Priority Report
Triple Gene-Deleted Oncolytic Herpes Simplex Virus Vector
Double-Armed with Interleukin 18 and Soluble
B7-1 Constructed by Bacterial Artificial
Chromosome–Mediated System
1,2
1,3
1
1
1,3,4
Hiroshi Fukuhara, Yasushi Ino, Toshihiko Kuroda, Robert L. Martuza, and Tomoki Todo
1
Molecular Neurosurgery Laboratory, Massachusetts General Hospital, Harvard Medical School, Charlestown, Massachusetts and
Departments of 2Urology, 3Neuro-oncology and Molecular Therapeutics, and 4Neurosurgery, The University of Tokyo, Tokyo, Japan
Abstract
Conditionally replicating herpes simplex virus type 1 (HSV-1)
vectors are promising therapeutic agents for cancer. Certain
antitumor functions may be added to oncolytic activities of
recombinant HSV-1 vectors by inserting transgenes into the
viral genome. Because conventional homologous recombination techniques had required time-consuming processes to
create ‘‘armed’’ oncolytic HSV-1 vectors, we established an
innovative construction system using bacterial artificial
chromosome and two recombinase systems (Cre/loxP and
FLPe/FRT). Using G47#, a safe and efficacious oncolytic HSV1 with triple gene mutations, as the backbone, this system
allowed a rapid generation of multiple vectors with desired
transgenes inserted in the deleted ICP6 locus. Four oncolytic
HSV-1 vectors, expressing murine interleukin 18 (mIL-18),
soluble murine B7-1 [B7-1-immunoglobulin (B7-1-Ig)], both,
or none, were created simultaneously within 3 months.
In vitro, all newly created recombinant vectors exhibited virus
yields and cytopathic effects similar to the parental G47#.
In two immunocompetent mouse tumor models, TRAMP-C2
prostate cancer and Neuro2a neuroblastoma, the vector
expressing both mIL-18 and B7-1-Ig showed a significant
enhancement of antitumor efficacy via T-cell–mediated
immune responses. The results show that ‘‘arming’’ with
multiple transgenes can improve the efficacy of oncolytic
HSV-1 vectors. The use of our system may facilitate the
development and testing of various armed oncolytic HSV-1
vectors. (Cancer Res 2005; 65(23): 10663-8)
Introduction
The key to developing useful oncolytic herpes simplex virus
type 1 (HSV-1) vectors is to acquire high antitumor efficacy without
compromising safety, obtaining as wide therapeutic window as
possible. G207 is one of the first oncolytic HSV-1 vectors used in
clinical trials (1) and has deletions in both copies of the c34.5 gene
and a lacZ insertion inactivating the ICP6 gene (2). The double
mutations permit viral replication within cancer cells that can
complement these mutations but not in normal cells. G207,
however, may be considerably attenuated not only for the
pathogenicity but also for the tumor cell killing capability compared
Note: Supplementary data for this article are available at Cancer Research Online
(http://cancerres.aacrjournals.org/).
Requests for reprints: Tomoki Todo, Department of Neurosurgery, The University
of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8655, Japan. Phone: 81-3-5800-8853; Fax:
81-3-5800-8655; E-mail: [email protected].
I2005 American Association for Cancer Research.
doi:10.1158/0008-5472.CAN-05-2534
www.aacrjournals.org
with wild-type HSV-1. G47D was constructed by creating a further
deletion within the a47 gene and the overlapping US11 promoter of
the G207 genome (3). This additional deletion conferred enhanced
viral replication in tumor cells and partial restoration of MHC class I
expression in infected human cells, resulting in drastic improvement of antitumor efficacy while preserving the safety features.
