Journal of Molecular and Cellular Cardiology 59 (2013) 139–147
Contents lists available at SciVerse ScienceDirect
Journal of Molecular and Cellular Cardiology
journal homepage: www.elsevier.com/locate/yjmcc
Original article
p90 RSKs mediate the activation of ribosomal RNA synthesis by the hypertrophic
agonist phenylephrine in adult cardiomyocytes
Ze Zhang a, Rui Liu a, Paul A. Townsend b,⁎, Christopher G. Proud a,⁎⁎
a
b
Centre for Biological Sciences, University of Southampton, Southampton, UK
Cancer Sciences, Faculty of Medicine, University of Southampton, Southampton, UK
a r t i c l e
i n f o
Article history:
Received 15 February 2013
Received in revised form 5 March 2013
Accepted 7 March 2013
Available online 17 March 2013
Keywords:
Ribosome biogenesis
Hypertrophy
Cardiomyocyte
MAP kinase
p90RSK
a b s t r a c t
Cardiac hypertrophy involves the growth of heart muscle cells and is driven by faster protein synthesis which
involves increased ribosome biogenesis. However, the signaling pathways that link hypertrophic stimuli
to faster ribosome production remain to be identified. Here we have investigated the signaling pathways
which promote ribosomal RNA synthesis in cardiomyocytes in response to hypertrophic stimulation. We
employed a new non-radioactive labeling approach and show that the hypertrophic agent phenylephrine
(PE) stimulates synthesis of 18S rRNA (made by RNA polymerase I) and 5S rRNA (produced by RNA polymerase III) in adult cardiomyocytes. In many settings, rRNA synthesis is driven by rapamycin-sensitive signaling
through mammalian target of rapamycin complex 1 (mTORC1). However, the activation of rRNA synthesis by
PE is not inhibited by rapamycin, indicating that its regulation involves other signaling pathways. PE stimulates MEK/ERK signaling in these cells. Inhibition of this pathway blocks the ability of PE to activate synthesis
of 18S and 5S rRNA. Furthermore, BI-D1870, an inhibitor of the p90RSKs, protein kinases which are activated by
ERK, blocks PE-activated rRNA synthesis, as did a second p90 RSK inhibitor, SL0101. BI-D1870 also inhibits the
PE-stimulated association of RNA polymerase I with the rRNA promoter. These findings show that signaling
via MEK/ERK/p90 RSK, not mTORC1, drives rRNA synthesis in adult cardiomyocytes undergoing hypertrophy.
This is important both for our understanding of the mechanisms that control ribosome production and, potentially, for the management of cardiac hypertrophy.
© 2013 Elsevier Ltd. Open access under CC BY-NC-ND license.
1. Introduction
In the adult myocardium, growth is mediated through changes
in the size of the cardiomyocytes. A major driver of cell growth
is the rate of protein synthesis, reflecting the fact that the majority
of dry cell mass is protein. Consistent with this, agents that induce
cardiomyocyte growth (hypertrophy) activate protein synthesis
Abbreviations: 4SU, 4-thiouridine; ARVC, adult rat ventricular cardiomyocytes;
CH, cardiac hypertrophy, ChIP, chromatin immunoprecipitation; ERK, extracellular
ligand-regulated kinase; MEK, mitogen-activated protein kinase kinase; mTOR,
mammalian target of rapamycin; mTORC, mTOR complex; p90RSK, 90 kDa ribosomal
protein S6 kinase; PE, phenylephrine; PKB, protein kinase B (also termed Akt); Pol I
(or Pol III), RNA polymerase I/III; Rp, ribosomal protein; rRNA, ribosomal RNA; UBF,
upstream binding factor.
⁎ Correspondence to: P.A. Townsend, present address: Faculty Institute for Cancer
Sciences, University of Manchester, Manchester Academic Health Science Centre,
Research Floor, St Mary's Hospital, Oxford Road, Manchester, M13 9WL, UK. Tel.: +44
161 701 6923; fax: +44 161 701 6919.
⁎⁎ Correspondence to: C.G. Proud, Centre for Biological Sciences, University of
Southampton, Highfield Campus, Southampton, SO17 1BJ, UK. Tel.: +44 2380 592028;
fax: +44 2380 595159.
E-mail addresses: [email protected] (P.A. Townsend),
[email protected] (C.G. Proud).
0022-2828 © 2013 Elsevier Ltd. Open access under CC BY-NC-ND license.
http://dx.doi.org/10.1016/j.yjmcc.2013.03.006
(reviewed in [1]). Cardiac hypertrophy (CH) occurs in response,
e.g., to increased load, and is initially adaptive. However, in conditions
of continued stress, CH leads to loss of cardiomyocytes and to tissue
fibrosis, becoming a major risk factor for heart failure. A better understanding of the molecular mechanisms that link pro-hypertrophic
stimuli to increased protein synthesis in cardiomyocytes is needed
to develop therapeutic strategies for CH.
Cellular protein synthesis rates are determined both by the overall
levels of ribosomes and translation factors (‘translational capacity’)
and by their intrinsic activities (‘translational efficiency’). The hypertrophic agonist PE rapidly stimulates protein synthesis in ARVC [2].
This effect is markedly inhibited by rapamycin, indicating that it
is mediated through the mammalian target of rapamycin complex 1,
mTORC1. Activation of mTORC1 by hypertrophic stimuli such as
PE in ARVC is mediated by MEK/ERK signaling [3–6]. Early studies
demonstrated that ribosome content increases in hypertrophying
rat heart and that increased ribosome synthesis is an early event in
hypertrophy [7,8]. However, it is unclear how hypertrophic stimuli
promote ribosome biogenesis in cardiomyocytes.
Production of new ribosomes requires synthesis of four ribosomal
RNAs (rRNAs) and about 80 ribosomal proteins (Rps) [9]. The three
larger rRNAs are made in the nucleolus by RNA polymerase I (Pol I)
140
Z. Zhang et al. / Journal of Molecular and Cellular Cardiology 59 (2013) 139–147
as a precursor, processing of which yields the mature 5.8S, 18S and
28S rRNAs. The 5S rRNA is made by Pol III. Studies in cell lines have
revealed that mTORC1 can regulate Pol I and Pol III [9–11].
Previous work on ribosome biogenesis in cardiomyocytes used neonatal cardiomyocytes (e.g., [12]), which are far easier to make and work
with than adult cardiomyocytes. Here, we have studied the regulation
of rRNA synthesis in primary adult rat cardiomyocytes, where PE drives
cell growth [13]. We show that PE stimulates the synthesis of the 18S
and 5S rRNAs, implying that it activates Pol I and Pol III, respectively.
