THEJOURNAL
OF BIOLOGICAL
CHENL¶TRY
Vol. 268,No. 2,Isaue of January 15, pp. 1362-1367,1993
Printed in U.S.A.
0 1993 by The American Society for Biochemistry and Molecular Biology, Inc
Two mRNA Transcripts (rBAT-1 and rBAT-2) Are Involved in System
bos’-related Amino Acid Transport*
(Received for publication, August 3, 1992)
Daniel Markovich, Gerti Stange,Joan BertranSQ, ManuelPalacins, Andreas Werner,
Jiirg Biber,
and Heini Murer
From the Department of Physiology, University of Zurich, Winterthurerstrase 190, CH-8057 Zurich, Switzerland
Previously, we isolated a cDNA clone (rBAT-1) of
2.2 kilobase pairs (kb) from a rabbit kidney cortex
cDNA library, encoding a protein involved in sodiumindependent transport of L-dibasic amino acids, L-cystine, andsome neutral amino acids via a system related
to bo*+-likeactivity (Bertran, J., Werner, A., Moore,
M. L., Stange, G., Markovich, D., Biber, J., Testar, X.,
Zorzano, A,, Palacin, M., and Murer, H. (1992) Proc.
Natl. Acud. Sci. U. S.A. 89,5601-5605). In Northern
blot hybridization using an rBAT- 1 cDNA probe, 2.2and 3.9-kb mRNA species were observed. Here we
describe the isolation of a 3.9-kb cDNA clone (rBAT2) by expression cloning using Xenopus laevis oocytes
corresponding to the 3.9-kb mRNA species. On the
basis of sequence analysis, in vitro translation (major
protein of approximately 78 kDa),andfunctional
analysis (expression of transport function), we conclude that rBAT-1- and rBAT-2-related proteins are
identical: 677 amino acids in length, with most likely
only one transmembrane-spanning domain. There are
seven differences in thenucleotide composition within
a common overlap of 2189 nucleotides, resulting in 2
amino acid replacements. In comparison with rBAT-1,
rBAT-2 has26 additional nucleotides at the 5‘-end, an
identical location of the first polyadenylation signal,
and approximately 1.7 kb of 3’-untranslated sequence
(rich in AT(U) motifs) prior to a poly(A) tail of 63
adenines. We conclude that rBAT-1 and rBAT-2 encode the same protein and that the major difference
seems to be related to the use of different polyadenylation signals.
transport pathways are involved in transmembrane transport
of dibasic amino acids: (i) system y+, whichaccepts L-dibasic
amino acids and excludes L-cystine (it interacts with some
neutralamino acids (e.g. L-homoserine), but only in the
presence of sodium (1, 2, 5-7); (ii) system bo*+,which accepts
L-dibasic amino acids, L-cystine, and some neutral L-amino
acids (eg. L-leucine and L-alanine). In contrast to system y+,
system bo.+interacts with L-homoserine in the presence and
absence of sodium (1, 2, 8-10).
Little is known about the structuralidentity of the different
amino acid transporters. Only recently, evidence was obtained
that a murine ecotropic retrovirus receptor most likely represents a protein closely related to system y+ (5-7). In addition, functional cloning using the Xenopus laevis oocyte
expression system has led to theidentification of a rat kidney
protein and a rabbit
kidney protein, which have high
potencies
to induce transport activities in X . laevis oocytes resembling
system bO.+-liketransport activity (8-13). Although the rat
kidney protein identified by Tate and colleagues (11) was
closely related (“identical”) to that cloned from the same
source by Wells and Hediger (12), the former authors suggested the participation of the protein in amino acid transport
via a system L-related pathway (11, 12). Therat kidney
protein identified by Wells and Hediger was named D2 (12),
and the corresponding protein identified from rabbit kidney
was named rBAT (rBAT-1 in the presentpaper); it was
concluded that rBAT (rBAT-1; D2) is either the carrier protein itself, forming a homooligomer, or an important component of a heterooligomeric structure (9, 12, 13). This protein
(rBAT-1; D2) might be related to a brush border membrane
function; previously, it was shown that small intestinal and
proximal tubular brush border membranes seem to have a
Amino acids aretransported across mammalian plasma transport activity with a substrate specificity resembling bo,+
membranes by multiple sodium-dependent and -independent activity (3, 4, 14-16). Magagnin et al. (10) could demonstrate
that rBAT-1-related mRNA species are also present in small
pathways. Classification into distinct transport pathways is
mainly based on studies related to substrate specificity, in- intestinal epithelial cells and are capable of expressing bo-+cluding cross-inhibition studies, as well as on studies charac- related transport activity after oocyte injection.
Northern blot analysis using a rBAT-1 cDNA probe has
terizing the involvement of a sodium gradient as a driving
force (1-4). It seems that two different sodium-independent indicated the existence of two mRNA transcripts in various
tissues, of 2.2 and 3.9 kb,’ respectively (9, 10). The 2.2-kb
* This work was supported by Swiss National Science Foundation transcript corresponds in size to the cloned rBAT-1 cDNA
Grant 32-30785-91, the “Stiftung fur Wissenschaftliche Forschung” and is about 2-3 times more abundant than the 3.9-kb tranof the University of Zurich, and the Geigy “Jubilaumsstiftung.” The script in rabbit kidney cortex (9, 10). The present work
costs of publication of this article were defrayed in part by the describes the isolation and characterizationof a cDNA related
payment of page charges. This article must therefore be hereby to the 3.9-kb transcript. This long rBAT cDNA (rBAT-2)
marked “advertisement” in accordance with 18 U.S.C. Section 1734
encodes a protein highly homologousto theprotein related to
solely to indicate this fact.