One of the advantages of HSV-1 vectors is the capacity to
incorporate large and/or multiple transgenes within the viral
genome. Aside from the extent of replication capability within the
tumor, the efficacy of an oncolytic HSV-1 depends on the extent of
antitumor immunity induction (4, 5). Therefore, the genes of
immunomodulatory molecules would be reasonable candidates for
‘‘arming’’ oncolytic HSV-1 vectors. Conventionally, recombinant
HSV-1 vectors have been constructed using homologous recombination techniques, which required time-consuming processes of
selection and structure confirmation. Bacterial artificial chromosome (BAC) enables manipulation of large eukaryotic sequences
such as oversized HSV-1 amplicons and HSV-1 genomes in plasmids
(6–11). In this article, we used BAC and two recombinase systems
(Cre/loxP and FLPe/FRT) to develop a method that allowed a rapid,
reliable, and simultaneous construction of multiple ‘‘armed’’
oncolytic HSV-1 vectors using G47D as the backbone.
Materials and Methods
Cells and viruses. Vero, Neuro2a, Pr14-2, and TRAMP-C2 cells were
cultured as described (3). G47D was grown in Vero cells and virus titers
were determined as described (2, 3).
Generation of BAC-G47# plasmid. BAC-G47D was created by a
homologous recombination of G47D DNA and pBAC-ICP6EF, a plasmid
that contains the insertion sequences of the ICP6 coding region.5
Transfections were done on Vero cells by using 0.9 Ag of DNA composed
of a 1:1:1 mixture of G47D DNA purified by Na/I method, pBAC-ICP6EF
(undigested), and pBAC-ICP6EF linearized with Asc I digestion, with
Lipofectamine (Invitrogen, Carlsbad, CA). At a 30% to 50% cytopathic
effect, recombinant viruses forming green fluorescent protein (GFP)–
positive plaques were selected and further passaged in Vero cells
(Supplementary Fig. S1). After three rounds of GFP-positive and lacZnegative selection, circular virus DNA from infected Vero cells was isolated
by the Hirt method (12, 13) and electroporated into E.coli DH10B
(Invitrogen). Antibiotic-resistant colonies were isolated, BAC-G47D plasmid
DNA was purified, and the structure was confirmed by endonuclease
digestions (Supplementary Fig. S2).
Construction of shuttle vectors. The shuttle vector pVec9 was
constructed to contain a 45-bp FRT adaptor (5V-GATCCGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCCTCGAG-3V), a 50-bp loxP adaptor (5V-AGCTTATAACTTCGTATAATGTATGCTATACGAAGTTATCCATGGCTGCA-3V) ,
10663
5
T. Kuroda, manuscript in preparation.
Cancer Res 2005; 65: (23). December 1, 2005
Downloaded from cancerres.aacrjournals.org on June 18, 2017. © 2005 American Association for Cancer
Research.
Cancer Research
the lacZ gene from pcDNA6E/Uni-lacZ (Clontech, Mountain View, CA),
an expression cassette with the cytomegalovirus (CMV) promoter and bovine
growth hormone poly(A) from pVP22/myc-His2 (Invitrogen), a 3,989-bp fragment
of the E HindIII DNA, and a multiple cloning site sequence of AvrII, StuI,
and NotI (GATCCTTCCTAGGTTAGGCCTAAGCGGCCGCTTCCGCGG).
A 2.4-kb HindIII-NotI fragment containing the extracellular domain of
B7-1 and the Fc portion of human immunoglobulin G (IgG) gene from B7.1pIg (5) was inserted into the AvrII site of pVec9 to generate murine B7-1-Ig
(mB7-1-Ig)/Vec9. A 582-bp EcoRI fragment containing a mouse IFN-h signal
sequence and a mature interleukin 18 (IL-18) sequence from pCEXV3/
hybrid IL-18 (provided by Dr. Isao Hara, Kobe University, Kobe, Japan;
ref. 14) was inserted into the StuI site of pVec9 to generate mIL-18/Vec9.
A 3.3-kb fragment containing the hybrid IL-18 gene inserted into the
polylinker region of pIRES (Clontech) and the B7-1-Ig gene was inserted
into the AvrII site of pVec9 to generate IL18-B7/Vec9.
