Am J Physiol Lung Cell Mol Physiol 285: L829–L837, 2003.
First published June 13, 2003; 10.1152/ajplung.00054.2003.
Norepinephrine transport by the extraneuronal monoamine
transporter in human bronchial arterial smooth muscle cells
Gabor Horvath,1,3 Zoltan Sutto,1,3 Aliza Torbati,2
Gregory E. Conner,1,2 Matthias Salathe,1 and Adam Wanner1
1
Division of Pulmonary and Critical Care Medicine and 2Department of Cell Biology
and Anatomy, University of Miami School of Medicine, Miami, Florida 33133;
and 3Department of Respiratory Medicine, Semmelweis University, Budapest, Hungary
Submitted 27 February 2003; accepted in final form 5 June 2003
Address for reprint requests and other correspondence: A. Wanner, Div. of Pulmonary and Critical Care Medicine, University of
Miami School of Medicine, PO Box 016960 (R-47), Miami, FL 33101
(E-mail: [email protected]).
The costs of publication of this article were defrayed in part by the
payment of page charges. The article must therefore be hereby
marked ‘‘advertisement’’ in accordance with 18 U.S.C. Section 1734
solely to indicate this fact.
vasoconstriction; glucocorticosteroids; budesonide;
genomic; plasma membrane binding site
non-
NOREPINEPHRINE
http://www.ajplung.org
1040-0605/03 $5.00 Copyright © 2003 the American Physiological Society
L829
Downloaded from http://ajplung.physiology.org/ by 10.220.32.246 on June 18, 2017
(NE), released from airway sympathetic nerve endings, mediates vasoconstriction in the
tracheobronchial circulation (4). NE acts largely via
postjunctional ␣1-adrenoreceptors on bronchial vascular smooth muscle cells (SMC). The NE concentration
and duration at its receptor determine the extent of
neurogenic vasoconstriction. Because NE is metabolically stable in the extracellular space (i.e., the metabolizing enzymes are localized intracellularly) and because NE cannot freely diffuse through membranes,
the NE concentration at postjunctional ␣1-adrenoreceptors is largely dependent on the rates of release,
neuronal reuptake [uptake1, or cocaine-sensitive uptake (36)], and extraneuronal uptake [uptake2, or steroid-sensitive uptake (7)]. In contrast to other tissues
where uptake1 predominates (7), NE removal from the
extracellular space in the airways by uptake2 is five
times greater than removal by uptake1 (31), possibly
because of the relatively sparse sympathetic innervation (6). Inhibition of uptake2 in the airways is therefore expected to increase overall sympathetic tone and
cause local vasoconstriction, in keeping with observations of uptake2 inhibition in other vascular beds (9,
19, 21, 27).
We previously showed that human tracheobronchial
blood flow decreases in response to ␣1-adrenergic stimulation in vivo (2) and that inhaled glucocorticosteroids
(GSs) cause an acute, ␣1-adrenoreceptor-mediated bronchial vasoconstriction (20, 26). This GS-mediated vasoconstriction occurred too rapidly to be due to the “classic,” transcriptional steroid effect (1, 23), suggesting that
GSs exert this vasoconstrictive effect via a nongenomic
action (39). In search of such a nongenomic action, we
previously showed that GSs inhibit NE uptake by rabbit
aortic SMC in a membrane-dependent fashion and that
rabbit aortic SMC express mRNA of the GS-sensitive,
extraneuronal monoamine transporter [EMT, or organic
cation transporter 3 (OCT-3)] (12, 15). Preliminary
observations in human bronchial arterial SMC showed
that these cells also exhibit GS-sensitive NE uptake
and express EMT mRNA (15). These findings suggested that inhaled GSs could cause bronchial vasoconstriction by acutely interfering with NE uptake into
bronchial vascular SMC, but the process remained to
be carefully characterized in human cells.
Horvath, Gabor, Zoltan Sutto, Aliza Torbati, Gregory E. Conner, Matthias Salathe, and Adam Wanner.
Norepinephrine transport by the extraneuronal monoamine
transporter in human bronchial arterial smooth muscle cells.
Am J Physiol Lung Cell Mol Physiol 285: L829–L837, 2003.
First published June 13, 2003; 10.1152/ajplung.00054.2003.—
Inhaled glucocorticosteroids (GSs) cause acute, ␣1-adrenoreceptor (AR)-mediated bronchial vasoconstriction. After release
from sympathetic nerves, norepinephrine (NE) must be taken
up into cells for deactivation by intracellular enzymes. Because
postsynaptic cellular NE uptake is steroid sensitive, GSs could
increase NE concentrations at ␣1-AR, causing vasoconstriction.
We therefore evaluated mRNA expression of different NE
transporters in human bronchial arterial smooth muscle and
pharmacologically characterized NE uptake into these cells.
RT-PCR demonstrated mRNA expression of the extraneuronal
monoamine transporter (EMT) and organic cation transporter 1
(OCT-1). Fluorometric uptake assay showed time (within minutes)- and concentration-dependent NE uptake by freshly isolated bronchial arterial smooth muscle cells (SMC) with an
estimated Km of 240 ␮M. Corticosterone and O-methylisoprenaline (1 ␮M each), but not desipramine, inhibited NE uptake, a
profile indicative of NE uptake by EMT, but not OCT-1. Budesonide and methylprednisolone inhibited uptake with IC50 values of 0.9 and 5.6 ␮M, respectively. Corticosterone’s action was
reversible and not sensitive to RU-486 (GS receptor antagonist),
actinomycin D (transcription inhibitor), or cycloheximide (protein synthesis inhibitor). Corticosterone made membrane impermeant by coupling to BSA also blocked NE uptake. Immunocytochemistry indicated a specific membrane binding site for
corticosterone on bronchial arterial SMC. These data demonstrate that although human bronchial arterial SMC express
OCT-1 and EMT, EMT is the predominant plasma membrane
transporter for NE uptake. This process can be inhibited by
GSs, likely via a specific membrane binding site. This nongenomic GS action (increasing NE concentrations at ␣1-AR)
could explain acute bronchial vasoconstriction caused by inhaled GSs.
L830
NE TRANSPORT BY EMT IN BRONCHIAL ARTERIAL SMOOTH MUSCLE
The present investigation was designed to expand
our preliminary human data by carefully characterizing NE uptake into freshly isolated human bronchial
arterial SMC and determining mRNA expression profiles of different known NE transporters in these cells.