These effects are blocked by inhibition of MEK, indicating a requirement
for MEK/ERK signaling. However, PE-activated rRNA synthesis is not
blocked by rapamycin indicating that, unusually, mTORC1 does not
mediate the activation of rRNA production in this setting. Instead, the
stimulation of rRNA synthesis by PE requires the activity of p90RSKs, kinases downstream of ERK [14]. Thus, in cardiomyocytes stimulated
with a hypertrophic agonist, MEK/ERK/p90RSK signaling, and not
mTORC1, appears to be the major driver of activated rRNA synthesis.
2. Materials and methods
2.1. Materials
Chemicals for cardiomyocyte isolation were purchased from BDHMerck (Poole, UK) or Sigma-Aldrich unless otherwise stated. Bovine
serum albumin (BSA, fraction V) was from Boehringer Mannheim
and Collagenase (type II) from Worthington Biochemical, New Jersey.
Nylon monofilament filter cloth was from Cadish Precision Meshes.
Dialysis tubing of size 5 (MW cut-off: 12–14000 Da) was from Medicell
International. One mL pastettes were from Alpha Laboratories. Vacuum
filter unit Stericup sterile PES membrane (0.22 μm pore size) was from
Millipore.
All chemicals and biochemicals for RNA isolation, including
4-thiouridine (4SU), and for the chromatin immunoprecipitation assay
were obtained from Sigma-Aldrich unless otherwise stated. Tissue
culture reagents were provided by Invitrogen. Trizol was from Invitrogen
and EZ-Link Biotin-HPDP was from Pierce. Magnetic Porous Glass (MPG)
Streptavidin beads were purchased from PUREBiotech. Actinomycin-D,
PP242 and rapamycin were supplied by Calbiochem, PD184352 from
Toronto Research Chemicals, and AZD6244 from Selleck Chemicals.
BI-D1870 was obtained from the Division of Signal Transduction Therapy, College of Life Sciences, University of Dundee (UK). A769662
and SL0101 were from TOCRIS Bioscience. L-[35S]methionine and [3H]
uridine were from PerkinElmer. Econofluor scintillation liquid was
from Packard Instruments. Real Time-PCR primers and 2× SYBR
Green qPCR mastermix were purchased from PrimerDesign. 3MM filter
paper was from Whatman International and nitrocellulose transfer
membrane (0.45 μm pore size) from Bio-Rad.
All phosphospecific antibodies and anti-ribosomal protein S6 were
from Cell Signaling Technology. Anti-α-tubulin and anti-UBF (H-300)
were from Santa Cruz Biotechnology, as were antibodies for IP of Pol I
(sc-46699) and Pol II (sc-47701). Appropriate marker proteins were included on all gels and immunoblots, and were used to ensure that the
antibodies did indeed detect the protein bands of the expected sizes.
2.2. Preparation, maintenance and treatment of ARVC
Adult rat ventricular cardiomyocytes were isolated and maintained
in culture as described [15,16]. Adult male Sprague–Dawley rats
(250–300 g) were from the Biomedical Research Facility, University
of Southampton.
2.3. Assay of uridine uptake into ARVC
Uridine transport was monitored in cultured ARVC cells in medium
either containing or lacking Na + ions, using a method based on those
used in earlier studies [17–19].
2.4. Analysis of RNA dynamics using 4SU labeling
The synthesis and decay of labeled RNA were isolated and measured as previously described [20,21]. Briefly, 4SU is incorporated
into newly-synthesized RNA; following cell lysis, 4SU tagged RNA is
covalently coupled to biotin, and isolated on streptavidin beads.
After reverse-transcription to cDNA, the quantity of any RNA of interest can be determined by real-time PCR using appropriate primers.
2.5. qChIP analysis
Chromatin immunoprecipitation (ChIP) was performed as described
previously with modifications [22,23]. Cross-linking was achieved with
1% formaldehyde for 5 min at an ambient temperature and the cells
were sonicated eighteen times for 30 s.
Primers for qPCR analysis of ChIP reactions were β-actin
(Primerdesign, Southampton, UK), ENH (sense: AGGAGGCCGGGCA
AGCA, antisense: CCTCCTTGTTAGAGACCGTCCTTAA), UCE (sense:
AGTTGTTCCTTTGAGGTCCGGT, antisense: AGGAAAGTGACAGGCCAC
AGAG) and CORE (sense: AGTTGTTCCTTTGAGGTCCGGT, antisense:
CAGCCTTAAATCGAAAGGGTCT). The relative level of DNA binding
was analysed using primers specific for the indicated regions of the
Pol I promoter by qRT-PCR. Average values of precipitated DNA
were normalized to input control.
3. Results and discussion
3.1. PE stimulates the synthesis of new rRNAs in ARVC
We applied a non-radioactive procedure to tag and quantify
newly-made rRNA whereby cells are incubated with 4SU which is incorporated into new RNA molecules. Following cell lysis, labeled RNA
molecules are covalently linked to biotin and then isolated. After
reverse transcription (RT), quantitative real-time PCR (RT-qPCR) is
used to measure the levels of any RNA molecule of interest.
To assess whether transferring the cells to medium containing
4SU affected their response to PE, we incubated ARVC for 30 min in
medium containing or lacking 4SU to treatment with PE for times
up to 1 h. As expected from our earlier studies [2], PE rapidly induced
the phosphorylation (activation) of ERK (Fig. 1A). The presence of
4SU did not affect this. To assess activation of mTORC1 signaling, we
looked at the phosphorylation of Rp S6 (Fig. 1A). As reported earlier
[2], PE increased S6 phosphorylation and neither the timing nor the
extent of this response was affected by 4SU (Fig. 1A).
Activation of rRNA transcription has previously been shown to be
slow in neonatal cardiomyocytes [12]. Therefore, to assess whether
PE activates rRNA synthesis, ARVC were treated with PE for 20 h
prior to the addition of 4SU. In some cases, cells were treated with actinomycin D (2μg/mL), which inhibits transcription by Pol I, Pol II and
Pol III, prior to addition of 4SU. In the absence of actinomycin D, we
observed labeling of transcripts made by each of these polymerases
(18S rRNA, Pol I; actin, Pol II; and 5S rRNA, Pol III; Fig. 1B). Incorporation
of 4SU into each of them was enhanced by PE, indicating that PE stimulates the transcription of each of these genes, including rRNAs. Importantly labeling was completely blocked by actinomycin D (Fig. 1B),
confirming that this method only detects newly-synthesized RNAs.
By 12 h of PE treatment, a small increase in the labeling of 18S
rRNA was observed (Fig. 1C), but no significant changes in 5S or
actin were apparent (Fig. 1C). After 24 h treatment, much more robust
increases in all three were observed (Fig. 1C); we therefore selected
this as the time-point for further experiments.