Reconstitution of BAC-G47# virus. Mutagenesis of the BAC-G47D
plasmid was done by a two-step replacement procedure. Mixture of BACG47D plasmid (1.5 Ag) and mB7-1-Ig/Vec9, mIL-18/Vec9, IL18-B7/Vec9,
or empty Vec9 (150 ng each) was incubated with Cre recombinase (NEB,
Ipswich, MA) at 37jC for 30 minutes in 10 AL of solution and was
electroporated into E.coli DH10B. To select those that contained the mutant
BAC plasmid, the bacteria were streaked onto LB plates containing Cm
(15 Ag/mL) and Kan (10 Ag/mL) and incubated at 37jC overnight. DNA
structures of the recombinant BAC-G47D/Vec9 plasmids were confirmed by
gel analyses following endonuclease digestions (Supplementary Fig. S3).
Transfections were done on Vero cells by using 2 Ag of BAC-G47D/
Vec9 DNA and 0.5 Ag of pCAGGSFlpeIRES with 15 AL of Lipofectamine.
Transfected cells were incubated in DMEM/10% FCS at 37jC overnight,
then medium was replaced with DMEM/1% heat-inactivated FCS the
next day, and incubation was continued for several days until plaques
appeared. The progeny viruses were selected for GFP negativity by an
inverted fluorescence microscope and for lacZ positivity by X-gal
staining. Three rounds of limiting dilution were done to pick out a
single clone. Recombinant vectors were harvested and the structure of
the viral DNA was confirmed by endonuclease digestions and Southern
blot analyses.
In vitro cytotoxicity studies and virus yield studies. In vitro
cytotoxicity studies were done as described (2, 3). The number of
surviving cells was counted daily with a Coulter Counter (Beckman
Coulter, Fullerton, CA) and expressed as a percentage of mock-infected
controls. For viral yield studies, Vero cells were seeded on six-well plates
at 3 105 per well. Wells were infected with four clones each of G47Dempty, G47D-mIL-18, G47D-mB7-1-Ig, and G47D-IL18/B7 in duplicate
wells at a multiplicity of infection (MOI) of 0.01 for 48 hours. G47D was
used as a control. After 48 hours of infection, the cells were scraped and
lysed by three cycles of freezing and thawing. The progeny virus was
titrated on Vero cells by a plaque assay as described (2, 3). Results
represent the average of duplicates.
Immunocytochemistry and ELISA. Cells were plated in 24-well plates
and incubated at 37jC for 24 hours. Cells in duplicate wells were
Figure 1. A, a schema describing the system for constructing armed oncolytic HSV-1 vectors with the G47D backbone. The desired transgene for arming is inserted
into the multiple cloning site of the shuttle vector (pVec9). The first step is to insert the entire sequence of the shuttle vector into the loxP site of BAC-G47D by
a Cre-mediated recombination, followed by an electroporation into E.coli DH10B. The second step is to cotransfect the cointegrate with a plasmid expressing FLPe
onto Vero cells to excise the BAC sequence flanked by the FRT sites. The objective armed oncolytic HSV-1 vectors appear as GFP-negative and lacZ-positive
virus plaques. Nonrecombined viruses do not appear due to the presence of the lambda stuffer sequence causing an oversize of the genome. B, structure of the
armed oncolytic HSV-1 vector (G47D-transgene) constructed using the system. Boxes on the top line, inverted repeat sequences flanking the long (UL ) and short
(US ) unique sequences of HSV-1 DNA. G47D-transgene contains 1.0-kb deletions in both copies of the c34.5 gene, a 312-bp deletion in the a47 gene, and an
894-bp deletion in the ICP6 gene. The lacZ gene and the CMV promoter-driven transgene, placed in opposite directions, are inserted in the deleted ICP6 locus.
Thick arrows, transcribed regions. N, Nco I; Bs, Bst EII; St, Stu I; X, Xho I; B, Bam HI; G, Bgl II; EN, Eco NI; Nr, Nru I. C, structure of the shuttle vector pVec9. The desired
transgene would be cloned in the multiple cloning site under the CMV promoter.
