Protection of Endothelial Survival by Peroxisome
Proliferator-Activated Receptor-␦ Mediated
14-3-3 Upregulation
Jun-Yang Liou, Sang Lee, Dipak Ghelani, Nevenka Matijevic-Aleksic, Kenneth K. Wu
Downloaded from http://atvb.ahajournals.org/ by guest on June 18, 2017
Objective—To determine the role of prostacyclin (PGI2) in protecting endothelial cells (ECs) from apoptosis and elucidate
the protective mechanism.
Methods and Results—To evaluate the effect of PGI2 on EC survival, we treated ECs with Ad-COX1/PGIS (Ad-COPI),
which augmented selectively PGI2 production or carbaprostacyclin (cPGI2) followed by H2O2 for 4 hours. Ad-COPI
inhibited annexin V–positive cells and blocked caspase 3 activation. cPGI2 inhibited apoptosis in a concentrationdependent manner. L-165041 had a similar effect, suggesting the involvement of peroxisome proliferator-activated
receptor-␦ (PPAR␦). ECs expressed functional PPAR␦. PPAR␦ overexpression enhanced whereas PPAR␦ knockdown
by small interfering RNA abrogated the antiapoptotic action of cPGI2 and L-165041. Our results show for the first time
that PGI2 stimulated 14-3-3␧ expression via PPAR␦ activation. cPGI2 and L-165041 induced binding oaf PPAR␦ to
PPAR response elements located between ⫺1426 and ⫺1477 of 14-3-3␧ promoter region, thereby activating 14-3-3␧
promoter activity and protein expression. Upregulation of 14-3-3␧ proteins resulted in an increase in Bad binding to
14-3-3␧ and a reduction in Bad translocation to mitochondria.
Conclusions—PGI2 protects ECs from H2O2-induced apoptosis by inducing PPAR␦ binding to 14-3-3␧ promoter, thereby
upregulating 14-3-3␧ protein expression. Elevated 14-3-3␧ augments Bad sequestration and prevents Bad-triggered
apoptosis. (Arterioscler Thromb Vasc Biol. 2006;26:1481-1487.)
Key Words: apoptosis 䡲 endothelial cells 䡲 PPAR␦, prostacyclin 䡲 14-3-3
V
ascular endothelial cells (ECs) are metabolically active,
capable of synthesizing an array of compounds in
response to exogenous stimulation. These molecules play
crucial roles in protecting vascular integrity. Among the
molecules, prostacyclin (PGI2) inhibits platelet aggregation,
regulates vascular tone, antagonizes the actions of
thromboxane A2, and protects tissues from apoptosis.1– 4 The
biological actions of PGI2 are mediated by a PGI2-specific
Gs-coupled receptor that signals via the cAMP-dependent
protein kinase A pathway.5 Recent studies suggest that certain
PGI 2 actions may be mediated via the peroxisome
proliferator-activated receptor-␦ (PPAR␦) pathway. Several
PGI2 synthetic analogs such as carbaprostacyclin (cPGI2)
have been shown to bind and activate PPAR␦.6 PPAR␦ is
involved in controlling keratinocyte and cancer cell apoptosis.7,8 cPGI2 has been shown to protect renal cells from
hypertonicity-induced apoptosis, which was attributed to
PPAR␦ activation.9
It is conceivable that EC-derived PGI2 production in
response to exogenous stimuli may, in an autocrine or
paracrine manner, protect ECs from apoptosis. However, this
notion has not been supported by reported data. The aims of
this study were, hence, to determine whether PGI2 protects
ECs from H2O2-induced apoptosis and to elucidate the protective mechanism. Because authentic PGI2 is unstable and
unsuitable for this study, we transduced human umbilical vein
ECs (HUVECs) with an adenoviral vector containing a
bicistronic cyclooxygenase-1 (COX-1) and PGI2 synthase
(PGIS) construct (Ad-COPI), which selectively augment PGI2
synthesis in HUVECs.10 ECs synthesize PGI2 by 3 enzymatic
steps: (1) activation of an 85-kDa cytosolic phospholipase A2,
which catalyzes release of arachidonic acid from membrane
phospholipids; (2) conversion of arachidonic acid into prostaglandin H2 by cyclooxygenases (COX-1 and COX-2); and
(3) conversion of prostaglandin H2 into PGI2 by PGIS.11
These enzymes are colocalized and functionally coupled.12,13
COX-1 and PGIS undergo autoinactivation during catalysis,
thereby limiting the extent of PGI2 synthesis.14 –16 Limitation
of PGI2 production is circumvented by Ad-COPI–induced
cooverexpression of COX-1 and PGIS, which selectively
Original received February 1, 2006; final version accepted April 7, 2006.