Previous work, using neonatal rat cardiomyocytes [12,24], indicated that hypertrophic stimuli increase the cellular levels of upstream binding factor (UBF; a component of the Pol I machinery)
and Brf1 (a component of TFIIIB, which is a Pol III-specific transcription factor). UBF levels were also increased in vivo after one week of
Z. Zhang et al. / Journal of Molecular and Cellular Cardiology 59 (2013) 139–147
A
PE
- 4SU
0
5
25
141
+ 4SU
45
0
25
5
45
min
pS6240/244
Total S6
pErk1/2
Erk1/2
p-p90RSK Thr573
Tubulin
B
New RNA (control = 1)
p-PKB Ser473
KB cells
Insulin, 10 min
2.5
20h
PE
_
+ Actinomycin D
2µg/mL
2
1.5
Extract
RNA
New 5S rRNA
1
New β-Actin
0.5
0
3.5
New RNA (control = 1)
Add 3h
4-SU
New18S rRNA
Control
C
30’
PE
3
PE
9/21h Add 3h
4-SU
Act+PE
Extract
RNA
+
New 18S rRNA
2.5
2
D
+
+
+
BI-D1870
PE
New 5S rRNA
UBF
New β-Actin
Brf1/2
1.5
Tubulin
1
0.5
0
12h
12h+PE
24h
24h+PE
Fig. 1. Phenylephrine enhances synthesis of rRNA in ARVC. (A) ARVC were preincubated in medium containing or lacking 4SU for 30 min and 10 μmol/L PE was then added for the
indicated times (minutes). After lysis, equal amount of lysates (by protein) was analysed by SDS-PAGE and immunoblot using the indicated antibodies. (B,C) ARVC were treated
with 10 μmol/L PE and labeled with 4SU as indicated, actinomycin D being added where shown. Samples were processed for isolation of RNA and quantitation of 4SU-labeled
RNA by qPCR. Data are normalized to total 18S rRNA with levels in untreated cells being set at unity. (C) Data are presented as mean ± SEM (n = 3). (D) ARVC were treated
with PE (10 μM) and/or BI-D1870 (10 μM) for 24 h. Cells were lysed and equal amounts of protein were analysed by SDS-PAGE/immunoblot using the indicated antibodies.
aortic constriction [25]. However, although PE activated synthesis of
both 18S rRNA and 5S rRNA by 24 h, there was no detectable change
in levels of UBF or Brf1 (Fig. 1D). Thus, stimulation of rRNA synthesis
by PE in ARVC does not require increased levels of UBF or Brf1, but
likely involves activation of pre-existing components of the Pol I/III
machinery.
Before its incorporation into new RNA molecules, 4SU must enter
the cells. It was therefore important to test whether relevant signaling
inhibitors affected uridine uptake [26,27]. Linear uptake of [ 3H]uridine
into ARVC was observed up to 90 s (Fig. 2A); linear rates of net uptake
are not maintained at longer times, because the nucleoside transporters are equilibrative, not concentrative. PE did not affect the rate
of uridine uptake (Fig. 2B). Because a previous report indicated that
very high concentrations of rapamycin (10 μmol/L) inhibited uptake
of [ 3H]uridine into human K562 cells [26], we first assessed what
concentration of rapamycin was required for maximal inhibition
of mTORC1 signaling in ARVC, as judged from the phosphorylation
of S6 at Ser240/244, specific substrates for the mTORC1-activated
S6 kinases [28]. 100 nmol/L was required to block this completely
(Fig. 2C) and this concentration was used in subsequent experiments.
At this concentration, rapamycin reduced the uptake of [ 3H]uridine
into ARVC (Fig. 2B).
Importantly for the work described below, neither the MEK inhibitor AZD6244 [29] (Fig. 2D) nor the p90 RSK inhibitor BI-D1870
[30] (Fig. 2E) significantly affected uridine uptake. They can therefore
be used to study the regulation of rRNA synthesis without interference
from effects on nucleoside transport.
3.2. Rapamycin does not block PE-stimulated rRNA synthesis
To examine whether activation of rRNA synthesis by PE requires
mTORC1, we studied the effect of rapamycin. Rapamycin decreased
both basal and PE-stimulated synthesis of 18S and 5S rRNA (Fig. 3A,B).
The reduced basal rate of labeling likely reflects the partial impairment
of uridine uptake observed in Fig. 2B. Importantly, PE still enhanced
rRNA labeling in the presence of rapamycin, and to at least the same
142
Z. Zhang et al. / Journal of Molecular and Cellular Cardiology 59 (2013) 139–147
Cpm/µg protein
A
7
6
5
4
3
2
1
0
0
20
40
60
80
100
Time (s)
C
PE + rapa (nM)
1.2
1
0.8
0.6
0.4
0.2
0
NT PE
D
Uridine Uptake
(NT=1)
5
10
100
p-S6 Ser
240/244
Total S6
E
1.5
1
0.5
0
Uridine Uptake
(NT=1)
Uridine
ridine Uptake
(NT=1)
B
1.5
1
0.5
0
Fig. 2. Effects of signaling inhibitors on uptake of [3H]uridine into ARVC. (A) ARVC were incubated in medium to which 1 μCi/nmol [3H]uridine was added at t = 0. Cells were incubated further as indicated before harvesting and processing for measurement of [3H]uridine uptake. (B) [3H]uridine uptake was measured as for Panel A, but cells were treated
with 10 μmol/L PE and/or 100 nmol/L rapamycin for 16 h prior to the uptake assay. (C) ARVC were treated with different concentrations of rapamycin 30 min prior to stimulation
with 10 μmol/L PE for a further 30 min. Samples of lysate were processed by SDS-PAGE/immunoblot using the indicated antibodies. (D,E) As Panel B but using AZD6244 (5 μmol/L,
45 min) or BI-D1870 (10 μmol/L, 60 min) prior to PE stimulation. In panels B, D and E, data are shown as mean ± SEM (n = 3). NT, non-treated cells.
extent as in its absence. Importantly, given that 100 nmol/L rapamycin
completely blocks PE-induced S6 phosphorylation (Fig. 2C), these
findings demonstrate that the PE-induced activation of rRNA synthesis
is not mediated via rapamycin-sensitive functions of mTORC1 and
thus, in this case, does not involve the S6 kinases which have been
suggested to promote rRNA synthesis (reviewed [31]). Thus, the control
of rRNA synthesis by PE in ARVC differs from other settings, where
mTORC1 signaling does play a major role [9].