The nucleotide sequence(s) reported in thispaper has been submitted the 2.2-kb transcript (rBAT-1); this conclusion is supported
to the GenBankTM/EMBL Data Bank withaccession numbeds) by sequence analysis, i n vitro translation experiments, and
L04504.
expression of transport activity in oocytes. The difference
0 ReciDient of a fellowship from the Spanish Ministry of Science between rBAT-1 and rBAT-2 seems to be primarily in the 3’a n i Education.
§ Present address: Dept. of Biochemistry and Physiology, University of Barcelona, Avda. Diagonal 645, E-08071 Barcelona, Spain.
1362
The abbreviations used are: kb, kilobase pair(s); bp, base pairb).
rBAT-1 and rBAT-2 AreInvolved in Amino Acid Transport
1363
untranslated region, i.e. most likely in the use of a different
polyadenylation signal.
MATERIALS ANDMETHODS
X.Znevis Oocytes and Transport Assay-All materials and methods
concerning oocyte handling and amino acid transport have been
described in detail (8,9).Oocytes were injected with 2.5 ng of rBAT1 or rBAT-2 cRNA, and 2-4 days after injection, transport of Lamino acids was measured a t time periods showing a linear uptake
rate (10 min). For transport of L-cystine, the uptake solution was
supplemented with 10 mM diamide. Radiolabeled L-amino acids were
obtained from Du Pont-New England Nuclear and used at anactivity
of 10-50 pCi/ml.
cDNA Cloning and Library Screening-All materials and methods
used in cDNA library construction and screening, including cRNA
transcription, have been described in detail previously (9, 17). In
short, cDNA was synthesized from size-selected X - k b rabbit renal
cortex mRNA and thenunidirectionally ligated into pBluescript SK+
(Stratagene). After plasmid transformation, 14,000clones were plated
and screened by in vitro transcribing the cDNAs and then injecting
the cRNAs into oocytes and assaying for sodium-independent transport of L-amino acids. From initial pools of 1000 clones, the library
was subdivided until a single clone (rBAT-2) was isolated, strongly
stimulating sodium-independent transport of L-arginine, L-leucine,
and L-cystine, respectively.
cDNA Sequencing and Homology Analysis-rBAT-2 cDNA was
sequenced using the double-stranded dideoxy chain termination techCTP
England Nuclear Radiochemicals)
nique (18)using C Y - ~ ~ S - ~(New
and a T7 DNA polymerase sequencing system (PharmaciaLKB
Biotechnology Inc.). The cDNA was completely sequenced in both
directions by using vector-derived primers and synthetic oligonucleotide primers. We have also generated one subclone of rBAT-2
(ligated into pBluescript SK+) by using HindIIIKpnI (base 2154 up
t o the 3'-end of rBAT-2).
mRNA Isolation and Northern Blots-RNA and mRNA samples
were isolated according to previously published procedures (8).The
cDNA probe for rBAT-1 was a 2140-bp (BarnHI-KpnI) fragment
lacking 117 bp at the5 '-end of the complete rBAT-1 cDNA, and for
rBAT-2, a SmaI-KpnI restriction fragment (from 3375 bp up to the
3'-end) was generated from the complete rBAT-2 cDNA. Both probes
were labeled using C Y - ~ ~ P - ~
and
C Tthe
P T7 Quick Prime Kit (Pharmacia). 10 pg of mRNA was electrophoresed on a 1%formaldehyde/
agarose gel, transferred to Genescreen membranes (Du Pont-New
England Nuclear), and hybridized ina solution containing 50%
formamide. After hybridization, the blots were washed four times
quickly in 1 X standardsaline citrate (SSC), 0.1% SDS a t room
temperature and then twice for 15 min a t 45 "C with 0.1 X SSC, 0.1%
SDS.
I n Vitro Translation-In vitro translation of rBAT-1 and rBAT-2
cRNAs was performed using a rabbit reticulocyte lysate system in
the absence and presence of canine pancreatic microsomes (Promega).
The reaction in the absence of microsomes was run in the presence
of 0.5% (w/v) Triton X-100; otherwise the supplier's protocol was
followed (Promega). The reaction was stopped by addition of sample
buffer (final concentration: 2% SDS, 20% glycerol, 1 mM EDTA, 120
mM Tris-HCI, 10 mM dithiothreitol, pH 6.8) and thendirectly loaded
onto a 10% SDS-polyacrylamide gel. Electrophoresis and subsequent
fluorography were performed according to standardprotocols.
7
C
?-
.
0
4-
2'
1-
Hz0
rBAT-1rBAT-2mRNA
FIG. 1. Induction of L-arginine transport by rabbit kidney
cortex mRNA, rBAT-1, and rBAT-2 cRNA. Transport was
measured in the absence of sodium (100 mM choline chloride) using
L-arginine (50 p ~ as)substrate; it was measured 2 days after injection
of 50 nl of water, total mRNA (25 ng/oocyte), rBAT-1 cRNA (2.5 ng/
oocyte), and rBAT-2 cRNA (2.5 ng/oocyte), respectively. Uptake
values (10 min) are presented as means f S.D. for 6-10 oocytes/
group. The experiment is representative of three similar repetitions.