Furthermore, we studied whether the inhibitory effect
on NE uptake by corticosterone is also applicable to
GSs used in the treatment of airway diseases. Finally,
using immunocytochemistry, we examined the presence of a specific plasma membrane binding site for
corticosterone in human bronchial arterial SMC.
MATERIALS AND METHODS
Table 1. Oligonucleotide primers, annealing temperatures, and cycle numbers for RT-PCR amplifications of
NE transporter and GAPDH mRNAs
Forward Primer
Reverse Primer
mRNA
Sequence
Position
Sequence
Position
Tm, °C
Cycles
Size, bp
NET
OCT-1
OCT-2
EMT
GAPDH
ggccacggtatggattgatgc
ggctggctacaccctaatcacag
gtacaactggttcacgagctctg
ctgggtggtccctgagtctcc
cctgcaccaccaactgcttag
961–981
759–781
1226–1248
882–902
527–547
cctcccattgagctgtcaagg
agtccgtgaaccacaggtacatc
cgccaagattcctaatgaatgtggg
tcccaggcgcatgacaagtcc
gcctgcttcaccaccttcttg
1317–1297
1177–1155
1569–1545
1146–1126
869–849
60
60
60
61
60
36
30
30
26
24
357
419
344
265
343
NET, neuronal epinephrine transporter; OCT-1 and OCT-2, organic cation transporter-1 and -2; EMT, extraneuronal monoamine
transporter; Tm, annealing temperature; NE, norepinephrine.
AJP-Lung Cell Mol Physiol • VOL
285 • OCTOBER 2003 •
www.ajplung.org
Downloaded from http://ajplung.physiology.org/ by 10.220.32.246 on June 18, 2017
Materials. All media and agents were obtained from Sigma-Aldrich (St. Louis, MO) unless otherwise noted.
Human bronchial arterial SMC isolation. Donor lungs,
rejected for transplantation, were obtained through the University of Miami Life Alliance Organ Recovery Agency with
approval from the local Institutional Review Board. Donors
had no history of lung diseases and were not preselected on
the basis of their age or gender. Lungs obtained from at least
three different donors were used for each experiment. Major
branches of bronchial arteries from the main bronchi (⬃0.5–
1 mm diameter) were excised using a dissecting stereomicroscope under sterile conditions. To confirm that the dissected
structure was, in fact, an artery (thick muscular wall and
narrow lumen), a small portion of each vessel was fixed in 4%
formaldehyde buffered with PBS, processed according to regular procedures for histology, and stained with hematoxylin
and eosin. The rest of the vessel was dissected from adhering
fat and connective tissue and opened longitudinally. Endothelial cells were removed by scraping the inside surface.
From this muscle preparation, strips were cut transversely
and immediately used for RNA extraction (see below) or cell
isolation. SMC were isolated as described previously (15, 16),
with some modifications. Briefly, muscle strips were transferred to a constantly oxygenated incubation solution (137
mM NaCl, 4.17 mM NaHCO3, 0.34 mM NaH2PO4, 5.37 mM
KCl, 0.44 mM KH2PO4, 7 mM glucose, 0.15 mM CaCl2, 2 mM
MgCl2, 10 mM HEPES, 0.02% BSA, pH 7.4) containing papain (1.5 mg/ml) and 2 mM DTT and incubated at 37°C for 30
min with shaking. Then the muscle strips were transferred to
a constantly oxygenated incubation solution containing collagenase type F (1.5 mg/ml) and hyaluronidase type I-S (1
mg/ml) and incubated at 37°C for an additional 20 min with
shaking. At the end of the digestion period, individual SMC
were obtained by gentle tituration, followed by filtration
through a 500-␮m sieve. Finally, cells were collected by
centrifugation at 1,000 g for 3 min and resuspended in fresh
(enzyme free) incubation solution. The viability of freshly
isolated SMC after enzymatic dispersion was always ⬎95%
as tested by trypan blue exclusion. The SMC suspension was
deposited onto human placental collagen (type VI)-coated
glass coverslips. Cells were allowed to settle for 60 min at
37°C before NE uptake experiments.
Cell culture techniques. For immunochemical detection of a
corticosterone binding site, bronchial arterial SMC were
maintained for 3 days in DMEM (Life Technologies, Rockville, MD) supplemented with 10% FBS, penicillin (100
U/ml), and streptomycin (100 ␮g/ml) within a humidified
atmosphere containing 5% CO2 at 37°C. This was necessary
because acutely dissociated cells did not sufficiently adhere
to the coverslips to withstand the staining process, and they
were lost during the immunocytochemical procedure. The
3-day-cultured cells still revealed corticosterone-dependent
NE uptake similar to the freshly isolated cells.
To provide a positive control sample for RT-PCR optimization of EMT mRNA, human renal carcinoma-derived Caki-1
cells were purchased from the American Type Culture Collection (Manassas, VA). Caki-1 cells were cultured in McCoy’s 5A medium (American Type Culture Collection) supplemented with 10% FBS, penicillin (100 U/ml), and streptomycin (100 ␮g/ml) in a humidified atmosphere containing 5%
CO2 at 37°C. Media were changed every other day.
Airway epithelial cell air-liquid interface cultures were
prepared as described previously (22).
RT-PCR analysis of mRNA expression of NE transporters.
NE transporter expression was determined in bronchial arterial smooth muscle and compared with expression in
Caki-1 cells, airway epithelium, and brain, liver, and kidney
tissues. Total RNA was extracted from freshly isolated bronchial arterial smooth muscle as well as cultured Caki-1 and
airway epithelial cells using the RNeasy Protect Mini Kit
(Qiagen, Valencia, CA). RNA samples were treated with
DNase (DNase I Amplification Grade, Life Technologies),
precipitated with ethanol, and quantified spectrophotometrically at 260 nm. Good quality of isolated RNA (28S-to-8S
rRNA ratio ⬎ 1.75) was confirmed using an RNA 6000 LabChip Kit (Agilent Technologies, Palo Alto, CA) and a bioanalyzer (model 2100, Agilent Technologies) provided by the
University of Miami DNA Microarray Facility. Total RNA
samples from human brain, liver, and kidney were purchased
from Ambion (Austin, TX). RNA (1 ␮g per sample) was used
for first-strand cDNA synthesis with Superscript II RT (Life
Technologies) using oligo-(dT)16 primers. For PCR amplification, oligonucleotide primers were designed on the basis of
the published sequences of neuronal epinephrine transporter
(NET; GenBank NM_001043), organic cation transporters 1
and 2 (OCT-1 and OCT-2; GenBank NM_003057 and GenBank NM_003058), extraneuronal monoamine transporter
(EMT; GenBank NM_021977), and GAPDH (GenBank
NM_002046) cDNAs (Table 1). PCR amplifications were done
using Taq DNA polymerase (Life Technologies) using opti-
NE TRANSPORT BY EMT IN BRONCHIAL ARTERIAL SMOOTH MUSCLE
AJP-Lung Cell Mol Physiol • VOL
mental group was calculated using the mean normalized Fn
of all cells. Because we have shown that the intracellular
fluorescence is nearly linear to the intracellular NE concentration over a wide concentration range (15), we chose to
report here the fluorescence in arbitrary units and only
convert the values to NE concentration for the Km determination of NE uptake.