Cancer Res 2005; 65: (23). December 1, 2005
10664
www.aacrjournals.org
Downloaded from cancerres.aacrjournals.org on June 18, 2017. © 2005 American Association for Cancer
Research.
Oncolytic HSV Double-Armed with IL-18 and Soluble B7-1
infected with each virus and further incubated at 39.5jC for 18 hours.
Cells were fixed and immunostained for B7-1-Ig as described (5). The
IL-18 concentration of the media was measured using a mouse IL-18
ELISA kit (MBL, Nagoya, Japan). Results represent the average of
duplicates.
Animal studies. Six-week-old male C57BL/6 mice (Harlan Laboratories,
Indianapolis, IN), female A/J mice [National Cancer Institute (NCI),
Frederick, MD], and male/female athymic (BALB/c nu/nu) mice (NCI)
were used. All animal procedures were approved by the Institutional
Committee on Research Animal Care. S.c. tumor therapy was done as
described (4). Statistical analysis was done by unpaired t test.
Results and Discussion
The established system involves two steps (Fig. 1A). The first
step requires BAC-G47D, a plasmid of the G47D genome with the
BAC-containing sequence inserted into the deleted ICP6 locus
flanked by loxP and FRT sites. Also required is the shuttle vector
(pVec9), a replication-conditional plasmid that contains the lacZ
gene (without a promoter), loxP and FRT sites, a CMV promoter,
and a multiple cloning site where the desired transgene is cloned
(Fig. 1C). The first step of this system is to insert the entire
sequence of the shuttle vector into the loxP site of BAC-G47D by a
Cre-mediated recombination (15). It is designed so that, after the
recombination, lacZ is placed under the ICP6 promoter of G47D
and expressed. The transgene cassette is placed in the downstream
of lacZ, driven in the opposite direction (Fig. 1B). The second step
is to cotransfect the cointegrate with a plasmid expressing FLPe
onto Vero cells to excise the BAC sequence flanked by the FRT
sites (16, 17). The lambda stuffer sequence is included in the
shuttle vector so that, without a successful excision of the BAC
sequence, there is no virus formation due to an oversized genome
(Fig. 1C). The objective recombinant HSV-1 vector is obtained by
harvesting GFP-negative and lacZ-positive plaques and isolated
by limiting dilution. The entire procedure is typically done within
3 months.
To test and use the system, we used the murine IL-18 (mIL-18)
gene, the B7-1-Ig gene, both genes connected by the equine CMV
internal ribosomal entry site (IRES) sequence, or no transgene to
simultaneously create four different HSV-1 vectors, G47D-mIL-18,
G47D-B7-1-Ig, G47D-IL18/B7, and G47D-empty, respectively. The
resultant vectors should have triple gene deletions in the c34.5,
ICP6, and a47 genes, and the transgene driven by the CMV
promoter and the lacZ gene driven by the ICP6 promoter both
inserted in the deleted ICP6 locus. More than 99% of virus plaques
formed after the FLPe recombination were both GFP negative and
lacZ positive (Supplementary Fig. S4). Four clones of each HSV-1
vector were isolated by two-round limiting dilution and the
construct was confirmed by restriction endonuclease digestion and
Southern blot analyses (Fig. 2).
To check the replication capability of the armed oncolytic
HSV-1 vectors, we determined the yield of progeny virus 48 hours
after infection of Vero cells (3 105 per well) at an MOI of 0.01
(Table 1A). The virus yield was not significantly altered by the
presence or the size of inserted transgenes. The transgene
expression was tested by ELISA for murine IL-18 and by immunocytochemistry for murine B7-1 or human IgG (Fc). The medium
of Vero cells 48 hours after infection with each virus clone of
G47D-IL18/B7 or G47D-mIL-18 at an MOI of 1 contained an
average of 1,000 pg/mL of murine IL-18 (Table 1A). All virus clones
of G47D-IL18/B7 and G47D-B7-1-Ig expressed murine B7-1-Ig 48
hours after infection of Vero cells (Table 1A).