Since some mTOR functions are resistant to rapamycin [32–35],
we used PP242 [32] which, unlike rapamycin, directly inhibits mTOR's
kinase activity and blocks all functions of mTOR. As expected, PP242
blocked PE-induced phosphorylation of S6 at Ser235/236 and
Ser240/244 (Suppl. Fig. S1A) without affecting ERK phosphorylation.
PP242 partially inhibited basal rate 18S and 5S rRNA synthesis
(Suppl. Fig. S1B). PP242 also substantially inhibited the PE-activated
synthesis of both 18S rRNA and, to a lesser extent, 5S rRNA synthesis
(Suppl. Fig. S1B). Nonetheless, and especially for 5S rRNA synthesis,
PE was still able to stimulate rRNA transcription even in the presence
of PP242, indicating that events independent of mTOR are involved.
PP242, like rapamycin, inhibited [ 3H]uridine uptake by 40-50% in
both PE-treated and control conditions (Suppl. Fig. S1C). Hence, its inhibitory effect on basal 4SU-labeling of rRNA likely reflects impaired
uptake of 4SU, while the partial inhibition of the stimulatory effect
of PE may reflect a genuine impairment of rRNA transcription or
increased decay of new rRNA given that inhibition of mTOR affects
rRNA processing [17]. Such effects could be mediated via mTORC2
or rapamycin-insensitive functions of mTORC1; the lack of a specific
mTORC2 inhibitor precludes us from studying this further.
3.3. PE enhances rRNA synthesis via MEK signaling
As shown here and previously [2–4], PE activates MEK/ERK signaling
in ARVC and this mediates its short-term (1–3 h) stimulatory effects
on protein synthesis. To test the role of this pathway in rRNA synthesis,
we used the specific MEK inhibitor, AZD6244 [29], which completely
blocked PE-induced ERK activation (phosphorylation; Fig. 4A). Consistent with earlier data obtained using other MEK inhibitors [2–4],
AZD6244 also largely inhibited activation of mTORC1 signaling as
manifested by decreased phosphorylation of S6(Ser240/244).
AZD6244 did not significantly affect basal 18S rRNA transcription
(Fig. 4B) but completely blocked the stimulation by PE, indicating
that PE activates Pol I via MEK/ERK signaling (independently of
mTORC1, which is also activated by MEK/ERK in ARVC). AZD6244
did not elicit activation of AMPK (which can negatively regulate the
Z. Zhang et al. / Journal of Molecular and Cellular Cardiology 59 (2013) 139–147
A
A
New 18S
(Control=1)
2.5
16h
2
+
1.91
1.5
1
+
+
+
+
+
PE
AZD6244
Erk1/2
p-S6 Ser240/244
Control
Rapa
PE
p-AMPK T172
PE+Rapa
A-769662 1h
α-Tubulin
B
2.5
1.5
1.85
1
3.39
0.5
0
Control
Rapa
PE
PE+Rapa
Fig. 3. Rapamycin does not inhibit phenylephrine-stimulated rRNA synthesis. (A,B)
ARVC were treated with PE with/without 100 nmol/L rapamycin (added 30 min
prior to PE) for 24 h and labeled with 100 μmol/L 4SU for the final 4 h. Samples
were processed for isolation of rRNA and quantitation of new 4SU-labeled 18S (A) or
5S (B) rRNA by qPCR. Data are shown as mean ± SEM (n = 3). Numbers above
the dotted arrows indicate the fold increase in labeling caused by PE in each pair
of samples.
Pol I machinery [36]), which is caused by some other MEK inhibitors
[37,38] (Fig. 4A).
A second MEK inhibitor, PD184352 [39], also completely blocked
PE-induced 5S and 18S rRNA synthesis, without affecting basal synthesis rates, confirming the importance of MEK in this response
(Suppl. Fig. S2). However, because PD184352 is one of the MEK inhibitors that can activate AMPK, we did not use this compound further
in this study.
New 18S (Control=1)
B
2
2.5
p<0.05
2
1.5
1
0.5
0
C
New 5S (Control=1)
New 5S (Control=1)
+
16h
pErk1/2
2.58
0.5
0
5min
143
2
p<0.05
1.5
1
0.5
0
3.4. Enhances rRNA synthesis via p90 RSKs
To assess which signaling components mediate activation of Pol I
and Pol III downstream of MEK/ERK, we used BI-D1870, a potent
and selective inhibitor of the four p90 RSK isoforms [30]. Earlier data
(discussed in [40]) indicate that p90 RSK2/3 are the main isoforms in
ARVC. Our data (Fig. 5A) confirm this and that their levels are not
altered by PE (Fig. 5A). p90 RSKs are activated by ERK [14] and we previously showed that PE rapidly activates p90 RSKs in ARVC [4], and that
BI-D1870 blocks signaling through p90 RSKs in these cells [41], as it
also does in neonatal cardiomyocytes [42]. BI-D1870 did not impede
activation of ERK by PE (Fig. 5B); rather, it potentiated it, likely
because it blocks an inhibitory feedback loop, as reported earlier
[30,41]. Extended treatment of ARVC with BI-D1870 (for 24 h) caused
a decrease in the levels of p90 RSK2, but not p90 RSK3 (Fig. 5A). This may
reflect a destabilizing effect of BI-D1870 on its target, the p90 RSK2 protein, but could reflect an additional effect of this compound. This effect
was not observed in earlier studies where cells were only treated for
shorter periods with this compound (e.g., [30]).
BI-D1870 did not affect basal labeling of 5S or 18S rRNA, but
completely blocked the stimulation by PE (Figs. 5C,D), indicating
that activation of Pol I and Pol III by PE requires an obligatory input
from p90 RSKs. One potential caveat is that BI-D1870 can also interfere
with activation of PKB [41,43]; however, PE does not activate PKB in
ARVC( [2] and Figs. 1A,5B).
Fig. 4. The MEK inhibitor, AZD6244, blocks activation of rRNA synthesis by PE.
(A) ARVC were treated with 10 μmol/L PE for the indicated times and, where shown,
5 μmol/L AZD6244 (added 45 min before PE). Samples of lysate were processed
by SDS-PAGE/immunoblot using the indicated antibodies. The right-hand lane for
the p-AMPK blot shows a sample from hepatoma cells treated with 300 nmol/L
A-769662 for 1 h and run on the same gel. (B,C) ARVC were treated with 10 μmol/L
PE for 24 h in the presence of 5 μmol/L AZD6244 (added 45 min prior to PE) where
indicated and labeled with 100 μmol/L 4SU 4 h. Samples were processed for isolation
of RNA and quantitation of new 4SU-labeled rRNA by qPCR. Data are shown as
mean ± SEM (n = 3).