Immunochemical detection of a plasma membrane binding
site for corticosterone in bronchial arterial SMC. Cells maintained on collagen-coated coverslips for 3 days were washed
three times with PBS and incubated with 1 ␮M BSA, 1 ␮M
corticosterone-21-hemisuccinate-BSA, or 1 ␮M corticosterone-21-hemisuccinate-BSA ⫹ 100 ␮M corticosterone for 5
min at 37°C. Then the cells were fixed with 4% paraformaldehyde buffered with PBS for 30 min at room temperature.
Fixed cells were washed with PBS containing 200 ␮g/ml goat
IgG (blocking buffer) and incubated with blocking buffer for
60 min at room temperature. The cells were washed with
blocking buffer and then incubated with rabbit anti-BSA IgG
primary antibody (10 ␮g/ml; Molecular Probes, Eugene, OR)
for 60 min at room temperature. After they were washed
again with blocking buffer, the cells were incubated with a
tetramethylrhodamine isothiocyanate (TRITC)-conjugated
goat anti-rabbit IgG secondary antibody (20 ␮g/ml) for 60
min at room temperature. After being washed with PBS and
mounted in permanent aqueous mounting medium (Gel/
Mount, Biomedia, Foster City, CA), cells were visualized on
the Nikon Eclipse E600FN microscope described above, and
TRITC fluorescence was imaged using an appropriate excitation-emission filter set.
Data analysis and statistical methods. Uptake experiments
were carried out in triplicate with measurements on 25–50 cells
each. Values are means ⫾ SE. For time-course analysis of NE
uptake, the data were fit with nonlinear regression methods
using Prism version 3.0a (GraphPad Software, San Diego, CA)
with the following equations: A(t) ⫽ kin/kout ⴱ (1 ⫺ e⫺kout ⴱ t),
where A(t) is uptake of NE at time t, kin and kout are rate
constants for inward and outward transport, respectively, and t
is incubation time. The variables for the fit were kin and kout
and, thus, were determined during the fitting procedure.
Km was determined with a nonlinear regression fit (Prism)
using the following equation: y ⫽ (Vmax ⴱ x)/(Km ⫹ x), where
y is uptake of x amount of NE. Again Vmax was a variable of
the fitting procedure.
For IC50 calculations, the data were fit to a multisite
inhibition model (Prism) using the following equation: y ⫽
inhibitionmax ⫹ (inhibitionmin ⫺ inhibitionmax)/(1 ⫹
10(logIC50⫻Hill slope)), where y is the effect of x amount of the
inhibitor.
Statistical significance was determined with an unpaired
Student’s t-test for comparison of two groups and ANOVA
followed by the post hoc Tukey-Kramer honestly significant
difference test for multiple groups. P ⬍ 0.05 was considered
significant.
RESULTS
NE transporter mRNA expression. Because nonneuronal cells may express various and/or multiple transport systems for NE, RT-PCR was used as described in
MATERIALS AND METHODS to examine the presence of neuronal [NET (29)] and nonneuronal [OCT-1 (11), OCT-2
(28), and EMT] transporter mRNAs. On the basis of
the published expression data, human brain, liver,
kidney, and Caki-1 cell mRNA samples were used to
optimize the RT-PCR for NET, OCT-1, OCT-2, and
285 • OCTOBER 2003 •
www.ajplung.org
Downloaded from http://ajplung.physiology.org/ by 10.220.32.246 on June 18, 2017
mized annealing temperatures and cycle numbers for each
primer pair (Table 1). RT-PCR products were electrophoresed
on ethidium bromide-stained 2% SeaKem agarose (BMA,
Rockland, ME) gels. Control reactions were performed in the
absence of RT to verify that the amplified products were from
mRNA, and not from genomic DNA contamination. In the
absence of RT, no PCR products were observed. To confirm
specific amplification, RT-PCR products were purified on a
silica spin column (Qiaquick PCR Purification Kit, Qiagen)
and sequenced by the University of Miami DNA Core
Laboratory. Sequences were compared with the published
cDNA sequences by PileUp (Wisconsin Package, GCG, Madison, WI).
NE uptake experiments. For NE uptake studies, coverslips
with SMC were placed in 12-well cell culture clusters (Corning, Corning, NY), and the cells were exposed to incubation
solution containing NE with or without different NE transporter inhibitors (see below) in a humidified atmosphere
containing 5% CO2 at 37°C. To inhibit the intracellular
NE-metabolizing enzymes, 500 ␮M pargyline (a monoamine
oxidase inhibitor) (14) and 1 ␮M Ro-41-0960 (a catecholamine-O-methyltransferase inhibitor) (30) were added to the
incubation solution 30 min before the NE uptake experiments. The following inhibitors were used: 1 ␮M desipramine, which inhibits only NET (Ki ⫽ 4 nM) (3), 1 ␮M corticosterone, which inhibits OCT-1, OCT-2, and EMT (IC50 ⫽
21.7, 34.2, and 0.29 ␮M, respectively) (3, 25, 33), or 1 ␮M
O-methylisoprenaline (Boehringer Ingelheim), which inhibits OCT-2 (Ki ⫽ 580 ␮M) and EMT (IC50 ⫽ 4.38 ␮M), but not
OCT-1 (10, 33). GSs, such as corticosterone, budesonide, and
methylprednisolone, were dissolved in ethanol and freshly
diluted into the incubation solution just before use. The final
concentration of ethanol was 0.1%, a concentration with no
significant effect on NE uptake measurements as confirmed
in control experiments using this vehicle only.
