mammals (http://genome.cse.ucsc.edu). The most highly
conserved DNA sequences are marked by a double
underline. Regions included in the 184-bp (84–269)
and 274-bp (84–357) PCR-generated subfragments
are demarcated by a slash. BamHI and PvuII sites
used to generate subfragments are shown above
the cleavage sites in italics. (B) Luciferase reporter
gene transfection assays in stimulated Jurkat T cells
of pIL3H plasmids containing segments of the
237-kb enhancer linked to the human IL-3 promoter. (C) Map of the 237-kb enhancer with transcription factor motifs and showing DNA segments
used in transfection assays. (D) Transient transfection assays in stimulated Jurkat T cells of pIL3H
plasmids containing the 237-kb enhancer with the
indicated mutations.
Downloaded from http://www.jimmunol.org/ by guest on April 3, 2017
The 684-bp sequence used in Fig. 5A to define the 237-kb enhancer
is displayed in Fig. 6A, in which the conserved transcription factorbinding motifs are highlighted in gray and the most highly conserved DNA sequences are double underlined. These include a
55-bp core region containing GATA, ETS-1, and NFAT consensus
elements, plus downstream EGR-1, NFAT, and AP-1 elements.
These elements are widely conserved across a broad range of
mammalian species (http://genome.cse.ucsc.edu). Supplemental
Fig. 3 depicts the alignment between nine representative mammalian genomes. For this group of mammals, it can be seen that
the core region of the enhancer is well conserved across primates,
dogs, cats, and horses, but less well conserved among rodents. The
most highly conserved motifs are the four adjacent elements in the
central region that have consensus-binding sequences for ETS-1
(site 2), EGR-1, NFAT, and AP-1, and are highlighted on line 3 of
the sequence in Fig. 6A.
To further dissect tissue-specific mechanisms of enhancer
function, we followed the parallel approaches of the following: 1)
assaying subfragments of the enhancer, starting from the 684-bp
fragment (termed the X37 element because it has XhoI adapters at
the ends of the 237-kb DHS) defined above (Fig. 6B, 6C), and 2)
making point mutations in motifs for the developmentally regulated factors GATA, ETS-1, and EGR-1 (Fig. 6D). Fig. 6B shows
that the minimal region maintaining full enhancer function is
defined by a 274-bp core region (bases 84–357) encompassing the
DHS and incorporating most of the transcription factor motifs
depicted in Fig. 6A. DNA fragments lacking the downstream AP-1
site (bases 123–305 or 84–269) had substantially reduced enhancer
activity (Fig. 6B, 6C). Although this downstream AP-1 motif was
clearly required for maximal function of the full-length enhancer,
the downstream segment encompassing bases 306–684 bp, encompassing this AP-1 site plus an NFAT site, was completely inactive
in the absence of the upstream elements.
The most significant motif identified by point mutations within
the 274-bp core region was the EGR-1 site, where enhancer activity
was reduced to ∼17% (Fig. 6D). The two ETS-1 motifs also each
contributed to enhancer function, whereby mutation of site 1 reduced enhancer activity to 62% and mutation of site 2 reduced
enhancer activity to 26% (Fig. 6D). No effect on enhancer activity
was observed after either specific mutation of the conserved
GATA motif or deletion of the nonconserved weak consensus
PU.1 motif, most likely because Jurkat cells do not express GATA
factors (25), and T cells do not normally express PU.1 (29).
Because EGR-1 motifs frequently overlap with Sp1 motifs (30),
we further investigated the nature of factors binding to the crucial
EGR-1 motif within the 237-kb enhancer. The 237-kb EGR-1
element resembles an EGR-1 binding site in the IL-2 gene (31),
whereby both elements encompass the sequence TCCCCCAC and
overlap with Sp1-like motifs. It has been shown previously that
Sp1 and EGR-1 compete for binding to overlapping sites, and it is
The Journal of Immunology
proposed that EGR-1 displaces Sp1 to mediate activation of some
PMA-inducible genes (32). To determine which of these factors
bind to the enhancer, we performed EMSA and ChIP analyses in
PMA/I-stimulated Jurkat cells (Fig. 7A, 7B). In these studies, we
also confirmed induction of both IL-3 and GM-CSF mRNA expression (Fig. 7C). EMSAs revealed that the 237-kb EGR-1 motif
bound in vitro to both of the constitutively expressed factors Sp1
and Sp3, and to the inducible factor EGR-1 (Fig. 7B). Note,
however, that although Sp1 and EGR-1 can both bind in EMSAs,
where the probe is in excess, these factors cannot bind simultaneously to the same site in vivo. We used ChIP assays in Jurkat
cells to confirm inducible binding of EGR-1 to the 237-kb enhancer, but not the Sp1/EGR-1–like element in the IL-3 promoter
(Fig. 7A). However, neither Sp1 nor Sp3 was found by ChIP to
bind to the 237-kb enhancer in Jurkat cells (data not shown). We
suggest that the lack of in vivo Sp1 binding prior to activation may
be due to lack of chromatin accessibility within the enhancer in
nonstimulated cells, whereas EGR-1 may outcompete Sp1 binding
after activation once the DHS has formed.