To extend these data, we also used an additional p90 RSK inhibitor,
SL0101 [44] although this compound is a much less potent inhibitor
of p90 RSKs as judged from in vitro data [45]. We therefore employed
it at a higher concentration than for BI-D1870 (50 μM, the concentration generally used in other studies). As shown in Figs. 5E,F, SL0101
strongly inhibited the activation of 18S and 5S rRNA synthesis caused
by PE, but without affecting basal synthesis rates. The latter observation indicates it very unlikely to affect uridine uptake, while the
observed inhibition of the effect of PE supports the conclusion that
p90 RSKs play a key role in mediating the activation of rRNA synthesis
in response to PE. The incomplete inhibition likely reflects the lower
potency of this inhibitor, and is consistent with the observation
(Suppl. Fig. S3) that, while BI-D1870 strongly inhibits the PE-induced
144
Z. Zhang et al. / Journal of Molecular and Cellular Cardiology 59 (2013) 139–147
A
+
+
B
+
BI-D1870
+
PE
Cont
BI-D1870 PE+BI-D1870
10
20
µM
10
20
PE
RSK2
pErk1/2
RSK3
α-Tubulin
p-PKB
Ser473
Tubulin
Insulin
10min,
KB cells
2.5
p<0.05
2
1.5
1
0.5
0
New 18S (Control=1)
E
New 5S (Control=1)
D
2.5
p<0.05
2
1.5
1
0.5
0
F
p<0.05
2.5
2
1.5
1
0.5
0
New 5S (Control=1)
New 18S (Control=1)
C
2.5
p<0.05
2
1.5
1
0.5
0
Fig. 5. The p90RSK inhibitor, BI-D1870, inhibits PE-enhanced rRNA synthesis in ARVC. (A) ARVC were treated with 10 μmol/L PE for 24 h with or without BI-D1870 (added 60 min
prior to PE). Samples of lysate were processed by SDS-PAGE/immunoblot using the indicated antibodies. The right-hand lane for the p-PKB blot shows a sample from insulin-treated
KB cells as a positive control. (B) As A, but ARVC were treated with 10 μmol/L PE for 15 min with or without BI-D1870 (added 60 min prior to PE). (C,D) ARVC were treated with
10 μmol/L PE for 24 h in the presence of 10 μmol/L BI-D1870 (added 1 h prior to PE) where indicated and labeled with 100 μmol/L 4SU for 4 h. Samples were processed for isolation
of RNA and quantitation of new 4SU-labeled rRNA by qPCR. Data are shown as mean ± SEM (n = 3). (E,F) As C,D but SL0101 (50 μmol/L) was used in place of BI-D1870.
phosphorylation of the p90RSK substrate GSK3, SL0101 only does so to
a lesser extent. Given we already have to use a relatively high concentration of SL0101, we were reluctant to test it at even higher levels,
where it may well exert off-target effects.
An earlier study suggested that p90 RSK may regulate the activity
of Pol I by phosphorylating TIF-1A [46]. While this may explain the
ability of BI-D1870 to inhibit 18S rRNA synthesis, it does not explain
the equally strong inhibition of 5S synthesis (Fig. 5D). Since the
assembly of new ribosomes requires all four rRNAs, three of which
are derived from the same precursor as 18S rRNA, it was possible
that inhibition of the activation of Pol I indirectly affected the stability
of new 5S rRNA, perhaps because it cannot be incorporated into
new ribosomes without the other rRNAs. To test this possibility, we
configured the 4SU labeling experiment as a pulse-chase protocol
(Fig. 6A). The data clearly show that BI-1870 causes the decay of
new 18S rRNA and 5S rRNA. This effect is similar to the effects of
rapamycin-induced inhibition of rRNA synthesis in HeLa cells, which
also promotes decay of new rRNA [17] and may explain the observed
inhibition of the accumulation of new 5S rRNA seen here.
It is potentially relevant that p90 RSKs are reported to regulate
mTORC1 signaling [47–49]. However, our earlier data revealed that
BI-D1870 does not interfere with activation of mTORC1 by PE in
ARVC [41]. Thus, p90 RSKs control PE-stimulated rRNA transcription
in ARVC directly, rather than via mTORC1. Interestingly, PE induces
nuclear translocation of p90 RSK in neonatal cardiomyocytes [50].
Earlier work implied that p90 RSKs phosphorylate Ser649 in the
C-terminus of TIF-1A [46]; however, there is no consensus phosphorylation site for the N-terminal kinase domain of these enzymes in this
region of TIF-1A, leading those authors to suggest that phosphorylation was catalysed by the C-terminal kinase domain (which functions
to activate the N-terminal kinase domain, which in turn transphosphorylates other proteins). However, BI-D1870 inhibits the
N-terminal, not the C-terminal, domain of p90 RSKs [30], ruling out this
explanation. While human, mouse and rat TIF-1A sequences contain
Z. Zhang et al. / Journal of Molecular and Cellular Cardiology 59 (2013) 139–147
New 18S (Control=1)
A
Add
PE
1.2
1
0.8
0.6
0.4
0.2
0
20h Add
4-SU
1h
3h
10 µM
BI-D1870 Extract Extract
Remove 4-SU
RNA
RNA
4h
145
A
5’ETS 18S
NTS
28S
3’ETS
NTS
Promoter
ENH
B
5.8S
30
UCE
Input
ITS
CORE
Pol I
ENH: Enhancer Element
UCE: Upstream Control Element
Core: Core promoter Element
Pol II
CORE
*
25
ENH
New 5S (Control=1)
B
1.2
1
0.8
% Total DNA
GAPDH
20
UCE
Lysate: PE 24h
*
15
*
10
5
0.6
0.4
CORE
Ψ Ψ Ψ
0
Control
BI-D1870
PE
PE+BI-D1870
0.2
0
Fig. 6. BI-D1870 induces decay of newly-synthesized rRNA in ARVC. (A,B) ARVC were
incubated in the presence of 10 μmol/L PE for 20 h and labeled with 100 μmol/L 4SU
for a further 4 h, as indicated. They were then transferred to medium lacking 4SU,
with or without 10 μmol/L BI-D1870, and incubated for a further 1 or 3 h. Samples
were processed for isolation of RNA and quantitation of new 4SU-labeled rRNA by
qPCR. Data are shown as mean ± SEM (n = 3).
the proposed ERK site at Ser633 (human numbering), the local sequence
around the proposed p90RSK-regulated site does not match the consensus for these kinases and differs significantly between these species
(see Fig. 4B of [46]). It seems likely that p90RSKs regulate Pol I by
phosphorylating another substrate. Identifying it requires substantial
additional work, which is unfeasible in ARVC. Our observation that
BI-D1870 completely inhibits the PE-activated synthesis of both 18S
and 5S rRNA, while also causing hyperactivation of ERK, shows that
the p90RSKs play a dominant role in controling rRNA synthesis in ARVC.