Fluorometric NE uptake assay. At the end of the incubation period, SMC were washed with ice-cold incubation solution. Intracellular NE was visualized using a sucrose-potassium phosphate-glyoxylic acid (SPG) method described for
tissue slices (37) and adapted by us for use in isolated
vascular SMC (15, 16). Briefly, coverslips with SMC were
washed with SPG solution (0.2 M sucrose, 236 mM KH2PO4,
1% glyoxylic acid monohydrate, pH 7.4) at room temperature.
After they were air-dried for 5 min, the specimen was covered
with a drop of light mineral oil. Then the sample was sealed
with a coverslip and placed in an oven at 95°C for 2.5 min. To
quantify fluorescence, a microscope (Eclipse E600FN, Nikon,
Melville, NY) with a Lambda DG-4 excitation system (Sutter
Instruments, Novato, CA), a cooled charge coupled device
camera (Coolsnap HQ, Roper Scientific), and ISee software
(ISee Imaging Systems, Raleigh, NC) were used. Cells were
imaged at ⫻600 magnification with differential interference
contrast microscopy, and individual cells were identified as
regions of interest. For quantification of the SPG fluorescence
(or intracellular NE concentration) in these cells (or regions
of interest), a 10-nm-wide filter centered on 405 nm was used
for excitation, and the emission was measured at ⬎455 nm
using a long-pass filter (emission maximum 480 nm), integrating the signal for 1 s. The cooled charge coupled device
camera was always set to a predefined gain, which was held
constant throughout the experiments. SMC fluorescence was
measured by selecting five well-separated regions on each
coverslip (5–10 cells per region). Each single cell’s mean
fluorescence intensity value (Fn), expressed in arbitrary
units, was normalized for background fluorescence by subtracting the mean Fn of SMC from the same tissue that had
not been exposed to NE. Average NE uptake of each experi-
L831
L832
NE TRANSPORT BY EMT IN BRONCHIAL ARTERIAL SMOOTH MUSCLE
EMT mRNAs, respectively. Gel electrophoresis of the
RT-PCR products for these samples showed bands of
expected sizes (Fig. 1). Gel purification and sequence
analysis confirmed that these amplicons were fragments of the corresponding NE transporter cDNAs.
The isolated fragments contained only exon sequences
(from ⱖ3 different exons for each), confirming the amplification of mRNA, rather than genomic sequences.
Interestingly, brain and kidney expressed mRNA for
every neuronal and nonneuronal NE transporter,
whereas Caki-1 cells expressed only mRNA for every
nonneuronal NE transporter. In addition to the previously reported mRNA expression of EMT (15), only
OCT-1 mRNA was detectable in human bronchial arterial smooth muscle. The possibility of EMT and
OCT-1 mRNA amplifications from cells other than
bronchial arterial smooth muscle (e.g., endothelial cells
Fig. 2. Time and concentration dependence of
NE uptake by human bronchial arterial smooth
muscle cells (SMC). A: cells were exposed to 50
␮M NE-containing incubation medium for 0–90
min. F, EMT-mediated NE uptake; E, non-EMTmediated NE uptake. EMT-mediated uptake was
defined as amount of uptake inhibited by 10 ␮M
corticosterone. B: EMT-mediated NE uptake
rates (v) calculated from the 5-min time point
and plotted against NE concentrations. F, fluorescence (in arbitrary units). Lines were fitted to
experimental data using nonlinear regression
methods. Values are means ⫾ SE for triplicate
experiments with 25–50 cells each.
AJP-Lung Cell Mol Physiol • VOL
285 • OCTOBER 2003 •
www.ajplung.org
Downloaded from http://ajplung.physiology.org/ by 10.220.32.246 on June 18, 2017
Fig. 1. RT-PCR analysis of norepinephrine (NE) transporter mRNA
expression. With use of primers and conditions listed in Table 1,
RT-PCR products were electrophoresed on ethidium bromide-stained
2% agarose gels. Gel purification and DNA sequencing were used to
confirm specific amplification of neuronal epinephrine transporter
(NET), organic cationic transporters 1 and 2 (OCT-1 and OCT-2),
extraneuronal monoamine transporter (EMT), and GAPDH cDNAs.
Starting RNA was from human brain, liver, kidney, Caki-1 cells,
bronchial arterial smooth muscle (BASM), and airway epithelial
cells (AEC) cultured at the air-liquid interface.
and neurons) is unlikely because these cells are expressing NET mRNA (29), which was not detected (Fig.
1). Cultured airway epithelial cells expressed neuronal
and nonneuronal (OCT-1 and EMT) transporters for NE.
NE uptake characteristics in bronchial arterial SMC.
Because rabbit aortic and human bronchial arterial
SMC showed steroid-sensitive NE uptake in our prior
study (15) and because our new RT-PCR data indicated
that EMT and OCT-1 mRNAs are expressed in human
bronchial arterial SMC, NE uptake was measured in
these cells in the absence or presence of 10 ␮M corticosterone. This concentration of corticosterone was
chosen to inhibit EMT, but not other OCTs, in a significant amount (13; see also below). The amount of
uptake inhibited by 10 ␮M corticosterone was defined
as EMT mediated.
To show first that NE uptake into human bronchial
arterial SMC is a time-dependent phenomenon, cells
were incubated in 50 ␮M NE with and without 10 ␮M
corticosterone for 5, 15, 30, 45, and 90 min. NE uptake
was detectable after 5 min and increased in a timedependent fashion for 45 min (Fig. 2A). The concentration dependence was evaluated by incubating the cells
in 25, 50, 250, and 1,000 ␮M NE with and without 10
␮M corticosterone for 5 min. EMT-mediated uptake
appeared to saturate (Fig. 2B). The calculated Km for
NE uptake was 240 ␮M. This is close to the Km of 245
␮M calculated for NE uptake into rabbit aortic SMC
(15), a process likely mediated by EMT (16, 33).