Independent regulation of the IL-3/GM-CSF locus
This study establishes that a 130-kb region of the IL-3/GM-CSF
locus includes all the DNA elements that are required for its
correct developmental and inducible regulation. It also establishes
that the IL-3/GM-CSF locus is controlled independently of the
downstream Th2 cytokine gene cluster encompassing the IL-4, IL5, and IL-13 genes, which are coregulated as a separate unit by the
Th2 LCR (9). This conclusion is further supported by chromatin
cross-linking (3C) assays that detected direct interactions within
the nucleus between the Th2 LCR and the IL-4, IL-5, and IL-13
genes, but not between the Th2 locus and the IL-3/GM-CSF locus
(10). Furthermore, our data provide further evidence suggesting
that the closely linked IL-3 and GM-CSF genes are regulated
independently of each other. This concept was first proposed on
the basis of the following: 1) the GM-CSF gene is expressed efficiently in vivo as an isolated 10-kb transgene (15); 2) the IL-3
insulator effectively blocks activation of the IL-3 promoter by the
GM-CSF enhancer (11); and 3) IL-3 and GM-CSF have overlapping, but also unique functions in hematopoietic development.
There is also the suggestion that coexpressed genes may actually
require independent enhancers, which is based on evidence that
the b-globin LCR can only activate one gene in this locus at any
one moment in time (33).
In this study, we also obtained a fortuitous deletion in line E50
of a conserved sequence 30 kb downstream of the GM-CSF gene,
which is homologous to the mouse GM-CSF +34-kb CNSa
enhancer (18). However, the activity of this truncated GM-CSF
transgene was not substantially different from the intact transgenes, suggesting that CNSa is not playing a major role in the
inducible activation of the GM-CSF gene in T blast cells.
Identification of elements controlling IL-3 gene expression
Our analyses revealed the existence of a highly complex 40-kb
region extending upstream from the IL-3 gene that encompasses at
least three enhancers and a total of nine additional DHSs that each
had inducible and/or tissue-specific properties that mirrored the
expression pattern of the IL-3 gene. Whereas it remains likely that
many of these upstream elements are required for the correct fine
tuning of IL-3 gene expression, the cluster of DHSs that colocalized with conserved sequences in the 233-kb to 40-kb region
was particularly prominent as a region closely linked to IL-3 gene
expression. This region is reminiscent of LCRs, which typically
include both enhancer and nonenhancer elements, such as the
b-globin LCR, which exists as a complex series of five DHSs
spread over at least 22 kb upstream of the b-globin gene cluster
(34). However, the IL-3 upstream regulatory region also includes
inducible tissue-specific DHSs associated with LI-LINE retrotransposons. These DHSs may also make a significant contribution
to the normal regulation of the IL-3 gene as there is already some
precedent for L1 LINE 59UTRs directing transcripts within the
human genome, and even contributing to tissue specificity (35).
This finding is also reminiscent of the observation that a repeat
element has been adopted as a normal component of an enhancer
in the Tal1 locus (36), and our previous studies identified aberrant
activation of repeat elements as a factor contributing to aberrant
gene expression in Hodgkin’s lymphoma (37).
Regulation of the 237-kb IL-3 enhancer
FIGURE 7. Transcription factor binding within the 237-kb IL-3 enhancer. (A–C) Analyses of Jurkat T cells cultured with and without stimulation for 4 h with 20 ng/ml PMA and 0.57 mM calcium ionophore
A23187. (A) EGR-1 ChIP assay of the 237-kb IL-3 enhancer performed as
described (28), with enrichment levels normalized against a negative
control within the VEZF1 gene body. (B) EMSA performed using a probe
encompassing the IL-3 237-kb EGR-1 site and Abs against Sp1, Sp3, and
EGR-1. (C) Semiquantitative real-time PCR analysis of mRNA expression.
The 237-kb enhancer stands out as the dominant element controlling the IL-3 gene, considering the following: 1) the 237-kb
enhancer is 10–to 20 times more powerful than either the 214- or
24.5-kb enhancers; 2) the combination of the 214- and 24.5-kb
enhancers was insufficient to support IL-3 gene promoter activity
in vivo; 3) the 214-kb DHS has never been detected in nonleukemic cells; and 4) the IL-3 240-, 234-, and 24.1-kb DHSs
lack enhancer activity (12). Like the other previously defined
enhancers in the IL-3/GM-CSF locus, the 237-kb enhancer contains ideal consensus binding sites for the Ca2+-inducible factor
NFAT and the MAPK-inducible factor AP-1. The 237-kb NFAT
and AP-1 sites are, therefore, likely to represent significant targets
in which the Ca2+ and MAPK TCR signaling pathways converge
to activate the IL-3 locus. However, unlike the GM-CSF enhancer
and IL-2 promoter, these NFAT and AP-1 motifs do not exist as
classical composite NFAT/AP-1 binding sites in which these
factors bind cooperatively (1, 38).