rBAT-2 cDNA insert is 3934 bp in length, as compared with
the shorter rBAT-1 cDNA, which is 2247 bp in length (9). A
high homology (>99.9% identity) was observed between
rBAT-1 and rBAT-2 cDNAs, within a common overlap of
2189 nucleotides, including thetranslation initiationsite
(double underlined), stop codon (marked by an asterisk), and
first common polyadenylation signal (underlined). The predicted open reading frame for the rBAT-2-relatedprotein
encodes a protein of 677 amino acids, completely in accordance with rBAT-1, with only two amino acid differences, as
deduced from the nucleotide sequence (Fig. 2B). Within the
overlapping regions, there are seven nucleotide differences
(five within the coding region), and therBAT-2 cDNA has an
additional 26 bp at the 5'-end (Fig. 2 A ) . There is complete
nucleotide identity in the first five nucleotides upstream of
the start codon (ATG)in both clones, representing good
consensus initiation sequences (19). The stop codons (TAG;
2032-2034 bp) are followed by an almost identical nucleotide
sequence until reaching a first polyadenylation signal (AATAA; 2179-2184 bp) (20). In contrast to rBAT-1 cDNA, in
which the poly(A) tail follows after a few bases, in rBAT-2
GDNA,this first polyadenylation signal is apparently not used,
and a noncoding nucleotide sequence of ~ 1 . kb
7 follows until
RESULTS
reaching the poly(A) tail. This poly(A) tail is preceded by
Similar to our previous procedure used to isolate the rBAT- multiple short stretches(6 bases) rich in A, which might serve
1cDNA (9), we have isolated an rBAT-2 cDNA by functional as polyadenylation signals.
The predicted amino acid sequence of rBAT-2 shows a
screening of a rabbit kidney cortex cDNA library (17) for
expression of sodium-independent transport of L-arginine in lysine residue substituted for glutamic acid at position 41 and
X . laevis oocytes. A sib selection procedure resulted in the an alanine to proline substitution at position 213 when comisolation of the rBAT-2 cDNA clone, which in contrast to the pared with rBAT-1 (Fig. 2B). Also, there is an identical
previously isolated rBAT-1 cDNA clone (9) has an insert3.9 secondary structure prediction for the proteins (Fig. 2B), with
kb in length (data not shown) (see below). Injection of equal only one transmembrane domain according to the Kyte and
amounts of in vitro synthesized cRNA from both rBAT-2 and Doolittle algorithm (amino acids 80-102; double underlined;
rBAT-1 cDNAs stimulated the uptake of L-arginine with Refs. 9 and 21) and an identical seven putative N-glycosylaapproximately equal potency (about 15-fold; Fig. 1).
tion sites (underlined) inrBAT-2 and rBAT-1 predicted
The insert of rBAT-2 cDNA was completely sequenced, proteins (9). In vitro reticulocyte translation of the rBAT-2
and the sequence was compared at the nucleotide level (Fig. and rBAT-1 cRNAs resulted in several bands in both cases
2 A ) and amino acid level (Fig. 2B) with rBAT-1 (9). The (Fig. 3A), the size of the major products being compatible
1364
rBAT-1 and rBAT-2 Are Involved in AminoAcid Transport
A
_
r8AT-2
-37
r0AT-1
-11
.......
~'-CCGGGCCCGGAAWCA~AGGCTCTA~A~T~AGAC
5'-CtC$G&GAt
.........................................................
............................................................
............................................................
1561 ACCAGTTCAGATIACCACACTGTGAATGTTMCGTCCMAAGACCCAGCCUCATCAKT
1561
ittiQiiBtiiiittititib~&iibii&tbitt~ib~t~ci~tt~t~it~~ti
............................................................
1 ~ZEGCTGAGWIAGGAAGCAAGAGAGACTCCATCAAWTGMTA~GMAGMTUCAGACA
1621 T T G M G T T G T A C C M G C T T T M G l C T A C l l C A T ~ C A A l 6 M C T G C l G C l U G U G G 6 6 C
1 ~GCTGAGGM~~AAGCAAGAGAGACTC~*TCAAWITGMTATGMAG~TUCAGACA
1621 ~GMGTTGTACCMGCTTTM6TCTAClT~TUCAATGMCTGCTUTCAGCAGGGGC
............................................................
......................
......................
61 AACMlGGCTTTGTGCAAAATGMGACAlCCCAGAKTGWCCTGWITC~GKAUTCG
1681 TGGTTTIGTCTTCTGAGWIATG
61 iitiiiEttiiiiibtiiiiibMbitAitttiGi~~b~ttibMit~b~iGt~t6
1601 TGGTTTTGTCTTCTGAGWATG
FIG. 2. A, comparison of the nucleotide sequences of rBAT-2 and rBAT-1.
Nucleotides are numbered in the 5' -+
3' direction, starting with the first nucleotide of the in-frame ATGcodon
(double underlined).The size of rBAT-2
is 3934 bp and contains apoly(A) tail of
63 bp, whereas rBAT-1is 2247bp in
length with a poly(A) tail of 39 bp. The
stop codon TAG lies at position 2032 bp
(indicated by three asterisks) and is followed by a polyadenylation signal (AATAA) at position 2179 bp (underlined);
if in rBAT-2 the nucleotide sequence
immediately following the polyadenylation signal is shifted by two positions
( T A in rBAT-l), there is an additional
sequence identity for the next nine nucleotides. There are seven differences in
base composition in the overlapping regions of rBAT-1 and rBAT-2 (boxed).At
the 3'-end of rBAT-2, there is no canonical polyadenylation signal (19). Apparently, one of the A-rich stretches at the
3'-end of rBAT-2 is used as a polyadenylation signal (e.g.between bp 3781and
3830). B, amino acid sequences of rBAT2 and rBAT-1. The predicted open reading frames of both clones encode 677
amino acid residues. There are two
amino acid differences between the two
clones (boxed) at position 41 (lysine -+
glutamate) and position 213 (alanine -+
proline), respectively. The putative
transmembrane domain (double underlined) is within amino acid residues 81
-+ 102. The seven potential N-glycosylation sites are underlined.
a..............................