The NE uptake inhibition by 10 ␮M corticosterone as
well as the calculated Km for NE uptake suggested that
EMT played the major part in NE uptake into human
bronchial arterial SMC. To support this hypothesis,
the pharmacological inhibitor profile of NE uptake was
further investigated. In these experiments, SMC were
exposed to 50 ␮M NE for 5 min without or with 1 ␮M
desipramine, which inhibits only NET (Ki ⫽ 4 nM) (3),
1 ␮M corticosterone, which inhibits OCT-1, OCT-2, and
EMT (IC50 ⫽ 21.7, 34.2, and 0.29 ␮M, respectively)
(33), or 1 ␮M O-methylisoprenaline, which inhibits
OCT-2 (Ki ⫽ 580 ␮M) and EMT (IC50 ⫽ 4.38 ␮M), but
not OCT-1 (13, 33). Control experiments showed that
these inhibitors did not affect the fluorometric assay at
NE TRANSPORT BY EMT IN BRONCHIAL ARTERIAL SMOOTH MUSCLE
Fig. 3. Effects of NE transporter inhibitors on NE uptake by human
bronchial arterial SMC. Cells were exposed to 50 ␮M NE for 5 min
without (control) or with 1 ␮M desipramine (DESI) to inhibit NET, 1
␮M corticosterone (CORT) to inhibit EMT, or 1 ␮M O-methylisoprenaline (OMI) to inhibit EMT. Values are means ⫾ SE for triplicate experiments with 25–50 cells each. *P ⬍ 0.05 vs. control.
AJP-Lung Cell Mol Physiol • VOL
Fig. 4. Inhibition of NE uptake by glucocorticosteroids in human
bronchial arterial SMC. Cells were exposed to 50 ␮M NE for 5 min in
the presence of corticosterone, budesonide, or methylprednisolone.
Data are shown as a percentage of NE uptake measured in the
absence of inhibitors. Values are means ⫾ SE for triplicate experiments with 25–50 cells each.
64.8 ⫾ 5.6%, respectively (in duplicate experiments,
P ⬎ 0.05 vs. corticosterone alone for both). Because
budesonide and methylprednisolone did not further
increase the inhibition induced by corticosterone, these
data suggest that these compounds also act on EMT.
EMT inhibition by corticosterone is a nongenomic
effect. Because NE uptake into rabbit aortic SMC is
mediated by a nongenomic action of GSs, independent
of transcription, protein synthesis, and membrane penetration of the drug (15), we repeated these experiments with human bronchial arterial SMC. In addition, using freshly dissociated human bronchial arterial SMC, we examined reversibility of the
corticosterone effect and its dependence on the classical, intracellular GS receptor.
To investigate reversibility, human bronchial arterial SMC were exposed to 1 ␮M corticosterone for 5
min, which blocked NE uptake by ⬃65% in our experiments (see above). Then the cells were transferred to a
corticosterone-free medium containing 50 ␮M NE for
uptake measurements. There was no significant difference in NE uptake between SMC pretreated with corticosterone but washed and control cells not exposed to
corticosterone (17.1 ⫾ 2.2 vs. 21.1 ⫾ 0.9 arbitrary units
in triplicate experiments with 25–50 cells each, P ⬎
0.05; Fig. 5A). Thus the inhibition of NE uptake by
corticosterone is reversible after removal of the GS.
To show that the classic genomic pathway (i.e., binding to cytoplasmic receptors followed by changes in
transcription and protein synthesis of target genes)
was not involved in corticosterone’s rapid action, 10
␮M RU-486 (a cytoplasmic GS receptor antagonist),
100 ␮M actinomycin D (a transcription inhibitor), or 10
␮M cycloheximide (a protein synthesis inhibitor) was
added to the incubation medium 30 min before the
addition of 50 ␮M NE and 1 ␮M corticosterone. Control
experiments showed that RU-486, actinomycin D, or
cycloheximide by themselves did not inhibit NE uptake
at the concentrations used. Corticosterone inhibited
285 • OCTOBER 2003 •
www.ajplung.org
Downloaded from http://ajplung.physiology.org/ by 10.220.32.246 on June 18, 2017
the concentrations used. (It was necessary to use Omethylisoprenaline below its reported IC50 for EMT,
because its autofluorescence interfered with the assay
at higher concentrations.) Desipramine did not decrease NE uptake significantly (the decrease was only
4.2 ⫾ 5.7% in triplicate experiments with 25–50 cells
each, P ⬎ 0.05 vs. control), whereas corticosterone and
O-methylisoprenaline inhibited NE uptake by 63.2 ⫾
6.9 and 57.8 ⫾ 2.9%, respectively (in triplicate experiments with 25–50 cells each, P ⬍ 0.05 vs. control for
both; Fig. 3). Together with NE transport kinetics data
(see above), these inhibitor characteristics suggest that
the majority of NE uptake is mediated by EMT.
Inhibition of NE uptake by different GSs. Because
inhaled and systemic drug administration can expose
the bronchial arterial smooth muscle to GSs, we investigated the effects of budesonide and methylprednisolone on NE uptake by bronchial arterial SMC.
Similar to corticosterone, budesonide and methylprednisolone inhibited NE uptake after 5 min of incubation
(Fig. 4). The inhibitory potency was ranked in the
following order: corticosterone ⬎ budesonide ⬎ methylprednisolone. These compounds inhibited EMT-mediated uptake (i.e., with only the amount of uptake that
is inhibited by 10 ␮M corticosterone taken into account) with apparent IC50 values of 0.2 ␮M (close to the
reported IC50 of 0.29 ␮M for EMT in other cells), 0.9
␮M, and 5.6 ␮M, respectively.
To investigate whether the combination of budesonide and methylprednisolone inhibited NE uptake
differently from each single inhibitor, bronchial arterial SMC were exposed to these compounds and 50 ␮M
NE for 5 min in the presence of 1 ␮M corticosterone
(which, by itself, almost completely inhibits EMT-mediated uptake). Because 10 ␮M budesonide and 30 ␮M
methylprednisolone alone caused the same degree of
NE uptake inhibition, these concentrations were used
for the experiments. In the presence of 1 ␮M corticosterone and 10 ␮M budesonide or 30 ␮M methylprednisolone, NE uptake was inhibited by 61.2 ⫾ 8.2 and
L833
L834
NE TRANSPORT BY EMT IN BRONCHIAL ARTERIAL SMOOTH MUSCLE
NE uptake by 66.7 ⫾ 12.4, 62.1 ⫾ 6.8, and 69.4 ⫾
11.6% in the presence of RU-486, actinomycin D, or
cycloheximide, respectively (in triplicate experiments
with 25–50 cells each, P ⬍ 0.05 vs. control for all, P ⬎
0.05 vs. corticosterone treated; Fig. 5B). Thus the NE
uptake inhibition by corticosterone does not depend on
the cytoplasmic GS receptor or on changes in transcription or translation.