www.aacrjournals.org
Figure 2. Southern blotting analyses confirming the structures of the
BAC-G47D plasmid, the BAC-G47D/Vec9-empty plasmid, and the recombinant
G47D-empty virus. After Hin dIII, XhoI, or Kpn I digestion, DNA fragments were
separated by electrophoresis on 0.6% agarose gels in 1 Tris-borate-EDTA
buffer for 14 to 18 hours at 2.5 V/cm. One of DNA fragments of Eco RI-digested
pcDNA6E/Uni-lacZ corresponding to the lacZ sequence was used as the
hybridization probe.
Because no significant difference was observed among clones,
the first clone from each HSV-1 vector was used for further
analyses. The in vitro cytopathic activities of the four oncolytic
HSV-1 vectors were evaluated in mouse cell lines TRAMP-C2
(prostate cancer) and Neuro2a (neuroblastoma). Whereas mouse
cells are generally less susceptible to HSV-1 infection than Vero
cells, all four vectors killed tumor cells as rapid as the parental
G47D in both cell lines when infected at an MOI of 0.1 (Fig. 3A).
The transgene expression of G47D-IL18/B7 and G47D-mIL-18 was
detected in all mouse cell lines tested (Table 1B).
The in vivo efficacy of the armed oncolytic HSV-1 vectors was
screened in two immunocompetent mouse tumor models, TRAMPC2 tumors in syngeneic C57BL/6 mice and Neuro2a tumors in
syngeneic A/J mice (Fig. 3B and C). When established s.c. tumors
reached f6 mm in diameter, mock, G47D, G47D-empty, G47DmIL-18, G47D-B7-1-Ig, or G47D-IL18/B7 [5 106 plaque-forming
units (pfu) for TRAMP-C2 and 5 105 pfu for Neuro2a] was
inoculated into the tumor on days 0 and 3. In the TRAMP-C2
model, whereas all HSV-1 vectors caused a significant inhibition of
tumor growth compared with mock, the G47D-IL18/B7 treatment
showed the greatest efficacy, resulting in a significantly smaller
10665
Cancer Res 2005; 65: (23). December 1, 2005
Downloaded from cancerres.aacrjournals.org on June 18, 2017. © 2005 American Association for Cancer
Research.
Cancer Research
tumor size than the treatment with G47D-mIL-18 or G47D-B7-1-Ig
(P < 0.05 versus G47D-mIL-18 on days 19 and 23 and versus
G47D-B7-1-Ig on days 23 and 26; Fig. 3B). Also in the Neuro2a
model, in which tumors grow more aggressively than TRAMP-C2,
all HSV-1 vectors caused a significant inhibition of tumor growth
compared with mock. Only the G47D-IL18/B7 treatment was
significantly more efficacious than G47D and G47D-empty (P < 0.05
on day 17; Fig. 3C). When athymic mice harboring s.c. Neuro2a
tumors were treated in the same manner, there was no difference
in efficacy between armed oncolytic vectors and unarmed control
vectors, indicating that the enhancement of antitumor efficacy by
arming with the IL-18 and/or B7-1-Ig gene(s) requires T cells (data
not shown).