6CCGCGl~~GGTGTMACMGAGAKTffiAlffiC
GCCGCGTTTTGGTGTACACAAMGAKTffiAT~C
............................................................
............................................................
1741 ATAWCAWGTCTTTATTGTGGTTCTGUTTTTGGAGMTCAACACTGCT~ATCTACAS
1741 ATA6ACAWGTCTTTATl6TffiTTCTGMTTTTGGAGMTUAUCT~TMATCTAUG
181 CCUAGGAGGTGCTGTTCCAGTlCTCGGGCCAffiCCCGCTACCGCGTGCCCCffiMGAlC
............................................................
101 CCUAGGAGGTGCTGTlCCAGTTCTCGGGCCAGGCCCGCTACCGCGTGCCCCffiGAGATC
241 CTCTTCTGGCTCGTCGTGGTTCTGTGCTCGTGCTCATTGGGGCCACCATAGCCATCATC
............................................................
241 CTCTlC~GGCTCGTCGTGGTTTCTGTGCTCGTKTUTT66GGCCACCATAGCCATCAlC
1801 WAAlGATTTCAGMCTCCCCGTMGACTGAGCATAAMTlAAGTACUA~CTGCCTCC
............................................................
1001 WAATGATTTCAGGAClCCCCGTMGAClGAGCATAAMTTMGTACUATCTGCCTCC
............................................................
1861 ACAGGCAGCCAGGTTGATACGAGAGGCATTTTTCTTGAGAGGGMGAGGGAGTCCTCClT
1861
ititbtitttibtiibiiit~b~b6~i~iiiit~ib~b~~b~~i~bibittit
............................................................
............................................................
301 GCUTCTCTCCAMGlGCCTTGATTGGTGGCAG6CAGGGCCCATGTATCAGATCTACCCG
1921 MAUCAMATGAAGAACCTCCTTCACCGCCAAACAGCTlTCAMGACAGATG~TCATC
301 GCCATCTCTCCAMGTGCCTTMTlGGTGGCAffiCAGGGCCCATGTATCA6ATCTACCCG
1921 WACACI*lATGAAGAACCTCC~lCACCGCUAACAG~TTCAGAGAUGATG~TCATC
............................................................
......................................................
............................................................
.............................................
1981 TCCAGTCWGUTGCTACTCUGCGCATTAGACATACTGTACA~TCCTGT~~CAGCT
1901 T C C A G T C M G C A T G C T A C l C C A G C G C A l T A ~ C A T A C l G T A C A G C T C C l G T ~ ~ ~ G C A K l
2041 W I G A G G A C G G A G A C G C G G C A C C C 6 C A G C A C T G l M G C A T T A G C A G ~ 6 ~ ~ ~ ~ ~ ~ ~ ~ ~ ~
2041
M g i b b i t i ; b i b i ~ c b b ~ ~ t ~ ~ b t i G ~ i ~ i 6 ~cccGtiiikiii
M~~iii~6c~G
ATGGCCATTAGGTGCTTCTGTAGATTCAGTTACACTGTTAGWMGCTTCC
.....
.........................................................
2101 GCGCT
2101 GCGCT
ATGGCCATTAGGTGCTTCTGTAGATTCAGTTACACTGTTAGWAAGCTTCC
.........................
2161 C A A A l C l T T l U A A G A A T ~ T A T 6 T l T C A M A G M A M I * l A A M A I * l M A A M A
2161 U A A T C l T T T U A A 6 A A T ~ l G T T T C M A G G A A A T G A C T M T T G l A W A A C T T G T A
2221 A C ~ T ~ A T C A A T A G U T C M ~ A T G ~ G A T G A A C A G M C A C ~ ~ ~ A A G A C C C C A G A T T A T ~ T G A
2221 M A M A A M A M A M M A - 3 '
2281 M 6 C T C l A C T ~ A T T T T M T 6 l G M C C T T C T T C C T T A M A T A C A G l C A T G G A A A C T G M G
2341 MTGACTCAClGCCACAGTATCTMAAATGCTCACGGGCAUAAGGCACGACATTGAlTT
2401 GTAMCGTCAMGMAAlCCTAGTAAAATAGGCACAAMCMAWCATTCCGATTGGMG
2661 f f i A G ~ C C A G f f i G T G 6 G ~ l G T C C C ~ A C C C ~ l C C I G A C C T t C ~ C l C C A l G C ~ C T ~ G
2521 WIGCATGffilGAACCTGACCTAGGTlGAGlWICATCAATGTGCATCAATGMGAGCACAG
2501 WTMGCCAGTGAGACCAGACTAAGCAMATCCGGATGGAWAGCAAGTTTlTMAAATT
2641 ATTTAATMCTGAMAAMAAlCTCAClTTTGCTAATCTAAGTGGAAATAAGAClATMA
2701 AlATTTCAGTGTGTllTCAACCTCCAACTGMTGTGGCAlTTCAGAATTTTAGGTATTTC
2761 lTAffiAlCCTCGAMACACGGGTGCTSTC**GTCCAAGTTCCTCAThCAGWIATTTAA~T
2021 TGGGClGTAAlCIMAAWAACAlTTAMAMTTAGAAlGGlTTTGlffiTMAACTCCAG
2801 CATlCAAGlTTTTCTTCllCCCAMTTCACCTAACCCCAAAGCCAGCMTlTATAAGAGT
2941 ATTTTATnAGGGCAGCGTGMAAGGCTCTMCMTTMGAlTCAGCCACACACTlTClT
3001 TAACAGAWGClCAT6ACCAMTATGAMGTGCCTTTTCTCTGMCTWl~AGTGTCCC
3061 T C T C C l C C C T C C T G G G T C T C G G C C A C A M A C C C T G T G ~ G T M A T A C M C ~ G C l C
3121 TACCTGGWC~CCTCAGCCGGGGGAACTCGGTAACATACCTTTTTGTWGMTCClCMT
3181 CACATGATTGCCTCCAGGCTWATAlCTAAMlMlATTCffiGUClWTAGCClGAMA
3241 AGTTAAGGlATAAMCAATlAGAAGGTClTGCAMGACTG~ACCCATTTCTTCCCTClC