The exquisite tissue specificity of the 237-kb enhancer may be
dictated by a highly conserved 55-bp core segment encompassing
GATA, ETS-1, and NFAT motifs. In addition, a highly conserved
EGR-1 site exists just downstream of this region. The two ETS-1
motifs and the EGR-1 binding site all contributed significantly to
Downloaded from http://www.jimmunol.org/ by guest on April 3, 2017
Discussion
9
10
DEVELOPMENTAL REGULATION OF THE IL-3/GM-CSF LOCUS
gene expression and expansion of HSCs in the early embryo (4).
Hence, it is significant that the constitutive IL-3 240-, 234-, and
210-kb DHSs also each encompass RUNX1 motifs. Once the
open chromatin regions have formed at each of these DHSs, the
RUNX elements may be able to maintain stable RUNX1 binding
and thereby maintain the locus in a primed state in both memory
T cells and myeloid cells that have gained the capacity to express
RUNX1. Most of these DHSs also encompass motifs for other
inducible factors that may be responsible for the initial creation
of these DHSs.
The finding that GM-CSF expression was also strongly downregulated during monocyte/macrophage differentiation was somewhat unexpected. This does not appear to be a cell culture artifact,
as we obtained similar findings in our studies of freshly isolated
spleen CD11b+ monocytic cells stimulated with either PMA/I or
LPS (25). Hence, the concept that macrophage-lineage cells produce significant amounts of GM-CSF may be more representative
of macrophage progenitor cells that express GATA-2, and primitive
cell lines (25), rather than mature monocytes and macrophages
that no longer express GATA-2.
The IL-3/GM-CSF locus undergoes a program of
developmental regulation
Acknowledgments
The specific combination of developmentally regulated transcription factor motifs found in the 237-kb enhancer, together with the
many RUNX motifs found elsewhere in the locus (1), represents
an ideal combination adapted to support gene expression in progenitor cells, mast cells, and T cells (25, 39), but not in other cell
types. GATA, RUNX, and ETS family factors belong to a tight
cluster of factors directing combinatorial control in hematopoietic
progenitor cells (39). However, because the 237-kb DHS is
strictly inducible, it is likely that the binding of the constitutively
expressed factors to the enhancer is dependent on the inducible
factors NFAT, AP-1, and EGR-1. This mechanism resembles
the GM-CSF enhancer in which binding of the tissue-specific
factor RUNX-1 is dependent on accessibility to chromatin created
by NFAT-dependent chromatin remodeling (25).
Cells with the capacity to express IL-3 and/or GM-CSF arise
from two different types of progenitor cell, as follows: 1) lymphoid
progenitors that can produce either T cells that express both genes
or B cells that express neither gene, and 2) myeloid progenitors that
start out with some capacity to express both genes, and can produce
mast cells that upregulate IL-3 and GM-CSF expression, and
monocytes/macrophages that downregulate both genes. Within
the lymphoid lineage, the 24.1- and 21.5-kb DHSs were constitutively present in T blast cells and memory T cells, but absent in both
thymocytes, naive T cells, and B cells (24). We also observed some
specific differences between the lymphoid and myeloid pathways, with the IL-3 240.3- and 21.5-kb DHSs being T cell
specific, and the IL-3 216.4- and 210-kb DHSs being myeloid
cell specific. To a very large extent, the inducible expression levels
seen in the different lineages reflect whether these cells had acquired
these various DHSs.
We observed that some specific DHSs in the IL-3 locus, such
as the IL-3 24.5- and 24.1-kb DHSs, begin to be acquired early
during the differentiation process in MP cells, and become stronger
in IL-3–expressing mast cells, but are extinguished in an alternate
differentiation pathway leading to macrophages. We previously
proposed that the IL-3 24.5-, 24.1-, and 21.5-kb DHSs, which
are stably maintained in T blast cells, also play a role in maintaining the locus in a partially active state in memory T cells,
priming the locus for activation by inducible enhancers (24). These
stably maintained DHSs, and the IL-3 promoter (40), each encompass motifs for RUNX1, a factor known to be required for IL-3
We thank D. Roberts and D. Brooke for making transgenic mice and
H. Tagoh for the CD19 gene probe. We thank Peter Laslo for comments
on the manuscript.
Disclosures
The authors have no financial conflicts of interest.