Our system has several important advantages over previously
reported methods that use BAC to manipulate HSV-1 genomes
(9, 11). The most time-consuming process for generating recombinant HSV-1 has been the selection of a correctly structured clone
among, literally, millions of candidates after homologous recombination. We drastically improved the probability of a precise
recombination occurrence by using recombinase systems. In fact,
14 of 16 of BAC-G47D/shuttle vector clones after the first step
(Cre recombination) possessed the expected insert and over 99% of
the clones after the second step (FLPe recombination) had the
expected phenotype (Supplementary Fig. S1). We also used multiple
devices for easy selection of correct recombinants. In addition to
the use of antibiotic-resistant genes, the GFP gene was used for a
positive selection in the process of creating the BAC-G47D plasmid
(Supplementary Fig. S1) and also for a negative selection in the
final step. It is also advantageous to have the GFP gene removed in
the final product because GFP is known to be relatively cytotoxic
and immunogenic (18, 19). The lacZ gene was used for a positive
selection in the final step (therefore, a dual marker selection
with the negative GFP) and as the histochemical marker of the
generated vector. The final vector does not contain any portion
of BAC sequences and the stuffer sequence of the shuttle vector
prevents virus formation when the excision by FLPe recombination is unsuccessful. The sequence of using the two
recombinase systems, first Cre then FLPe, was carefully chosen
so that the first recombination is done not in cells but efficiently
in a tube, and the second recombination is done in Vero cells,
which directly results in virus plaque formation. Most importantly, the system has G47D as the backbone structure and the
generated vectors would have triple gene deletions in four widely
spread loci. To develop clinically applicable armed oncolytic
HSV-1 vectors, it is crucial to use an efficacious and safe
backbone HSV-1 vector with a large therapeutic window, such as
G47D, especially because the transgene expression may result in
increased toxicity.
A series of armed oncolytic HSV-1 vectors may be developed not
only to improve the efficacy but also to cope with a wide variation
Table 1. The replication capability and transgene expression of constructed armed oncolytic HSV-1 vectors in Vero cells (A)
and mouse tumor cells (B)
(A)
Virus
Virus yields (pfu)
G47D
G47D-empty.1
G47D-empty.2
G47D-empty.3
G47D-empty.4
G47D-IL18/B7.1
G47D-IL18/B7.2
G47D-IL18/B7.3
G47D-IL18/B7.4
G47D-mIL-18.1
G47D-mIL-18.2
G47D-mIL-18.3
G47D-mIL-18.4
G47D-B7-1-Ig.1
G47D-B7-1-Ig.2
G47D-B7-1-Ig.3
G47D-B7-1-Ig.4
2.0
7.5
6.1
6.3
7.2
7.6
4.4
8.3
5.7
1.3
3.2
9.6
7.6
1.6
3.9
1.2
5.8
mIL-18 (pg/mL)
107
106
106
106
106
106
106
106
106
107
106
106
106
107
106
107
107
1,002
818
986
338
1,418
730
1,710
994
B7-1-Ig expression
( )
( )
( )
( )
( )
(+)
(+)
(+)
(+)
(+)
(+)
(+)
(+)
(B)
Virus and cells
mIL-18 (pg/mL)
G47D-IL18/B7 in Neuro2a
G47D-IL18/B7 in Pr14-2
G47D-IL18/B7 in TRAMP-C2
G47D-mIL-18 in Neuro2a
G47D-mIL-18 in Pr14-2
G47D-mIL-18 in TRAMP-C2
Cancer Res 2005; 65: (23). December 1, 2005
538
572
806
483
658
673
10666
B7-1-Ig expression
(+)
(+)
(+)
( )
( )
( )
www.aacrjournals.org
Downloaded from cancerres.aacrjournals.org on June 18, 2017. © 2005 American Association for Cancer
Research.
Oncolytic HSV Double-Armed with IL-18 and Soluble B7-1
Figure 3. The efficacy of armed oncolytic HSV-1 vectors (G47D-transgene). A, cytopathic effect of the recombinant oncolytic HSV-1 vectors in vitro.
TRAMP-C2 or Neuro2a cells were plated into six-well plates at 2 105 per well. After a 24-hour incubation, cells were infected with G47D, G47D-empty, G47D-mIL-18,
G47D-B7-1-Ig, or G47D-IL18/B7 at an MOI of 0.1 or without virus (Control ). The number of surviving cells was counted daily and expressed as a percentage of
mock-infected controls. Points, mean of triplicates; bars, SD. B, in vivo efficacy of armed oncolytic HSV-1 vectors in male C57BL/6 mice harboring TRAMP-C2
mouse prostate cancer (n = 6 per group). When established s.c. tumors in the left flank reached f6 mm in diameter, mock, G47D, G47D-empty, G47D-mIL-18,
G47D-B7-1-Ig, or G47D-IL18/B7 (5 106 pfu) was inoculated into the tumor on days 0 and 3. The G47D-IL18/B7 treatment showed the greatest efficacy, resulting in a
significantly smaller tumor size than the treatment with G47D-mIL-18 or G47D-B7-1-Ig (P < 0.05 versus G47D-mIL-18 on days 19 and 23 and versus G47D-B7-1-Ig
on days 23 and 26). C, in vivo efficacy of armed oncolytic HSV-1 vectors in female A/J mice harboring s.c. Neuro2a mouse neuroblastoma (n = 6 per group).