3301 CTCTTGGAlACTCTGTTCAAAGACTAGCAAAGAMCCACCAlTAGCAGCAGTGACAA~A
3361 WTGGGAGGCGCCCGGGAGlAGAAGACCCGCTTClGACCCffiAMGCTGGAGGCGGCGGC
3421 TGGTGGCTGAGGAAGCCACGTGAACAGACGGTGCAGCACGCCGGCAAGGCTGTGACCGAG
3401 GAGGGAGTCCATCAGCCAlATAGCAGCTGAGlCTGGTTACTGGMACACCAGCCACAGCA
1541 ATGCAlGACGlGAGGACGGGGGClGAGGACAGGGACAClGTCTWCIlGTAlGlGGGlTC
1601 CTGCCACTGTTGAACCCAGAATGTCCTGATGTACAGTlCCMGGCAAMAGGAAGCGGTC
3661 TlATCTAATGAAAGATCAACAGGAAACTGAAGCAGClAGTTGAGGCATTGMGCCCTMA
3721 G G A M A A M C C T C M T C l G T C T G A G A G A T T C C T A G G A M A A T G A T l A G T A M l A T T G C T A
1701 MlWTTATGATCTAAATTAGTGCATCTAAACATlATATACGATCATTAAATTTAAAMA
3841 A A A M A A M A A A A A A A A M A M A A A A A M A M A A A A A M A M A M A A A A A M A M A A . 3 '
with the sizes predicted for the open reading frames (77,832
for rBAT-1 and 77,805 for rBAT-2). Addition of microsomes
to the in vitro translation system resulted in a shift of these
major translation products to higher molecular weights; endoglycosidase H treatment shifted these proteinsback to the
size observed withoutaddition
of microsomes (datanot
shown). These observations further document that rBAT-1
and rBAT-2 code for almost identical proteins, most likely
type I1 membrane glycoproteins (9, 22).
The available sequence information on rBAT-2 allowed us
t o generate a cDNA probe that should only recognize the 3.9kb transcript in a Northern blot. As shown in Fig. 3B, a
random primed cDNA probe derived from an ~ 5 6 0 - fragb~
ment at the 3'-endof rBAT-2 only recognizes the long transcript, which is in contrast to a cDNA probe corresponding
t o full-length rBAT-1, which identifies both short (2.2-2.3
kb) and long (3.7-3.9 kb) mRNA species (9, 10).
Sodium-independent transport of L-arginine (Fig. 1) could
be eithermediated by system y+-like or system bO.+-liketransport activity (see theIntroduction). Injection of rBAT-2
cRNA into oocytes also led to the induction of L-cystine and
L-leucine transport (Table I); L-cystine is not known to be
transported by system y+-like transport activity (data not
shown) (9,10,13): In Fig. 4,we show that sodium-independent transport of L-leucine and L-arginine are mediated by the
samerBAT-2 induced transport activity. The induced Larginine transportshows both self-inhibition (saturation) and
inhibition by L-leucine. Similarly, theinduced transport of Lleucine shows both self-inhibition (saturation) and inhibition
by L-arginine. Furthermore, the rBAT-2-induced transport
of
L-arginine is inhibited by L-homoserine in the presence and
absence of sodium(Fig. 5 ) , which is typicalfor bO.'-like
activity (9, 10, 13). A system y+-like activity would show
inhibition of L-arginine uptake by L-homoserine only in the
presence of sodium ( 5 , 7), asobserved by the intrinsic uptake
in water-injected oocytes (8-10, 13, 23). Thus, on the basis of
this brief transport characterization,we conclude that rBAT2-induced transport is identical to rBAT-1-related transport
and most likely corresponds toa bO,+-like activity(9,10,12).
* J. Cunningham, personal communication.
rBAT-1
and
rBAT-2
Are
Involved
in Amino Acid
Transport
1365
B
rM1-2
rlA1-1
1
1
I1
11
33
33
49
49
65
6s
81
81
91
97
113
113
113
119
14s
145
161
161
FIG.2"continued
117
111
191
193
209
209
22s
22s
241
241
251
211
211
273
DISCUSSION
We have isolated a cDNA clone of 3934 bp from a rabbit
kidney cortex library, which most likely corresponds to the
3.7-3.9-kb mRNA transcript seen in Northern blots
of various
tissues, including rabbit kidney cortex mRNA. We could
document that this cDNA (and this 3.7-3.9-kb mRNA species) isdirectly related toa cDNA of 2247 bp, which we earlier
isolated and which in Northern blots recognizes a 2.2-2.3-kb
transcript, as well as the above mentioned longer transcript
(9).