References
1. Cockerill, P. N. 2004. Mechanisms of transcriptional regulation of the human IL3/GM-CSF locus by inducible tissue-specific promoters and enhancers. Crit. Rev.
Immunol. 24: 385–408.
2. Alexander, W. S. 1998. Cytokines in hematopoiesis. Int. Rev. Immunol. 16: 651–
682.
3. Nicola, N. A. 1989. Hemopoietic cell growth factors and their receptors. Annu.
Rev. Biochem. 58: 45–77.
4. Robin, C., K. Ottersbach, C. Durand, M. Peeters, L. Vanes, V. Tybulewicz, and
E. Dzierzak. 2006. An unexpected role for IL-3 in the embryonic development of
hematopoietic stem cells. Dev. Cell 11: 171–180.
5. He, W. Y., Y. Lan, H. Y. Yao, Z. Li, X. Y. Wang, X. S. Li, J. Y. Zhang, Y. Zhang,
B. Liu, and N. Mao. 2010. Interleukin-3 promotes hemangioblast development in
mouse aorta-gonad-mesonephros region. Haematologica 95: 875–883.
6. Gasson, J. C. 1991. Molecular physiology of granulocyte-macrophage colonystimulating factor. Blood 77: 1131–1145.
7. Basu, S., A. R. Dunn, M. W. Marino, H. Savoia, G. Hodgson, G. J. Lieschke, and
J. Cebon. 1997. Increased tolerance to endotoxin by granulocyte-macrophage
colony-stimulating factor-deficient mice. J. Immunol. 159: 1412–1417.
8. Frazer, K. A., Y. Ueda, Y. Zhu, V. R. Gifford, M. R. Garofalo, N. Mohandas,
C. H. Martin, M. J. Palazzolo, J. F. Cheng, and E. M. Rubin. 1997. Computational and biological analysis of 680 kb of DNA sequence from the human 5q31
cytokine gene cluster region. Genome Res. 7: 495–512.
9. Lee, G. R., C. G. Spilianakis, and R. A. Flavell. 2005. Hypersensitive site 7 of
the TH2 locus control region is essential for expressing TH2 cytokine genes and
for long-range intrachromosomal interactions. Nat. Immunol. 6: 42–48.
10. Spilianakis, C. G., M. D. Lalioti, T. Town, G. R. Lee, and R. A. Flavell. 2005.
Interchromosomal associations between alternatively expressed loci. Nature 435:
637–645.
11. Bowers, S. R., F. Mirabella, F. J. Calero-Nieto, S. Valeaux, S. Hadjur,
E. W. Baxter, M. Merkenschlager, and P. N. Cockerill. 2009. A conserved insulator that recruits CTCF and cohesin exists between the closely related but
divergently regulated interleukin-3 and granulocyte-macrophage colonystimulating factor genes. Mol. Cell. Biol. 29: 1682–1693.
12. Hawwari, A., J. Burrows, M. A. Vadas, and P. N. Cockerill. 2002. The human IL3 locus is regulated cooperatively by two NFAT-dependent enhancers that have
distinct tissue-specific activities. J. Immunol. 169: 1876–1886.
13. Bert, A. G., J. Burrows, A. Hawwari, M. A. Vadas, and P. N. Cockerill. 2000.
Reconstitution of T cell-specific transcription directed by composite NFAT/Oct
elements. J. Immunol. 165: 5646–5655.
14. Duncliffe, K. N., A. G. Bert, M. A. Vadas, and P. N. Cockerill. 1997. A T cellspecific enhancer in the interleukin-3 locus is activated cooperatively by Oct and
NFAT elements within a DNase I-hypersensitive site. Immunity 6: 175–185.
15. Cockerill, P. N., A. G. Bert, D. Roberts, and M. A. Vadas. 1999. The human GMCSF gene is autonomously regulated in vivo by an inducible tissue-specific
enhancer. Proc. Natl. Acad. Sci. USA 96: 15097–15102.
Downloaded from http://www.jimmunol.org/ by guest on April 3, 2017
enhancer function in Jurkat T cells. The PU.1 and GATA motifs
were not required for function in Jurkat T cells, which lack these
factors. However, it is highly significant that essentially all the
major regulatory elements in the IL-3/GM-CSF locus encompass
GATA motifs (1, 25). These GATA motifs are more likely to be
important for promoting inducible expression in progenitor cells
and mast cells than in T cells, as is established for GATA motifs in
the GM-CSF enhancer and promoter (25). These motifs may also
be critical for IL-3 and GM-CSF expression in the emerging hemopoietic system in the embryo (4). Furthermore, because GATA2 expression is typically maintained in leukemic cells arising from
MP cells, these GATA motifs are also likely to contribute to IL-3
and GM-CSF expression in myeloid leukemia. Future studies of
this locus will now be better equipped to identify the elements that
account for the activation of IL-3 expression in CML in response
to constitutive tyrosine kinase signaling from the BCR-ABL fusion protein (21). It is also possible that some DHSs in the locus
will be disease specific, as the IL-3 214-kb enhancer DHS has
only ever been detected in two cell lines derived from T cell
leukemia (12).