To investigate whether corticosterone acts at the
plasma membrane, corticosterone was prevented from
entering the cell by conjugation to the membraneimpermeant carrier protein BSA (40). Corticosterone21-hemisuccinate-BSA (1 ␮M) decreased NE uptake
into SMC by 57.7 ⫾ 16.3% (in triplicate experiments
with 25–50 cells each, P ⬍ 0.05 vs. control, P ⬎ 0.05 vs.
corticosterone treated; Fig. 5C). Because membraneimpermeant corticosterone also inhibited NE uptake
into human bronchial arterial SMC, we concluded that
the acute effects of GSs are likely mediated through a
GS binding site at the plasma membrane.
Plasma membrane binding site for corticosterone in
human bronchial arterial SMC. Inasmuch as the activity of the membrane-impermeant corticosteroneBSA conjugate suggested that corticosterone acted at a
site located at or in the plasma membrane, we looked
for further evidence of a membrane-binding site for
corticosterone in human bronchial arterial SMC. To
immunocytochemically visualize the binding of membrane-impermeant corticosterone-BSA conjugate to
the plasma membrane, rabbit IgG antibodies against
BSA were used in combination with TRITC-labeled
goat anti-rabbit IgG secondary antibodies. Fluorescent
labeling was absent in control cells that were incubated in 1 ␮M BSA-containing medium for 5 min (Fig.
6, A and B), whereas cells incubated in 1 ␮M corticosterone-21-hemisuccinate-BSA for 5 min were specifically labeled (Fig. 6, C and D). Inasmuch as the conjuAJP-Lung Cell Mol Physiol • VOL
gated corticosterone was necessary for BSA binding,
this experiment demonstrated a binding site for corticosterone in the cell membrane. Competition with 100
␮M corticosterone completely inhibited binding of corticosterone-21-hemisuccinate-BSA to the cells (Fig. 6,
E and F), indicating that corticosterone binding to the
plasma membrane was specific.
DISCUSSION
In the present study, we showed that human bronchial arterial SMC express mRNAs for two transmembrane NE transporters: EMT and OCT-1. Our uptake
measurements demonstrated that NE uptake is
mainly EMT mediated and acutely inhibited by various
GSs, including budesonide and methylprednisolone,
which are commonly used in clinical practice. The
inhibitory action of GSs is rapidly reversible and seems
to be mediated by a specific GS binding site in the
plasma membrane.
After the original description of uptake2 (18), it became clear that three transmembrane transporters for
catecholamines are expressed at various extraneuronal
locations, either individually or simultaneously: OCT-1
(11), OCT-2 (28), and EMT [i.e., the classic uptake2
transporter (12)]. These transporters have a characteristic regional distribution that may reflect their specialized roles. OCT-1 appears to be confined to the
liver, kidney, and intestine, OCT-2 is mainly expressed
in the kidney and brain, and EMT has a broad tissue
distribution (7). In blood vessels, OCT-1 mRNA is expressed at 15-fold lower levels than in the kidney, and
OCT-2 mRNA is undetectable (35), whereas EMT
mRNA expression is the highest (16, 35). In human
bronchial arterial smooth muscle, we found RT-PCR
amplicons for EMT and OCT-1 mRNAs.
285 • OCTOBER 2003 •
www.ajplung.org
Downloaded from http://ajplung.physiology.org/ by 10.220.32.246 on June 18, 2017
Fig. 5. Corticosterone inhibits NE uptake into human bronchial arterial SMC via a nongenomic mechanism. A:
cells exposed to 50 ␮M NE for 5 min without (control) or with 1 ␮M corticosterone. Additionally, cells were
pretreated with 1 ␮M corticosterone for 5 min but exposed to NE in corticosterone-free solutions (CORT ⫽ NE). B:
cells exposed to 50 ␮M NE without (control) or with 10 ␮M RU-486 (RU) ⫹ 1 ␮M corticosterone, 100 ␮M
actinomycin D (ACT) ⫹ 1 ␮M corticosterone, or 10 ␮M cycloheximide (CYC) ⫹ 1 ␮M corticosterone. C: cells exposed
to 50 ␮M NE without (control) or with 1 ␮M corticosterone-BSA conjugate (CORT:BSA). Values are means ⫾ SE
for triplicate experiments with 25–50 cells each. *P ⬍ 0.05 vs. control.
NE TRANSPORT BY EMT IN BRONCHIAL ARTERIAL SMOOTH MUSCLE
Although EMT and OCT-1 show a high degree of
sequence homology, they can be pharmacologically distinguished on the basis of their sensitivities to inhibitors (13). To investigate the physiological roles of EMT
and OCT-1 in NE uptake into these cells, a recently
developed fluorometric assay was used. In contrast to
other uptake measurement methods using tissue samples (14), our single-cell technique eliminated variables
of substrate diffusion and allowed experiments with
low numbers of cells (⬍100) isolated from a small
artery.
Corticosterone and O-methylisoprenaline were used
to identify the EMT-specific uptake of NE and indicated that NE uptake in freshly isolated human bronchial arterial SMC was mediated mainly by EMT.
Although our mRNA expression analysis may also sugAJP-Lung Cell Mol Physiol • VOL
gest a role for OCT-1, our functional studies, together
with the reported GS sensitivities of NE transporters
(13), indicate that EMT is the primary target for GSs in
bronchial arterial smooth muscle. Uptake via OCT-1 is
unlikely, inasmuch as ⱖ1 ␮M corticosterone did not
decrease NE uptake into the cells further, as expected
if OCT-1 were to play a role, given the IC50 of its
inhibition by corticosterone (21.7 ␮M; Fig. 4). Because
papain digestion is unlikely to differentially digest
these related transport molecules, we do not believe
that the enzymatic treatment step influenced the results significantly.
The remaining NE uptake after blocking EMT could
be due to nonspecific uptake, possibly related to the
measurement technique or, less likely, due to binding
of NE to receptors on the cell surface. Similar nonspecific uptake has been observed in experiments on EMT
using the synthetic substrate 1-methyl-4-phenylpyridium (17).
There is a considerable variability in the ability of
different steroid hormones to inhibit EMT-mediated
uptake of catecholamines (32, 33). Among GSs, corticosterone is the most potent, with an IC50 of ⬃130 nM
in Caki-1 cells (33). In our experiments performed on
human bronchial arterial SMC, corticosterone inhibited NE uptake with an almost identical IC50 (i.e., 0.2
␮M). Although EMT inhibition requires relatively high
GS amounts, such concentrations can be encountered
after systemic GS drug administration and even in
stress conditions. The concentrations of inhaled GSs in
the airway wall may also be in the inhibitory range of
EMT (8).