Since BI-D1870 clearly inhibits the induction of rRNA synthesis
by PE, we asked whether it also interfered with the rapid activation
of protein synthesis by PE. At times up to about 2 h, we have already
shown that this effect is mediated by MEK/ERK signaling [2,5,6]. ARVC
were incubated with or without PE for 24 h; [ 35S]methionine was
added 30 min after PE (where added). BI-D1870 clearly does not impede PE-stimulated protein synthesis; in fact, if anything, it causes an
increase (Suppl. Fig. 4A), perhaps reflecting its ability to enhance ERK
phosphorylation, first reported in [30] and observed in Suppl. Figs. 4B
and Fig. 5B. Thus, at relatively short times up to 24 h, the activation
of protein synthesis by PE presumably reflects control of the activities
of components of the translational machinery (e.g., the initiation
and elongation factors which are rapidly stimulated by PE [2,5]),
rather than increased ribosome content. Indeed, the present data
show that rRNA synthesis is only activated slowly in ARVC. Ribosome
levels do increase at longer times in hypertrophying neonatal
cardiomyocytes [51,52] or in vivo [7] and this effect is presumably
important for the sustained faster rates of protein synthesis that
lead to cardiac hypertrophy.
* p<0.05 Control vs. PE
Ψ P<0.05 PE vs. PE+BI-D1870
Fig. 7. BI-D1870 inhibits the PE-induced recruitment of Pol I to the rRNA promoter.
(A) Scheme showing layout of the rat rDNA promoter and genes, with the nontranscribed, external and internal spacers indicated (NTS, ETS and ITS), and relevant
regions corresponding to the qPCR primers used. (B) ARVC were pre-incubated in
medium containing or lacking BI-D1870 for 1 h and then 10 μmol/L PE was added for
24 h where indicated. 100 μg of cross-linked chromatin was immunoprecipitated
with anti-Pol I antibody or anti-Pol II antibody. The percent (%) total DNA value represents DNA enrichment with the anti-Pol I antibody corrected by subtracting the negative control anti-Pol II bound sample. Pol I binding at rDNA sequences was analysed
by qPCR using primers specific for the indicated regions of the Pol I promoter, and
the values were normalized to the input control. Data are shown as mean ± SEM
(n = 3). The inset shows an ethidium bromide-stained agarose gel of CORE and
GAPDH products amplified after 20 PCR cycles.
3.5. BI-D1870 inhibits the PE-induced recruitment of Pol I to the rRNA
promoter
Since BI-D1870 clearly inhibits the PE-induced synthesis of new
18S rRNA, we used ChIP analysis to ask whether PE promoted the
association of Pol I with the rDNA promoter and whether BI-D1870
affected this. We immunoprecipitated Pol I and used three different
sets of primers (Fig. 7A) to study its association with different parts
of the rDNA promoter. PE greatly enhanced the association of Pol I
with the rRNA promoter and this effect was essentially eliminated by
prior treatment of ARVC with BI-D1870 (Fig. 7B). Similar data were
obtained for each pair of pair of primers, confirming that signaling
through p90RSKs is required for PE-induced recruitment of Pol I to the
45S rRNA promoter. Since PE does not increase UBF levels (Fig. 1D),
these data suggest that PE acutely regulates the function of UBF or
other components of the Pol I transcriptional machinery.
4. Concluding remarks
This is the first study of the signaling events that control rRNA synthesis in adult cardiomyocytes. It shows that the hypertrophic agonist
PE stimulates the synthesis of rRNA in adult rat cardiomyocytes, consistent with much earlier data showing that hypertrophy is associated
with increased cardiac ribosome content and faster ribosome synthesis [7]. We show that PE stimulates the synthesis of both 5S rRNA,
made by Pol III, and 18S rRNA, made by Pol I. It is important to note
146
Z. Zhang et al. / Journal of Molecular and Cellular Cardiology 59 (2013) 139–147
that our data indicate that MEK/ERK/p90 RSK signaling, rather than
signaling through mTORC1, drives rRNA synthesis in response to hypertrophic stimulation of ARVC. This finding both differentiates the
control of rRNA synthesis from other settings where mTORC1 appears
to play a major role [9] and also raises the possibility that this pathway
may also promote rRNA synthesis in other situations, e.g., cancer cells
where the corresponding pathway is activated due to oncogenic mutations in Ras or Raf. We note that p90 RSKs regulate the sodium/proton
exchanger (NHE-1) in cardiomyocytes (reviewed in [53]) and that the
NHE-1 is implicated hypertrophy ([54]). It will be important to investigate the possible role of NHE-1 in regulating rRNA synthesis, e.g., via
alterations in intracellular pH.
Interestingly, just prior to submission of this article, p90RSK3 was
shown to be required for cardiac hypertrophy in neonatal cardiomyocytes
and in vivo in response to pressure overload [55], although the molecular
mechanism(s) underlying its contribution to this process was not
determined. Here, we demonstrate that p90RSKs play a key role in the activation of rRNA synthesis in response to hypertrophic stimulation. Increased ribosome biogenesis is likely to be important for the sustained
increases in protein synthesis that underlie cardiomyocyte growth. Our
data thus appear consistent with the findings from other groups that
p90RSK inhibitors hypertrophy in block neonatal myocytes [42,50,55]. It
is now clearly important to establish how p90RSKs activate rRNA synthesis
in ARVC; insights into this may provide opportunities for intervention
to prevent or reverse cardiac hypertrophy.
Supplementary data to this article can be found online at http://
dx.doi.org/10.1016/j.yjmcc.2013.03.006.
Disclosures
The authors have no conflicts of interest to declare.
Acknowledgments
We are very grateful to Dr. Jelena Mann (Newcastle) for her
invaluable help with the ChIP analyses and to Drs. Justin Kenney
and Xuemin Wang for their invaluable assistance in the preparation
of cardiomyocytes. This work was supported by the British Heart
Foundation through Project Grants 08/099/26124 (PAT and CGP) and
11/18/28824 (CGP).
References
[1] Hannan RD, Jenkins A, Jenkins AK, Brandenburger Y. Cardiac hypertrophy: a matter
of translation. Clin Exp Pharmacol Physiol 2003;30:517–27.
[2] Wang L, Proud CG. Ras/Erk signaling is essential for activation of protein synthesis by
Gq protein-coupled receptor agonists in adult cardiomyocytes. Circ Res 2002;91:
821–9.
[3] Wang L, Gout I, Proud CG. Cross-talk between the ERK and p70 S6 kinase (S6K)
signaling pathways. MEK-dependent activation of S6K2 in cardiomyocytes. J Biol
Chem 2001;276:32670–7.