The Journal of Immunology
29. Anderson, M. K., G. Hernandez-Hoyos, R. A. Diamond, and E. V. Rothenberg.
1999. Precise developmental regulation of Ets family transcription factors during
specification and commitment to the T cell lineage. Development 126: 3131–
3148.
30. Liu, C., A. Calogero, G. Ragona, E. Adamson, and D. Mercola. 1996. EGR-1,
the reluctant suppression factor: EGR-1 is known to function in the regulation of
growth, differentiation, and also has significant tumor suppressor activity and
a mechanism involving the induction of TGF-beta1 is postulated to account for
this suppressor activity. Crit. Rev. Oncog. 7: 101–125.
31. Skerka, C., E. L. Decker, and P. F. Zipfel. 1995. A regulatory element in the
human interleukin 2 gene promoter is a binding site for the zinc finger proteins
Sp1 and EGR-1. J. Biol. Chem. 270: 22500–22506.
32. Khachigian, L. M., and T. Collins. 1997. Inducible expression of Egr-1dependent genes: a paradigm of transcriptional activation in vascular endothelium. Circ. Res. 81: 457–461.
33. Wijgerde, M., F. Grosveld, and P. Fraser. 1995. Transcription complex stability
and chromatin dynamics in vivo. Nature 377: 209–213.
34. Dillon, N., and F. Grosveld. 1993. Transcriptional regulation of multigene loci:
multilevel control. Trends Genet. 9: 134–137.
35. Mätlik, K., K. Redik, and M. Speek. 2006. L1 antisense promoter drives
tissue-specific transcription of human genes. J. Biomed. Biotechnol. 2006:
71753.
36. Smith, A. M., M. J. Sanchez, G. A. Follows, S. Kinston, I. J. Donaldson,
A. R. Green, and B. Göttgens. 2008. A novel mode of enhancer evolution: the
Tal1 stem cell enhancer recruited a MIR element to specifically boost its activity.
Genome Res. 18: 1422–1432.
37. Lamprecht, B., K. Walter, S. Kreher, R. Kumar, M. Hummel, D. Lenze,
K. Kochert, M. A. Bouhlel, J. Richter, E. Soler, et al. 2010. Derepression of an
endogenous long terminal repeat activates the CSF1R proto-oncogene in human
lymphoma. Nat. Med. 16: 571-579, 1p following 579.
38. Cockerill, P. N., A. G. Bert, F. Jenkins, G. R. Ryan, M. F. Shannon, and
M. A. Vadas. 1995. Human GM-CSF enhancer function is associated with cooperative interactions between AP-1 and NFATp/c. Mol. Cell. Biol. 15: 2071–
2079.
39. Wilson, N. K., S. D. Foster, X. Wang, K. Knezevic, J. Schütte, P. Kaimakis,
P. M. Chilarska, S. Kinston, W. H. Ouwehand, E. Dzierzak, et al. 2010.
Combinatorial transcriptional control in blood stem/progenitor cells: genomewide analysis of ten major transcriptional regulators. Cell Stem Cell 7: 532–
544.
40. Taylor, D. S., J. P. Laubach, D. G. Nathan, and B. Mathey-Prevot. 1996. Cooperation between core binding factor and adjacent promoter elements contributes to the tissue-specific expression of interleukin-3. J. Biol. Chem. 271:
14020–14027.
Downloaded from http://www.jimmunol.org/ by guest on April 3, 2017
16. Cockerill, P. N., M. F. Shannon, A. G. Bert, G. R. Ryan, and M. A. Vadas. 1993.
The granulocyte-macrophage colony-stimulating factor/interleukin 3 locus is
regulated by an inducible cyclosporin A-sensitive enhancer. Proc. Natl. Acad.
Sci. USA 90: 2466–2470.
17. Osborne, C. S., M. A. Vadas, and P. N. Cockerill. 1995. Transcriptional regulation of mouse granulocyte-macrophage colony-stimulating factor/IL-3 locus. J.
Immunol. 155: 226–235.
18. Wurster, A. L., P. Precht, and M. J. Pazin. 2011. NF-kB and BRG1 bind a distal
regulatory element in the IL-3/GM-CSF locus. Mol. Immunol. 48: 2178–2188.
19. Johnson, B. V., A. G. Bert, G. R. Ryan, A. Condina, and P. N. Cockerill. 2004.
GM-CSF enhancer activation requires cooperation between NFAT and AP-1
elements and is associated with extensive nucleosome reorganization. Mol.