The two cDNAs encode an almost identical proteinof 677
amino acids in length. In the present study as well as in a
previously documentedone(9),
we haveshownthatthe
expression of this protein in X. laeuis oocytes leads to increased sodium-independent transportof dibasic amino acids,
some neutral aminoacids, and L-cystine via one single transport component (system bOz'-like transport activity) (9, 10).
Previously, we named the shortcDNA (2247 bp) rBAT-1 (9),
corresponding to a protein involved in sodium-independent
a variety of cell membranes
transport of aminoacidsin
(system bO.+-liketransport activity),including renal proximal
tubular and small intestinal brush border membranes (see
Introduction and Refs. 1-4). Therefore, the longer (3934 bp)
cDNA clone described in this paperwas named rBAT-2.
We present experimental evidence to support our conclusion on the direct relationship
of rBAT-2 torBAT-1: sequence
homology, identical in uitro translation products, and identical transport properties after the injection of the respective
cRNAs into oocytes. The isolation of a second functional
in
cDNA encoding a protein with the same apparent function
amino acid transport seems to be rather unusual; obviously,
only clones with minorsequence alterations within the
coding
regions and compatible with function can be isolated using
an expressioncloning approach. Therefore, is
it not surprising
that we have only found five differences in the nucleotide
composition, leading to two amino acid substitutions, within
the encoding sequences of rBAT-2- and rBAT-1-related proteins. These sequence variations could arise by ''errors" in
from mRNA
cDNA synthesis or represent cDNAs synthesized
templates transcribed from different
alleles of the rBATgene.
The majordifferencesbetween
rBAT-1 and rBAT-2 sequences are within the untranslatedregions of the clones. At
the 5'-end, the initiationcodons are found within usual consensus sequences (19) and arepreceded by only short nucleotide sequences. The 5'-ends may not be cmnplete and might
require primerextensionanalysis using the corresponding
mRNAsastemplates
(17). Inthe3"untranslated
region,
rBAT-1 utilizes the first "canonical" polyadenylation consensus signal(20), which is incontrasttorBAT-2,
wherea
noncoding sequence of roughly 1.7 kb is present in the clone.
Interestingly, shifting the rBAT-2
nucleotide sequence by two
positions (TA in rBAT-1) immediately after the polyadenylation signal results in an additional sequence identity of 9 bp
of rBAT-2 contains
between rBAT-1 and rBAT-2. The 3'-end
numerous
AT(U)-rich motifs, which apparently render such
the
mRNA specieshighly unstable(20), suggesting thatthe
rBAT-2-related mRNA might be degraded faster than the
shorterrBAT-1-relatedmRNA
species. Thishypothetical
difference in mRNA degradation/stability might offer an explanation for the apparent lower abundance of the longer
transcript (rBAT-2) in mRNAs isolated from various organs
and various species when compared with
the shorter transcript (rBAT-1) (9); a similar explanation could be valid for
the rat D2-related mRNA, which also shows a short (2.2 kb)
and a long (4.4 kb) mRNA transcript (9, 10, 12). However,
additionalmechanisms responsiblefor
different levels of
rBAT-1 and rBAT-2
Are
1366
InvolvedAmino
in
Acid Transport
B
I
31
-
3.9kB
2.2kB
9
-e
-
&
ControlL-ArgL-Leu
FIG.3. A, in vitrotranslation of rBAT-2 and rBAT-1 cRNAs. The
reactions were performed as described under “Materials and Methods,” in the presence (+) or absence (-) of microsomes. B, Northern
blot analysis of rabbit kidney cortex mRNA using rBAT-1- and
rBAT-2-specific probes. 10 pg of rabbit renal cortex mRNA was
loaded per lane. rBAT-1 probe contains an almost complete rBAT-1
cDNA insert, whereas the rBAT-2-specificprobe is a560-bp sequence
present at the3’-end of rBAT-2 having no homology to the rBAT-1
transcript.
FIG.4. Inhibition by different amino acids of expressed
transport of L-arginine ( A ) and L-leucine ( B ) in oocytes injected with rBAT-2 cRNA. Expressed transport is calculated by
subtracting the intrinsic values (water-injected oocytes) from the
induced transport activity (2.5 ng of rBAT-2 cRNA-injected oocytes).
t-arginine and L-leucine substrate concentrations were 50 pM, and
inhibitors were added at 100-fold higher concentrations (5 mM).
Uptake (10 min at 25 “C) was performed in the absence of sodium on
the second day after injection. Data are shown as means f S.D. for
6-10 oocytes for each condition. The experiment is representative of
three similar experiments.
’Oi
TABLE
I
Expression of L-arginine, L-leucine, and &-cystine uptake by rBAT-2
Amino acid transport was measured in oocytes injected with either
50 nl of water (intrinsic activity) or 50 nl of water containing 2.5 ng
of rBAT-2 cRNA. Two days after injection, L-amino acid uptake was
measured in the absence of sodium (100 mM choline chloride) a t 50
PM substrate concentrations. Data are presented as means f S.D.
using 6-10 oocytes for each condition within an experiment. The
experiment is representative of three similar experiments.
rBAT-2
pml/oocyte, min-l
L-Arginine
L-Leucine
L-Cystine
0.63 f 0.14
0.22 0.01
0.06 f 0.006
*
I
control
S-
c
E
8.