[4] Wang L, Proud CG. Regulation of the phosphorylation of elongation factor 2
by MEK-dependent signalling in adult rat cardiomyocytes. FEBS Lett 2002;531:
285–9.
[5] Wang L, Proud CG. Regulation of the phosphorylation of elongation factor 2 by
MEK-dependent signalling in adult rat cardiomyocytes. FEBS Lett 2002;531:
285–9.
[6] Rolfe M, McLeod LE, Pratt PF, Proud CG. Activation of protein synthesis in
cardiomyocytes by the hypertrophic agent phenylephrine requires the activation
of ERK and involves phosphorylation of tuberous sclerosis complex 2 (TSC2).
Biochem J 2005;388:973–84.
[7] Morgan HE, Siehl D, Chua BH, Lautensack-Belser N. Faster protein and ribosome synthesis in hypertrophying heart. Basic Res Cardiol 1985;80(Suppl. 2):
115–8.
[8] Morgan HE, Gordon EE, Kira Y, Chua BHL, Russo LA, Peterson CJ, et al. Biochemical
mechanisms of cardiac hypertrophy. Annu Rev Physiol 1987;49:533–43.
[9] Mayer C, Grummt I. Ribosome biogenesis and cell growth: mTOR coordinates transcription by all three classes of nuclear RNA polymerases. Oncogene 2006;25:
6384–91.
[10] Kantidakis T, Ramsbottom BA, Birch JL, Dowding SN, White RJ. mTOR associates
with TFIIIC, is found at tRNA and 5S rRNA genes, and targets their repressor
Maf1. Proc Natl Acad Sci U S A 2010;107:11823–8.
[11] Michels AA, Robitaille AM, Buczynski-Ruchonnet D, Hodroj W, Reina JH, Hall MN,
et al. mTORC1 directly phosphorylates and regulates human MAF1. Mol Cell Biol
2010;30:3749–57.
[12] Goodfellow SJ, Innes F, Derblay LE, MacLellan WR, Scott PH, White RJ. Regulation
of RNA polymerase III transcription during hypertrophic growth. EMBO J 2006;25:
1522–33.
[13] Wang Y, Huang BPH, Luciani DS, Wang X, Johnson JD, Proud CG. Rheb activates
protein synthesis and growth in adult rat ventricular cardiomyocytes. J Mol Cell
Cardiol 2008;45:812–20.
[14] Romeo Y, Zhang X, Roux PP. Regulation and function of the RSK family of protein
kinases. Biochem J 2012;441:553–69.
[15] Wang XM, Levi AJ, Halestrap AP. Kinetics of the sarcolemmal lactate carrier in
single heart cells using BCECF to measure pHi. Am J Physiol 1994;36:H1759–69.
[16] Wang L, Wang X, Proud CG. Activation of mRNA translation in rat cardiac myocytes
by insulin involves multiple rapamycin-sensitive steps. Am J Physiol Heart Circ
Physiol 2000;278:H1056–68.
[17] Iadevaia V, Zhang Z, Jan E, Proud CG. mTOR signaling regulates the processing of
pre-rRNA in human cells. Nucleic Acids Res 2012;40:2527–39.
[18] del SB Valdes R, Mata J, Felipe A, Casado FJ, Pastor-Anglada M. Differential expression and regulation of nucleoside transport systems in rat liver parenchymal and
hepatoma cells. Hepatology 1998;28:1504–11.
[19] Duflot S, Riera B, Fernandez-Veledo S, Casado V, Norman RI, Casado FJ, et al.
ATP-sensitive K(+) channels regulate the concentrative adenosine transporter
CNT2 following activation by A(1) adenosine receptors. Mol Cell Biol 2004;24:
2710–9.
[20] Cleary MD, Meiering CD, Jan E, Guymon R, Boothroyd JC. Biosynthetic labeling
of RNA with uracil phosphoribosyltransferase allows cell-specific microarray
analysis of mRNA synthesis and decay. Nat Biotechnol 2005;23:232–7.
[21] Woodford TA, Schlegel R, Pardee AB. Selective isolation of newly synthesized
mammalian mRNA after in vivo labeling with 4-thiouridine or 6-thioguanosine.
Anal Biochem 1988;171:166–72.
[22] Mann J, Chu DC, Maxwell A, Oakley F, Zhu NL, Tsukamoto H, et al. MeCP2 controls
an epigenetic pathway that promotes myofibroblast transdifferentiation and
fibrosis. Gastroenterology 2010;138:705–14 [714].
[23] Poortinga G, Hannan KM, Snelling H, Walkley CR, Jenkins A, Sharkey K, et al. MAD1
and c-MYC regulate UBF and rDNA transcription during granulocyte differentiation. EMBO J 2004;23:3325–35.
[24] Brandenburger Y, Jenkins A, Autelitano DJ, Hannan RD. Increased expression
of UBF is a critical determinant for rRNA synthesis and hypertrophic growth of
cardiac myocytes. FASEB J 2001;15:2051–3.
[25] Brandenburger Y, Arthur JF, Woodcock EA, Du XJ, Gao XM, Autelitano DJ, et al.
Cardiac hypertrophy in vivo is associated with increased expression of the ribosomal gene transcription factor UBF. FEBS Lett 2003;548:79–84.
[26] Huang M, Wang Y, Cogut SB, Mitchell BS, Graves LM. Inhibition of nucleoside
transport by protein kinase inhibitors. J Pharmacol Exp Ther 2003;304:753–60.
[27] Baldwin SA, Beal PR, Yao SY, King AE, Cass CE, Young JD. The equilibrative nucleoside transporter family, SLC29. Pflugers Arch 2004;447:735–43.
[28] Pende M, Um SH, Mieulet V, Sticker M, Goss VL, Mestan J, et al. S6K1(−/−)/
S6K2(−/−) mice exhibit perinatal lethality and rapamycin-sensitive 5′-terminal
oligopyrimidine mRNA translation and reveal a mitogen-activated protein kinasedependent S6 kinase pathway. Mol Cell Biol 2004;24:3112–24.
[29] Yeh TC, Marsh V, Bernat BA, Ballard J, Colwell H, Evans RJ, et al. Biological characterization of ARRY-142886 (AZD6244), a potent, highly selective mitogen-activated
protein kinase kinase 1/2 inhibitor. Clin Cancer Res 2007;13:1576–83.
[30] Sapkota GP, Cummings L, Newell FS, Armstrong C, Bain J, Frodin M, et al. BI-D1870
is a specific inhibitor of the p90 RSK (ribosomal S6 kinase) isoforms in vitro and
in vivo. Biochem J 2007;401:29–38.