Cell. Biol. 24: 7914–7930.
20. Russell, N. H. 1992. Autocrine growth factors and leukaemic haemopoiesis.
Blood Rev. 6: 149–156.
21. Jiang, X., A. Lopez, T. Holyoake, A. Eaves, and C. Eaves. 1999. Autocrine
production and action of IL-3 and granulocyte colony-stimulating factor in
chronic myeloid leukemia. Proc. Natl. Acad. Sci. USA 96: 12804–12809.
22. Jiang, X., E. Ng, C. Yip, W. Eisterer, Y. Chalandon, M. Stuible, A. Eaves, and
C. J. Eaves. 2002. Primitive interleukin 3 null hematopoietic cells transduced
with BCR-ABL show accelerated loss after culture of factor-independence
in vitro and leukemogenic activity in vivo. Blood 100: 3731–3740.
23. Holyoake, T. L., X. Jiang, H. G. Jorgensen, S. Graham, M. J. Alcorn, C. Laird,
A. C. Eaves, and C. J. Eaves. 2001. Primitive quiescent leukemic cells from
patients with chronic myeloid leukemia spontaneously initiate factor-independent growth in vitro in association with up-regulation of expression of interleukin-3. Blood 97: 720–728.
24. Mirabella, F., E. W. Baxter, M. Boissinot, S. R. James, and P. N. Cockerill. 2010.
The human IL-3/granulocyte-macrophage colony-stimulating factor locus is
epigenetically silent in immature thymocytes and is progressively activated
during T cell development. J. Immunol. 184: 3043–3054.
25. Bert, A. G., B. V. Johnson, E. W. Baxter, and P. N. Cockerill. 2007. A modular
enhancer is differentially regulated by GATA and NFAT elements that direct
different tissue-specific patterns of nucleosome positioning and inducible chromatin remodeling. Mol. Cell. Biol. 27: 2870–2885.
26. Butterfield, J. H., and D. A. Weiler. 1989. In vitro sensitivity of immature human mast
cells to chemotherapeutic agents. Int. Arch. Allergy Appl. Immunol. 89: 297–300.
27. Bert, A. G., J. Burrows, C. S. Osborne, and P. N. Cockerill. 2000. Generation of
an improved luciferase reporter gene plasmid that employs a novel mechanism
for high-copy replication. Plasmid 44: 173–182.
28. Dickson, J., H. Gowher, R. Strogantsev, M. Gaszner, A. Hair, G. Felsenfeld, and
A. G. West. 2010. VEZF1 elements mediate protection from DNA methylation.
PLoS Genet. 6: e1000804.
11
! " $#
! "
Region probed
Enzyme and location
Enzyme sites and PCR primers used to create probes
Distal 5' IL-3
BamHI -37.7 kb from the IL-3
PCR fragment using primers
-40 kb DHS
start, probing upstream
5' CTGGAATGGAAGGTATGGCTC
and 5' CTGCTGCTGAGATGTCCCTTC
Distal 5' IL-3
EcoRI -40.7 kb from the IL-3
PCR fragment using primers
-37 kb Enhancer
start, probing downstream
5' GAGGTGACTTGGCCACAAACA
and 5' TGGAAATAGGTCCCCTGGTAG
Distal 5' IL-3
BamHI -36.6 kb from the IL-3
PCR fragment using primers
-34 kb DHS
start, probing downstream
5' CTCCCCTTCCATGACTTTTACC
and 5' AGCTAGTGCCCATGTGGTTC
Distal 5' IL-3
KpnI -29.0 kb from the IL-3
Restriction enzyme fragment
-23 kb DHS
start, probing downstream
720 bp KpnI (-29.0 kb) - SfiI (-28.3 kb)
Distal 5' IL-3
SpeI -8.8 kb from the IL-3
PCR fragment using primers
-10 kb DHS
start, probing upstream
5' CCTGGAGGAAGATGTGTGTG
and 5' ACTGCCCTGGAAAAGACAAG
Supplemental figure 1
Nil
PMA/I
A
CD4 Ab
IgG control
27%
E
Prom.
-4.5 kb
-4.1 kb
E
-1.5 kb
-14 kb
B
CD4
IL-3 gene 5’ regulatory elements
E
E P
E
E P
- 14 kb
- 4.5 kb
Ins
IL-3
EP
- 3 kb
GM-CSF
Analysis of the proximal human IL-3 enhancers and promoter in transgenic mice
The human IL-3 -14 kb enhancer was linked to a proximal 5.2 kb segment spanning the human
IL-3 -4.5 kb enhancer and the promoter, coupled to a human CD4 reporter gene, and used to
generate 8 independent lines of transgenic mice. The proximal 5.2 kb region of the IL-3 locus
also includes constitutive tissue-specific DHSs located at -4.1 and -1.5 kb. To establish a model
system to measure transgene activities we first generated cultures of T blast cells by stimulating
splenic cells with concanavalin A for two days, followed by at least 2 days culture with IL-2.