Animals were treated in the same manner as above (5 105 pfu). Only the G47D-IL18/B7 treatment was significantly more efficacious than G47D and G47D-empty
(P < 0.05 on day 17). Tumor volume = length width height (mm). Bars, SE.
of cancer types, progression stages, or routes of administration.
We believe our system facilitates the progress of such cancer
therapeutics development.
Acknowledgments
Received 7/20/2005; accepted 9/29/2005.
Grant support: James S. McDonnell Foundation Brain Cancer Program, the
Massachusetts General Hospital/Giovanni Armenise Neuro-Oncology and Related
References
1. Markert JM, Medlock MD, Rabkin SD, et al. Conditionally replicating herpes simplex virus mutant, G207
for the treatment of malignant glioma: results of a phase
I trial. Gene Ther 2000;7:867–74.
2. Mineta T, Rabkin SD, Yazaki T, Hunter WD, Martuza
RL. Attenuated multi-mutated herpes simplex virus-1
www.aacrjournals.org
Disorders Grants Program, and the Ministry of Education, Culture, Sports, Science
and Technology of Japan (T. Todo); NIH grants R01 NS032677 and R01 CA102139
(R.L. Martuza); and Uehara Memorial Foundation postdoctoral fellowship
(H. Fukuhara).
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Drs. Yoshinaga Saeki, Samuel D. Rabkin, and E. Antonio Chiocca for their
helpful advice, Miyuki Hikasa for technical assistance, and Dr. Isao Hara for providing
murine IL-18 cDNA.
for the treatment of malignant gliomas. Nat Med 1995;
1:938–43.
3. Todo T, Martuza RL, Rabkin SD, Johnson PA. Oncolytic
herpes simplex virus vector with enhanced MHC class I
presentation and tumor cell killing. Proc Natl Acad Sci
U S A 2001;98:6396–401.
4. Todo T, Rabkin SD, Sundaresan P, et al. Systemic
antitumor immunity in experimental brain tumor
10667
therapy using a multimutated, replication-competent
herpes simplex virus. Hum Gene Ther 1999;10:
2741–55.
5. Todo T, Martuza RL, Dallman MJ, Rabkin SD. In situ
expression of soluble B7–1 in the context of oncolytic
herpes simplex virus induces potent antitumor immunity. Cancer Res 2001;61:153–61.
6. Saeki Y, Breakefield XO, Chiocca EA. Improved HSV-1
Cancer Res 2005; 65: (23). December 1, 2005
Downloaded from cancerres.aacrjournals.org on June 18, 2017. © 2005 American Association for Cancer
Research.
Cancer Research
amplicon packaging system using ICP27-deleted,
oversized HSV-1 BAC DNA. Methods Mol Med 2003;
76:51–60.
7. Saeki Y, Ichikawa T, Saeki A, et al. Herpes simplex virus
type 1 DNA amplified as bacterial artificial chromosome
in Escherichia coli : rescue of replication-competent
virus progeny and packaging of amplicon vectors.
Hum Gene Ther 1998;9:2787–94.
8. Stavropoulos TA, Strathdee CA. An enhanced packaging system for helper-dependent herpes simplex virus
vectors. J Virol 1998;72:7137–43.
9. Horsburgh BC, Hubinette MM, Qiang D, MacDonald
ML, Tufaro F. Allele replacement: an application that
permits rapid manipulation of herpes simplex virus type
1 genomes. Gene Ther 1999;6:922–30.