[31] Jastrzebski K, Hannan KM, Tchoubrieva EB, Hannan RD, Pearson RB. Coordinate
regulation of ribosome biogenesis and function by the ribosomal protein S6 kinase,
a key mediator of mTOR function. Growth Factors 2007;25:209–26.
[32] Feldman ME, Apsel B, Uotila A, Loewith R, Knight ZA, Ruggero D, et al. Active-site
inhibitors of mTOR target rapamycin-resistant outputs of mTORC1 and mTORC2.
PLoS Biol 2009;7:e38.
[33] Wang X, Beugnet A, Murakami M, Yamanaka S, Proud CG. Distinct signaling events
downstream of mTOR cooperate to mediate the effects of amino acids and insulin
on initiation factor 4E-binding proteins. Mol Cell Biol 2005;25:2558–72.
[34] Thoreen CC, Kang SA, Chang JW, Liu Q, Zhang J, Gao Y, et al. An ATP-competitive
mTOR inhibitor reveals rapamycin-insensitive functions of mTORC1. J Biol Chem
2009;284:8023–32.
[35] Choo AY, Yoon SO, Kim SG, Roux PP, Blenis J. Rapamycin differentially inhibits
S6Ks and 4E-BP1 to mediate cell-type-specific repression of mRNA translation.
Proc Natl Acad Sci U S A 2008;105:17414–9.
[36] Hoppe S, Bierhoff H, Cado I, Weber A, Tiebe M, Grummt I, et al. AMP-activated
protein kinase adapts rRNA synthesis to cellular energy supply. Proc Natl Acad
Sci U S A 2009;106:17781–6.
[37] Dokladda K, Green KA, Pan DA, Hardie DG. PD98059 and U0126 activate
AMP-activated protein kinase by increasing the cellular AMP:ATP ratio and not
via inhibition of the MAP kinase pathway. FEBS Lett 2005;579:236–40.
[38] Moore CE, Xie J, Gomez E, Herbert TP. Identification of cAMP-dependent kinase
as a third in vivo ribosomal protein S6 kinase in pancreatic beta-cells. J Mol Biol
2009;389:480–94.
[39] Sebolt-Leopold JS, Dudley DT, Herrera R, Becelaere KV, Wiland A, Gowan RC, et al.
Blockade of the MAP kinase pathway suppresses growth of colon tumors in vivo.
Nat Med 1999;5:810–6.
[40] Anjum R, Blenis J. The RSK family of kinases: emerging roles in cellular signalling.
Nat Rev Mol Cell Biol 2008;9:747–58.
Z. Zhang et al. / Journal of Molecular and Cellular Cardiology 59 (2013) 139–147
[41] Fonseca BD, Alain T, Finestone LK, Huang BP, Rolfe M, Jiang T, et al. Pharmacological
and genetic evaluation of proposed roles of mitogen-activated protein kinase/
extracellular signal-regulated kinase kinase (MEK), extracellular signal-regulated
kinase (ERK), and p90RSK in the control of mTORC1 protein signaling by phorbol
esters. J Biol Chem 2011;286:27111–22.
[42] Amirak E, Fuller SJ, Sugden PH, Clerk A. p90 ribosomal S6 kinases play a significant
role in early gene regulation in the cardiomyocyte response to Gq protein-coupled
receptor stimuli, endothelin-1 and alpha1-adrenergic receptor agonists. Biochem J
2012;450:351–63.
[43] Chen S, MacKintosh C. Differential regulation of NHE1 phosphorylation and glucose uptake by inhibitors of the ERK pathway and p90RSK in 3T3-L1 adipocytes.
Cell Signal 2009;21:1984–93.
[44] Smith JA, Poteet-Smith CE, Xu Y, Errington TM, Hecht SM, Lannigan DA. Identification of the first specific inhibitor of p90 ribosomal S6 kinase (RSK) reveals an unexpected role for RSK in cancer cell proliferation. Cancer Res 2005;65:1027–34.
[45] Bain J, Plater L, Elliott M, Shpiro N, Hastie CJ, McLauchlan H, et al. The selectivity of
protein kinase inhibitors: a further update. Biochem J 2007;408:297–315.
[46] Zhao J, Yuan X, Frodin M, Grummt I. ERK-dependent phosphorylation of the transcription initiation factor TIF-IA is required for RNA polymerase I transcription
and cell growth. Mol Cell 2003;11:405–13.
[47] Ballif BA, Roux PP, Gerber SA, Mackeigan JP, Blenis J, Gygi SP. Quantitative phosphorylation profiling of the ERK/p90 ribosomal S6 kinase-signaling cassette and
its targets, the tuberous sclerosis tumor suppressors. Proc Natl Acad Sci U S A
2005;102:667–72.
147
[48] Carriere A, Cargnello M, Julien LA, Gao H, Bonneil E, Thibault P, et al. Oncogenic
MAPK signaling stimulates mTORC1 activity by promoting RSK-mediated raptor
phosphorylation. Curr Biol 2008;18:1269–77.
[49] Roux PP, Ballif BA, Anjum R, Gygi SP, Blenis J. Tumor-promoting phorbol
esters and activated Ras inactivate the tuberous sclerosis tumor suppressor
complex via p90 ribosomal S6 kinase. Proc Natl Acad Sci U S A 2004;101:
13489–94.
[50] Li T, Liu Z, Hu X, Ma K, Zhou C. Involvement of ERK-RSK cascade in phenylephrineinduced phosphorylation of GATA4. Biochim Biophys Acta 1823;2012:582–92.
[51] Allo SN, McDermott PJ, Carl LL, Morgan HE. Phorbol ester stimulation of protein
kinase C activity and ribosomal DNA transcription. Role in hypertrophic growth
of cultured cardiomyocytes. J Biol Chem 1991;266:22003–9.
[52] McDermott PJ, Rothblum LI, Smith SD, Morgan HE. Accelerated rates of ribosomal
RNA synthesis during growth of contracting heart cells in culture. J Biol Chem
1989;264:18220–7.
[53] Avkiran M, Cook AR, Cuello F. Targeting Na+/H+ exchanger regulation for cardiac
protection: a RSKy approach? Curr Opin Pharmacol 2008;8:133–40.
[54] Kilic A, Javadov S, Karmazyn M. Estrogen exerts concentration-dependent
pro-and anti-hypertrophic effects on adult cultured ventricular myocytes.
Role of NHE-1 in estrogen-induced hypertrophy. J Mol Cell Cardiol 2009;46:
360–9.
[55] Li J, Kritzer MD, Michel JJ, Le A, Thakur H, Gayanilo M, et al. Anchored p90
ribosomal S6 kinase 3 is required for cardiac myocyte hypertrophy. Circ Res
2013;112:128–39.