These cells were then re-stimulated for 4 h with 20 ng/ml PMA and 2 mM calcium ionophore
(PMA/I), and stained with either IgG control (grey line) or CD4 antibodies (black line). (A)
Representative example of 3 transgenic lines showing low level variegated human CD4
transgene expression. (B) Representative example of 5 transgenic lines showing no CD4
expression. The map underneath depicts the DNA segments used to construct the transgene,
depicting the enhancers (E), the IL-3 promoter (P), and the DHSs (vertical arrows).
Supplemental Figure 2
Cyclosporin A sensitivity of DHSs in the IL-3/GM-CSF locus
B
Nil
PMA/I
PMA/I/CsA
GM-CSF Enhancer
160
Prom
+4.2
+4.5
GME
+4.9
80
40
0
pXPG
+4.5 kb
IL-3
DHS promoter
IL-3 -34 kb
marker
marker
6.6
9.4
4.4
6.6
DHS
PMA/I
IL-3 -40 kb
Nil
IL-3 -37 kb
Nil
PMA/I
PMA/I/CsA
EcoRI probe
Nil
PMA/I
PMA/I/CsA
C
120
PMA/I/CsA
+2.9
BamHI probe
IL-3 +4.5 kb ncRNA Promoter activity
Fold increase in Luciferase activity
Nil
PMA/I
PMA/I/CsA
A IL-3 Insulator
marker
23
- 23.3
9.4
6.6
DHS
- 37.5
4.4
2.3
EcoRI -37 kb probe
DHS
-40.9
-40.6
-40.3
4.4
EcoRI
EcoRI
2.3
-33.7
-34.0
2.3
2.0
-35.0
BamHI -40 probe
BamHI -34 probe
Cyclosporin A (CsA) sensitivity and function of inducible DHSs in the IL-3/GM-CSF locus.
(A and C) Mapping of DHSs in line C42 transgenic T blast cells, before and after stimulation for 4 h with
PMA/I, and in the presence or absence of 0.1 PM CsA, using the probes defined in supplementary figure 2.
In panel C, the positions of HindIII-lambda DNA size markers are shown on the right hand side, and the
positions of DHSs relative to the IL-3 transcription start site are shown on the left.
(B) Luciferase reporter gene transfection assay of a non-coding RNA promoter within the inducible CsAresistant IL-3 +4.5 kb DHS. This DHS is the potential source of non-coding transcripts emanating from this
region, which are transcribed in the direction of the GM-CSF gene(4). DNA spanning the DHS was inserted
in pXPG in the same orientation as in the gene and assayed in parallel with the IL-3 promoter plasmid pIL3H
and the empty vector. Transfected cells were assayed after stimulation with PMA/I, and normalized values
were expressed relative to values for pXPG. Assays were performed in triplicate on each of two independent
clones of each construct. Error bars indicate S.D.
Supplemental figure 3
Conservation of transcription factor motifs within the -37 kb IL-3 enhancer
enhancer core
NFAT
AP-1
305
NFAT
AP-1
EGR-1
ETS-1 #2
NFAT
123
GATA
ETS-1 #1
Vertebrate conversation
PU.1
A
3’ enhancer region
B
Enhancer Core = PU.1 + GATA + Ets + Egr + central NFAT + AP-1 motifs
Hu
Ch
Rh
Mo
Gu
Ra
Do
Ca
Ho
PU.1
GATA
ETS-1 #1
NFAT
TGGGGAAGGGACATCTCAGCAGCAGAGGT--GGGTGTGGGATCC--AGATAACACAGGATGAGAGGTGGGAGGAAAGA-AAGTTCAGGC
TGGGGAAGGGACATCTCAGCAGCAGAGGT--GGGTGTGGGATCC--AGATAACACAGGATGAGAGGTGGGAGGAAAGA-AAGTTCAGGC
TGGGGAAGGGACGTCTCAGCAGCAGAGGT--GGGTGTGGGATCC--CAATAAGACAGAATGAGAGGTGGGAGGAAAGA-AAGTTCAGGC