E
’I.
$a
6-
I
.
0
0
5-
0
Uptake
H,O
ControlL-ArgL-Leu
8.5 f 0.46
2.64 f 0.18
1.20 f 0.12
expression of rBAT-1 and rBAT-2 in different tissues might
have to be considered.
Using an expression cloningstrategy, cDNAs with sequence
alterations/truncations that are still compatible with biological function are selected. Therefore, the “selected” cDNA
does not necessarily correspond (at least in length) to the
major mRNA transcript present in the starting material (e.g.
kidney cortex mRNA). As illustrated by the small differences
in the coding region between rBAT-1 and rBAT-2, it also
cannot be guaranteed that thecoding sequenceof an isolated
cDNA indeedcorrespondsto thenative major mRNA species;
possible reasons for minor differences might be due to some
heterogeneity in sequences in the available mRNA species
(e.g. allelic variations), or the differences may be related to
“cloning” artifacts.
Quite frequently, transcripts of different lengths are seen
E,
4-
3.
21-
Chollne
NaCl
Chollne
NaCl
“
Water injected
oocytes
rBAT-2 InJectd
oocytes
FIG.5. Inhibition of L-arginine uptake by L-homoserine in
water and rBAT-2 cRNA-injected oocytes. 50 nl of water or 50
nl of rBAT-2 cRNA (2.5 ng/oocyte) was injected into oocytes, and
after 2days, L-arginine (50 p ~uptake
)
was measured (10 min) in 100
mM sodium chloride- or 100 mM choline chloride-containing media;
L-homoserine was added at a concentration of 5 mM. Data areshown
as means 2 S.D. for 6-10 oocytes for each condition. The experiment
is representativeof three similar experiments.
in Northern blots, of which a single (mostly shorter) cDNA
clone is “encoding”the function. They are usually “assigned”
to the use of different polyadenylation signals. Within the
field of expression cloning of membrane transport systems,
we would like to describe a few examples. The human intes-
rBAT-1 and rBAT-2
Are
Involved
in
tinal Na-glucose cotransporter (SGLT-1) shows transcripts
of 2.2,2.6, and 4.8 kb, respectively, on Northern blots; the
rabbit Na-glucose cotransporter shows only one transcriptof
2.3 kb (24, 25). Similarly with rBAT-l/rBAT-2, the differences between the three separate human Na-glucose mRNA
species have been suggested to be in the 3"untranslated
region. In the recent isolation of the osmotically regulated
renal betaine transporter, a cDNA clone of 2938 bp was
isolated by expression cloning, showing two signals of 2.4 and
3.0 kb, respectively, on the Northern blot (26). Also for the
renal Na-myoinositol cotransporter, a cDNA of 2870 bp encoding full transport activity showed signals of much higher
transcripts on Northern blots, with a band of 10.5 kb being
the most frequent (27). Finally, the murine ecotropic retrovirus receptor, most likely encoding a protein involved in
system y+ amino acid transport activity, shows two transcripts
of7.9/9.0 and 7.0/7.5 kb on Northern blots, whereas the
cDNA insert encoding the receptor/transport function is only
about 2.4 kb in size (5, 6). These above examples seem to be
in contrasttoothertransport
systems, e.g. the different
isoforms of Na/H exchangers, where only one transcript is
observed for each of the isoforms (28-30). Unfortunately, in
the above cases with multiple mRNA transcripts tobe apparently related to one transport function, full sequence information and functional data are notavailable for two or more
of the different mRNA transcripts. Thus, it cannot be predicted whether minor sequence alterations would still result
in functional proteinsand whether major differences between
them are only in the 3"untranslated region, e.g. by the use of
a different polyadenylation signal. For suchconclusions, complete sequencing of different functional cDNA clones would
be required, as was done in the presentstudy for rBAT-1 and
rBAT-2.
It should be mentioned that a cDNA highly homologous to
our rBAT-l/rBAT-2 hasbeen isolated from rat kidney cortex
(12, 13). As these cDNAs encode for asimilarmembrane
protein with only one transmembrane region (type I1 membrane glycoprotein; Refs. 9, 12, and 22), their role in system
bO*+-like amino
acid transport activity remainsunclear. There
are atleast three different possibilities. (i) TherBAT-encoded
protein is indeed the carrier protein and would most likely be
required for function of a homomultimeric structure. (ii) The
rBAT protein would represent an important subunit in a
heteromultimeric carrier complex and would therefore associate with "silent" oocyte components to result in functional
transport activity. (iii) The rBAT protein could be a specific
factor required for specific activation (e.g. by an enzymatic
reaction) of the observed transport activity (9, 12). As discussed in detail in the preceding papers, the rBAT protein
shows some homologies to nonmembrane-bound a-amylases
and a-glucosidases (9, 12), however, without conservation of
the specific amino acid residues required for hydrolytic activity. On the other hand, there is some interesting structural
homology between the rBAT protein and the 4F2 surface
antigen (heavy chain). Surprisingly, injection of 4F2-cRNA
into oocytes showed expression of a system y+-like amino acid
transport activity (13). The above results led us to the pro-
Amino Acid
Transport
1367
posal of an involvement of different proteins (e.g. the rBAT
and 4F2 proteins) as specific subunits in specific amino acid
transport systems (13). Clearly, this concept will require further examination for a better understanding.