Corticosterone and possibly other GSs inhibit NE
uptake by human bronchial arterial SMC through a
nongenomic mechanism as demonstrated by corticosterone’s rapid action, insensitivity to changes in transcription or protein synthesis, and lack of need to
penetrate the plasma membrane. In addition to these
findings, shown previously by us in rabbit aortic SMC
(15), we demonstrated here that corticosterone’s action
is acutely reversible and not mediated by the classic
cytoplasmic GS receptors. However, the mechanism by
which GSs acutely inhibit NE uptake is still unknown.
Because many rapid steroid actions influence plasma
membrane ion channels [e.g., K⫹ channels and, thus,
membrane potential (38)] and intracellular Ca2⫹-mediated signaling mechanisms (5), which have recently
been shown to play a key role in EMT’s functional
regulation (24), GSs might inhibit EMT through these
mechanisms. Alternatively, GSs might act directly on
the transporter.
A specific plasma membrane binding site for corticosterone was also demonstrated in bronchial arterial
SMC by immunocytochemical labeling of the membrane-impermeant corticosterone-BSA conjugate. Although hydrophobic steroids are thought to pass easily
across a plasma membrane into a cell and interact with
cytosolic receptors, various rapid GS actions have recently been attributed to plasma membrane-bound receptors (39). The existence of GS binding sites has been
reported previously, but not in vascular SMC. Their
285 • OCTOBER 2003 •
www.ajplung.org
Downloaded from http://ajplung.physiology.org/ by 10.220.32.246 on June 18, 2017
Fig. 6. Immunochemical demonstration of a specific plasma membrane binding site for corticosterone in human bronchial arterial
SMC. Cells were incubated with 1 ␮M BSA (A and B), 1 ␮M corticosterone-BSA (C and D), or 1 ␮M corticosterone-BSA ⫹ 100 ␮M
corticosterone (E and F). Rabbit anti-BSA primary and a tetramethylrhodamine isothiocyanate-labeled goat anti-rabbit IgG secondary
antibody were used for immunocytochemistry. A, C, and E: differential interference contrast microscopy; B, D, and F: fluorescence
(tetramethylrhodamine isothiocyanate) microscopy. Original magnification ⫻600.
L835
L836
NE TRANSPORT BY EMT IN BRONCHIAL ARTERIAL SMOOTH MUSCLE
DISCLOSURES
This work was supported in part National Heart, Lung, and Blood
Institute Grants HL-58086 (to A. Wanner), HL-60644 and HL-67206
(to M. Salathe), and HL-66125 (to G. E. Conner) and an award from
the American Heart Association, Florida/Puerto Rico Affiliate (to G.
Horvath).
REFERENCES
1. Beato M, Herrlich P, and Schutz G. Steroid hormone receptors: many actors in search of a plot. Cell 83: 851–857, 1995.
2. Brieva J and Wanner A. Adrenergic airway vascular smooth
muscle responsiveness in healthy and asthmatic subjects. J Appl
Physiol 90: 665–669, 2001.
3. Buck KJ and Amara SG. Structural domains of catecholamine
transporter chimeras involved in selective inhibition by antidepressants and psychomotor stimulants. Mol Pharmacol 48:
1030–1037, 1995.
4. Butler J. The Bronchial Circulation. New York: Dekker, 1992.
5. Cato AC, Nestl A, and Mink S. Rapid actions of steroid receptors in cellular signaling pathways. Sci STKE 2002: RE9, 2002.
6. Daniel EE, Kannan M, Davis C, and Posey-Daniel V. Ultrastructural studies on the neuromuscular control of human tracheal and bronchial muscle. Respir Physiol 63: 109–128, 1986.
7. Eisenhofer G. The role of neuronal and extraneuronal plasma
membrane transporters in the inactivation of peripheral catecholamines. Pharmacol Ther 91: 35–62, 2001.
8. Esmailpour N, Hogger P, Rabe KF, Heitmann U, Nakashima M, and Rohdewald P. Distribution of inhaled fluticasone propionate between human lung tissue and serum in
vivo. Eur Respir J 10: 1496–1499, 1997.
9. Ginsburg J. Influence of intra-arterial hydrocortisone on adrenergic responses in the hand. Br Med J 16: 424–427, 1958.
10. Grundemann D, Babin-Ebell J, Martel F, Ording N,
Schmidt A, and Schomig E. Primary structure and functional
expression of the apical organic cation transporter from kidney
epithelial LLC-PK1 cells. J Biol Chem 272: 10408–10413, 1997.
11. Grundemann D, Gorboulev V, Gambaryan S, Veyhl M, and
Koepsell H. Drug excretion mediated by a new prototype of
polyspecific transporter. Nature 372: 549–552, 1994.
12. Grundemann D, Schechinger B, Rappold GA, and
Schomig E. Molecular identification of the corticosterone-sensitive extraneuronal catecholamine transporter. Nat Neurosci 1:
349–351, 1998.
AJP-Lung Cell Mol Physiol • VOL
13. Hayer-Zillgen M, Bruss M, and Bonisch H. Expression and
pharmacological profile of the human organic cation transporters hOCT1, hOCT2 and hOCT3. Br J Pharmacol 136: 829–836,
2002.
14. Henseling M. Kinetic constants for uptake and metabolism of
3
H-(⫺)noradrenaline in rabbit aorta. Possible falsification of the
constants by diffusion barriers within the vessel wall. Naunyn
Schmiedebergs Arch Pharmacol 323: 12–23, 1983.
15. Horvath G, Lieb T, Conner GE, Salathe M, and Wanner A.
Steroid sensitivity of norepinephrine uptake by human bronchial
arterial and rabbit aortic smooth muscle cells. Am J Respir Cell
Mol Biol 25: 500–506, 2001.
16. Horvath G, Torbati A, Conner GE, Salathe M, and Wanner
A. Systemic ovalbumin sensitization downregulates norepinephrine uptake by rabbit aortic smooth muscle cells. Am J Respir
Cell Mol Biol 27: 746–751, 2002.
17. Inazu M, Takeda H, and Matsumiya T. Expression and functional characterization of the extraneuronal monoamine transporter in normal human astrocytes. J Neurochem 84: 43–52,
2003.
18. Iversen LL and Salt PJ. Inhibition of catecholamine uptake-2
by steroids in the isolated rat heart. Br J Pharmacol 40: 528–
530, 1970.
19. Kalsner S. Role of extraneuronal mechanisms in the termination of contractile responses to amines in vascular tissue. Br J
Pharmacol 53: 267–277, 1975.