CCAGGAAGGGACCT------GGCAGAGGAGTGGGTGTGAGATCC--TGATAA--CAGAAAGACAAGTGGGAGGGAAGAAAAGTTCAGGC
---------------------GCGGGGGTGCGGGTGTGGGGCCCGGTGATAG--CAGGCAAATGGGTGGG-GGCGGGAAAAGTCCAGGC
---------------------GAGGGGAA---------AGGACC---AACAGCATAGGATGAGACAGGGGAGGAAGATAAAGTCCAGGC
TGGGG-AGGGTTTCATCA---GCAGAAAT--GCATGTAGAATCC--AGATAACACAGAATGAGCAGTGGGAGGAAAGAAAAGTCCAGGC
TGGGGAAGAGCCCCATCA---GCAGATGT--GCATGTAGAATCC--AGATAACACAGGATGAGCAGTGGGAGGAAGGAAAAGTCCAGGC
TGGGGAAGGG-CCCATCA---GCAGAAGT--GGGTGTGGGATCT--AGATAACACAGGATGAGCAGTGGGAGGAAAGAAAAGTCCAGGC
Hu
Ch
Rh
Mo
Gu
Ra
Do
Ca
Ho
ETS-1 #2
EGR-1
NFAT
AP-1
AAAGGAACATCTTGCAGGTCTTTCTCAAACAACCTCCCCCACAAAATCATATTGATCCTGATTACAGCGTCTTTCCCATGAGTCAGTGTC
AAAGGAACATCTTGCAGGTCTTTCTCAAACAACCTCCCCCACAAAATCATATTGATCCTGATTACAGCGTCTTTCCCATGAGTCAGTGTC
AAAGGAACATCTTGCAGGTCTTTCTCAAACAACCTCCCCCGCAAAATCATATTGATCCTGATTACAGCGTCTTTCCCATGAGTCAGTGTC
TAAGGAACA---------TCTTTG------------CCCCATACAGCTGCCCTGATCCCGATCACCGTGTCCTTCCCATGAGTCACTGTC
CAAGGAACAGCTTGCAGGTCTTTGTCTAACATCCTCCCCCGCAGAATCACGCTGATCCTGACTGCAGTGTCTTTCCCCTGAGTCAGGGCC
TGAAGAAGAGCTTCCAGGTCCTCA----GCATCCT-CCCCACAGAACCACACCAGTCCTGATCACCAGGCC--TCCCTCGAGTCAGTGCC
AAAGGAACATCTTAAAAGTCTTACTCTACTATCCTCCCCCACAGAATCATACTGGTCCTGATTACAGCTTCTTTCCCATGAGTCAGTGTC
AGAGGAACATATTAAAAGTCTTTCTCTAATATCCTCCCCCACAGAATCATATTGATCCTGATTACAGCATCTTTCCCATGAGTCAATGTC
AAAGGAACATCTTATAGGTCGTTCTCTAATATCCTCCCCCACAAAATCGTGTTGATCCTGATTACAGGGTCTTCCCCATGAGTCAGTATC
C
Hu
Ch
Rh
Mo
Gu
Ra
Do
Ca
Ho
3’ region of Enhancer = 3’ AP-1 + NFAT motifs
AP-1
NFAT
TGGCTTGACTCAGTCCTTCCTAACCTAGCCTTTTTGATTGTTTTTTTTTCTGAGCCTCTGCTGACTTTTTGGAAATTAGCCTTCAGA
TGGCTTGACTCAGTCCTTCCTAACCTAGCCTTTTTGATTG-TATTTTTTCTGAGCCTCTGCTGACTTTTTGGAAATTAGCCTTCAGA
TGGCTTGACTCAGTCCTTCCTAACCTGGCCTTTTCAGTTG-TTGTTTTTCTGAGCCTCTGCTGACTTTTTGGAAATTGACCTTCAGA
TGGCTCAACTTAGCCCCTTCTAACATGGCCTCTTCTTCTA-CTTTCTCT======================================
TGGCTTGGCTCAGTCCTTCCTCACCTGGCCTTTGCGTGCA-CCCTCTTTCTGAGCCTCAGGTGCCTTCTGGGAAGTTGGGTTTCACA
================================================================================TTTCAGA
TGCCTTGACTCAATCCTCCCT-ATCTGGCTTTTTTTTTTTTTTTTTTTTTTAAACCTCTGCTGCCTTCTTGGAAATTGGGTTTCAGA
=======================================================================================
TTGCTTGACTCAATCCTTCCTAACCTGGCTTTTTTTCTT-------------AACCTCTGCTGCTTCTTTGGAAATTGGGTTTCAGA
(A) UCSC genome browser view of conserved regions within the core of the human IL-3 -37 kb enhancer
(Vertebrate Multiz Alignment & PhastCons Conservation, http://genome.cse.ucsc.edu).
A map of predicted transcription factor binding sites is aligned underneath. (B and C) Alignment of
representative mammalian genome sequences of the central core (B) and 3’ region (C) of the enhancer. Motifs
are highlighted in yellow if the consensus sequence predicted to be required for DNA-binding is conserved.
The DNA sequences are from the human (Hu), chimp (Ch), rhesus (Rh), mouse (Mo), guinea pig (Gu), rabbit
(Ra), dog (Do), cat (Ca) and horse (Ho) reference genomes. Gaps in the alignment are depicted by dashes.