10. Suter M, Lew AM, Grob P, et al. BAC-VAC, a novel
generation of (DNA) vaccines: a bacterial artificial
chromosome (BAC) containing a replication-competent,
packaging-defective virus genome induces protective
Cancer Res 2005; 65: (23). December 1, 2005
immunity against herpes simplex virus 1. Proc Natl Acad
Sci U S A 1999;96:12697–702.
11. Kambara H, Okano H, Chiocca EA, Saeki Y. An
oncolytic HSV-1 mutant expressing ICP34.5 under
control of a nestin promoter increases survival of
animals even when symptomatic from a brain tumor.
Cancer Res 2005;65:2832–9.
12. Bennett JJ, Malhotra S, Wong RJ, et al. Interleukin 12
secretion enhances antitumor efficacy of oncolytic
herpes simplex viral therapy for colorectal cancer. Ann
Surg 2001;233:819–26.
13. Liu BL, Robinson M, Han ZQ, et al. ICP34.5 deleted
herpes simplex virus with enhanced oncolytic, immune
stimulating, and anti-tumour properties. Gene Ther
2003;10:292–303.
14. Hara S, Nagai H, Miyake H, et al. Secreted type of
modified interleukin-18 gene transduced into mouse
renal cell carcinoma cells induces systemic tumor
immunity. J Urol 2001;165:2039–43.
10668
15. Logvinoff C, Epstein AL. A novel approach for herpes
simplex virus type 1 amplicon vector production, using
the Cre-loxP recombination system to remove helper
virus. Hum Gene Ther 2001;12:161–7.
16. Buchholz F, Angrand PO, Stewart AF. Improved
properties of FLP recombinase evolved by cycling
mutagenesis. Nat Biotechnol 1998;16:657–62.
17. Umana P, Gerdes CA, Stone D, et al. Efficient FLPe
recombinase enables scalable production of helperdependent adenoviral vectors with negligible helpervirus contamination. Nat Biotechnol 2001;19:582–5.
18. Goto H, Yang B, Petersen D, et al. Transduction of
green fluorescent protein increased oxidative stress and
enhanced sensitivity to cytotoxic drugs in neuroblastoma cell lines. Mol Cancer Ther 2003;2:911–7.
19. Gambotto A, Dworacki G, Cicinnati V, et al.
Immunogenicity of enhanced green fluorescent protein
(EGFP) in BALB/c mice: identification of an H2-Kdrestricted CTL epitope. Gene Ther 2000;7:2036–40.
www.aacrjournals.org
Downloaded from cancerres.aacrjournals.org on June 18, 2017. © 2005 American Association for Cancer
Research.
Triple Gene-Deleted Oncolytic Herpes Simplex Virus Vector
Double-Armed with Interleukin 18 and Soluble B7-1
Constructed by Bacterial Artificial Chromosome−Mediated
System
Hiroshi Fukuhara, Yasushi Ino, Toshihiko Kuroda, et al.
Cancer Res 2005;65:10663-10668.
Updated version
Supplementary
Material
Cited articles
Citing articles
E-mail alerts
Reprints and
Subscriptions
Permissions
Access the most recent version of this article at:
http://cancerres.aacrjournals.org/content/65/23/10663
Access the most recent supplemental material at:
http://cancerres.aacrjournals.org/content/suppl/2005/11/28/65.23.10663.DC1
This article cites 19 articles, 6 of which you can access for free at:
http://cancerres.aacrjournals.org/content/65/23/10663.full.html#ref-list-1
This article has been cited by 6 HighWire-hosted articles. Access the articles at:
/content/65/23/10663.full.html#related-urls
Sign up to receive free email-alerts related to this article or journal.
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Department at [email protected].
To request permission to re-use all or part of this article, contact the AACR Publications
Department at [email protected].
Downloaded from cancerres.aacrjournals.org on June 18, 2017. © 2005 American Association for Cancer
Research.