20. Kumar SD, Brieva JL, Danta I, and Wanner A. Transient
effect of inhaled fluticasone on airway mucosal blood flow in
subjects with and without asthma. Am J Respir Crit Care Med
161: 918–921, 2000.
21. Laporte R and DeRoth L. Modulation of the effects of norepinephrine uptake inhibitors on the norepinephrine-induced contractile response of the porcine uterine artery during early pregnancy. Can J Vet Res 61: 214–220, 1997.
22. Lieb T, Frei CW, Frohock JI, Bookman RJ, and Salathe M.
Prolonged increase in ciliary beat frequency after short-term
purinergic stimulation in human airway epithelial cells.
J Physiol 538: 633–646, 2002.
23. Mangelsdorf DJ, Thummel C, Beato M, Herrlich P, Schutz
G, Umesono K, Blumberg B, Kastner P, Mark M, and
Chambon P. The nuclear receptor superfamily: the second
decade. Cell 83: 835–839, 1995.
24. Martel F, Keating E, Calhau C, Grundemann D, Schomig
E, and Azevedo I. Regulation of human extraneuronal monoamine transporter (hEMT) expressed in HEK293 cells by intracellular second messenger systems. Naunyn Schmiedebergs Arch
Pharmacol 364: 487–495, 2001.
25. Martel F, Ribeiro L, Calhau C, and Azevedo I. Comparison
between uptake2 and rOCT1: effects of catecholamines, metanephrines and corticosterone. Naunyn Schmiedebergs Arch
Pharmacol 359: 303–309, 1999.
26. Mendes ES, Pereira A, Danta I, Duncan RC, and Wanner
A. Comparative bronchial vasoconstrictive efficacy of inhaled
glucocorticosteroids. Eur Respir J 21: 989–993, 2003.
27. Ohkubo H and Chiba S. Vascular responses of ophthalmic
arteries to exogenous and endogenous norepinephrine. Exp Eye
Res 48: 539–547, 1989.
28. Okuda M, Saito H, Urakami Y, Takano M, and Inui K.
cDNA cloning and functional expression of a novel rat kidney
organic cation transporter, OCT2. Biochem Biophys Res Commun 224: 500–507, 1996.
29. Pacholczyk T, Blakely RD, and Amara SG. Expression cloning of a cocaine- and antidepressant-sensitive human noradrenaline transporter. Nature 350: 350–354, 1991.
30. Percy E, Kaye DM, Lambert GW, Gruskin S, Esler MD, and Du
XJ. Catechol-O-methyltransferase activity in CHO cells expressing
norepinephrine transporter. Br J Pharmacol 128: 774–780, 1999.
31. Russell JA and Kircher KW. Metabolism of norepinephrine
during nerve stimulation in dog trachea. J Appl Physiol 59:
1236–1241, 1985.
32. Salt PJ. Inhibition of noradrenaline uptake 2 in the isolated rat
heart by steroids, clonidine and methoxylated phenylethylamines. Eur J Pharmacol 20: 329–340, 1972.
285 • OCTOBER 2003 •
www.ajplung.org
Downloaded from http://ajplung.physiology.org/ by 10.220.32.246 on June 18, 2017
molecular identity as well as their role in inhibiting NE
uptake remain to be clarified.
Although the detailed cellular mechanisms of GSs in
vascular tissues remain largely unknown, they apparently include transcriptional regulation of gene expression (e.g., increased ␣-adrenoreceptor number and NO
synthase inhibition) and nongenomic responses (e.g.,
uptake2 inhibition). NE uptake mechanisms have attracted increased interest recently, because several
studies suggest that impaired NE reuptake could be
responsible for increased sympathetic tone seen in essential hypertension (6) and postural tachycardia (34).
Because extraneuronal NE uptake is quantitatively
larger than neuronal reuptake in the airways, it is
likely that EMT has a role in regulating local concentrations of NE as well as other transported and intracellularly metabolized compounds. Our data suggest
that the interaction of GSs with local NE metabolism is
physiologically important to regulate the noradrenergic vasomotor tone in the tracheobronchial circulation
and possibly other vascular beds. This mechanism can
certainly explain the acute bronchial vasoconstrictive
action of inhaled GSs.
NE TRANSPORT BY EMT IN BRONCHIAL ARTERIAL SMOOTH MUSCLE
33. Schomig E and Schonfeld CL. Extraneuronal noradrenaline
transport (uptake2) in a human cell line (Caki-1 cells). Naunyn
Schmiedebergs Arch Pharmacol 341: 404–410, 1990.
34. Shannon JR, Flattem NL, Jordan J, Jacob G, Black BK,
Biaggioni I, Blakely RD, and Robertson D. Orthostatic intolerance and tachycardia associated with norepinephrine-transporter deficiency. N Engl J Med 342: 541–549, 2000.
35. Slitt AL, Cherrington NJ, Hartley DP, Leazer TM, and
Klaassen CD. Tissue distribution and renal developmental
changes in rat organic cation transporter mRNA levels. Drug
Metab Dispos 30: 212–219, 2002.
36. Stjarne L and Stjarne E. Geometry, kinetics and plasticity of
release and clearance of ATP and noradrenaline as sympathetic
cotransmitters: roles for the neurogenic contraction. Prog Neurobiol 47: 45–94, 1995.
L837
37. Torre JC and Surgeon JW. A methodological approach to
rapid and sensitive monoamine histofluorescence using a modified glyoxylic acid technique: the SPG method. Histochemistry
49: 81–93, 1976.
38. Valverde MA, Rojas P, Amigo J, Cosmelli D, Orio P, Bahamonde MI, Mann GE, Vergara C, and Latorre R. Acute
activation of maxi-K channels (hSlo) by estradiol binding to the
␤-subunit. Science 285: 1929–1931, 1999.
39. Watson CS and Gametchu B. Membrane-initiated steroid
actions and the proteins that mediate them. Proc Soc Exp Biol
Med 220: 9–19, 1999.
40. Zheng J and Ramirez VD. Demonstration of membrane estrogen binding proteins in rat brain by ligand blotting using a
17␤-estradiol-[125I]bovine serum albumin conjugate. J Steroid
Biochem Mol Biol 62: 327–336, 1997.
Downloaded from http://ajplung.physiology.org/ by 10.220.32.246 on June 18, 2017
AJP-Lung Cell Mol Physiol • VOL
285 • OCTOBER 2003 •
www.ajplung.org