In conclusion, we have isolated an rBAT-2 cDNA corresponding to the 3.9-kb transcript seen in Northern blots by
expression cloning. rBAT-2 encodes a protein of677 amino
acids, different only in 2 amino
acids from rBAT-1, as deduced
by comparison with a previously isolated cDNA clone (rBAl"
1)corresponding to a 2.2-kb transcript seen in Northern blots.
Both rBAT-1- and rBAT-2-related proteins are involved in
an identical manner in sodium-independent transport of Ldibasic amino acids, L-cystine, and some neutral L-amino
acids (e.g. L-leucine and L-alanine) via a transport pathway
closely resembling the specificity of system bo*+.
Acknowledgments-We thank B. Stieger for assistance in performing the in vitro translation experiments and M. L. Moore and N.
Mantei for the use of their cDNA library.
1.
2.
3.
4.
5.
6.
7.
8.
9.
REFERENCES
Christensen, H. N. (1990) Physiol. Reu. 7 0 , 43-77
Van Winkle, L. J. (1988) Bhchim. Biophys. Acta 9 4 7 , 173-208
Silhernagl, S. (1988) Physiol. Reu. 68,911-1007
Stevens, B.R., Kaunitz, J. D.,and Wright, E. M. (1984) Annu. Reu. Physiol.
46,417-433
Kim, J. W., Closs, E. I., Albritton, L. M., and Cunningham, J. M. (1991)
Nature 3 5 2 , 725-728
Albritton, L. M., Tseng, L., Scadden, D., and Cunningham, J. M. (1989)
Cell 57,659-666
Wane, H.. Kavanaueh. M. P.. North. R. A,. and Kabat., D. (1991)
.
. Nature
352,729-731
Bertran, J., Werner, A,, Stange, G., Markovich, D., Biber, J., Testar, X.,
Zorzano, A., Palacin, M., and Murer, H. (1992) Biochem. J. 2 8 1 , 717723
Bertran, J., Wener, A., Moore, M. L., Stange, G., Markovich, D., Biher, J.,
Testar, X., Zorzano, A., Palacin, M., and Murer, H. (1992) Proc. Natl.
A ~ & .sei. u. s.A. 8%
S m - S m
",."
Magagnin, S., Bertran, J., Werner, A., Markovich, D., Biber, J., Palacin,
M., and Murer, H. (1992) J. Bid. Chem. 267,15384-15390
Tate, S. S., Yan, N., and Udenfried, S. (1992) Proc. Natl. Acad. Sci. U. S. A .
I
~~~
10.
11.
~
.
~
""
-
SI) 1-5",
12. Wells, R. G., and Hediger, M. A. (1992) Proc. Natl. Acad. Sci. U. S . A. 89,
5596-5600
13. Bertran, J., Magagnin, S., Werner, A,, Markovich, D., Biber, J., Testar, X.,
Zorzano. A.. Kuhn. L. C.. Palacin. M.. and Murer., H. (1992)
.
. Proc. Natl.
Acad. Sci. U . S. A. 89,5606-5610'
'
14. Van Winkle, L. J., Campione, A. L., and Gorman, M. J. (1988) J. Biol.
Chem. 263,3150-3163
15. Stevens, B. R., Ross, H. J., and Wright, E. M. (1982) J. Membr. Biol. 66,
213-225
16. Mircheff, A. K., Kippen, I., Hirayama, B., and Wright, E. M. (1982) J.
Membr. Bwl. 64,113-122
17. Werner, A,, Moore, M. L., Mantei, N., Biher, J., Semenza, G., and Murer,
H. (1991) Proc. Natl. Acad. S a . U. S. A. 88,9608-9612
18. Sanger, F., Nlcklen, S., and Coulson, A.R. (1977) Proc. Natl. Acad. Sci.
U. S. A. 74,5463-5467
19. Kozak, M. (1989) J. Cell Biol. 108,229-241
20. Jackson, R. J., and Standart, N. (1990) Cell 62,15-24
21. Kyte, J., and Doolittle, R. F. (1982) J . Mol. Biol. 1 5 7 , 105-132
22. Holland. E. C.. and Drickamer. K. (1986) J. Biol. Chem. 2 6 1 . 1286-1292
23. Campa, 'M. J., and Kilberg, M.'S. (1989)'J. Cell. Physiol. 141; 645-652
24. Hediger, M. A., Coady, M. J., Ikeda, T. S., and Wright, E. M. (1987) Nature,
xan
"_,_.R ~ Q - R R I
25. Hediger, M. A., Turk, E., and Wright, E. M. (1989) Proc. Not!. Acad. Sei.
U. S. A. 86,5748-5752
26. Yamauchi, A., Uchida, S., Kwon, H. M., Preston, A. S., Roby, R. B., GarciaPerez, A., Burg, M. B., and Handler, J. S. (1992) J. Biol. Chem. 2 6 7 ,
1
"_
6AQ-6.53
""
"
I
27. Kwon, H. M., Yamauchi, A,, Uchida, S., Preston, A. S., Garcia-Perez, A.,
Burg, M. B., and Handler, J. S. (1992) J. Biol. Chem. 267,6297-6301
28. Sardet, C., Franchi, A,, and Pouyssegur, J. (1989) Cell 56, 271-280
29. Tse, C-M., Brant, S. R., Walker, M. S., Pouyssegur, J., and Donowitz, M.
(1992) J. Bid. Chem. 267,9340-9346
30. Orlowski, J., Kandasamy, R. A,, and Shull, G. E. (1992) J. Biol. Chem.
267,9331-9339