From the Vascular Biology Research Center (J.-Y.L., S.L., D.G., K.K.W.), Brown Foundation Institute of Molecular Medicine, and Division of
Hematology (J.-Y.L., S.L., D.G., N.M.-A., K.K.W.), Department of Internal Medicine, Medical School, University of Texas Health Science Center at
Houston.
Correspondence to Kenneth K. Wu, Vascular Biology Research Center, Brown Foundation Institute of Molecular Medicine, and Division of
Hematology, Department of Internal Medicine, Medical School, University of Texas Health Science Center at Houston, Houston, TX 77030-1503. E-mail
[email protected]
© 2006 American Heart Association, Inc.
Arterioscler Thromb Vasc Biol. is available at http://www.atvbaha.org
1481
DOI: 10.1161/01.ATV.0000223875.14120.93
1482
Arterioscler Thromb Vasc Biol.
July 2006
Downloaded from http://atvb.ahajournals.org/ by guest on June 18, 2017
augments PGI2 production without a concurrent increase in
the production of other eicosanoids.10 Thus, Ad-COPI is well
suited for evaluating the effect of authentic PGI2 on EC
survival. The results show that Ad-COPI suppressed annexin
V–positive cells and caspase 3 activation. cPGI2 protected
HUVECs from apoptosis in a concentration-dependent manner. Furthermore, L-165041, a selective PPAR␦ ligand, suppressed H2O2-induced apoptosis, suggesting the involvement
of PPAR␦. HUVECs expressed functional PPAR␦. Overexpression of PPAR␦ by Ad-PPAR␦ enhanced whereas knockdown of PPAR␦ with small interfering RNA (siRNA) abrogated the antiapoptotic action of cPGI2 and L-165041. Our
results reveal for the first time that PGI2 upregulated 14-3-3,
especially 14-3-3␧, in a PPAR␦-dependent manner. cPGI2
induced binding of PPAR␦ to PPAR response elements
(PPREs), thereby activating 14-3-3␧ promoter activity. 143-3␧ is a member of 14-3-3 family, which binds phosphorylated Bad and sequesters Bad in the cytosol.17–20 Our results
show that 14-3-3␧ upregulation amplified Bad binding and
reduced Bad translocation to mitochondria, whereby it inhibited cytochrome c release, caspase 3 activation, and EC
apoptosis.
Materials and Methods
Recombinant Adenoviral Vectors
Ad-COPI vectors were generated by homologous recombination and
amplified in 293 cells as described previously.10 An empty adenovirus (Ad-null) or Ad-GFP was used as a control. Ad-PPAR␦ was
kindly provided by Drs Kinzler and Vogelstein at Johns Hopkins
University, Baltimore, Md. The recombinant viruses were purified
by CsCl density-gradient centrifugation, and the virus titers were
determined by a plaque assay as described previously.10
Cell Culture and Treatment
HUVECs were prepared from freshly obtained umbilical veins and
cultured as described previously.21 In initial experiments, HUVECs
(at passage 3 or 4) grown in a 6-well plate were treated with various
concentrations of H2O2 for various periods of time, and apoptosis
was determined. We found treatment of HUVECs with 0.5 mmol/L
H2O2 for 4 hours to be optimal. To evaluate the effects of cPGI2 and
L-165041 on apoptosis, HUVECs were pretreated with either compound for 4 hours before treatment with H2O2 in serum-free medium
for 4 hours. Based on our previous experimental results,10 we
infected HUVECs with recombinant adenoviruses for 48 hours.
ECV304 cells were maintained in DMEM containing 10% FBS. For
induction of ECV304 apoptosis, cells were treated with 2 mmol/L
H2O2 for 8 hours.
Assay of Apoptosis
Apoptosis was analyzed by flow cytometry using annexin V staining.
Cells were washed with PBS and incubated with a fluorescein
isothiocyanate–labeled annexin V antibody (Beckman Coulter). The
labeled cells were analyzed by flow cytometry (Beckman Coulter
Epics XL). Apoptosis was also analyzed by incubating cells with 1
␮g/mL Hoechst 33258 for 15 minutes and counting positively
stained cells by fluorescent microscopy. Caspase-3 activity was
assayed by flow cytometry using a caspase-3 assay kit (Calbiochem).
Cytochrome c release was analyzed using immunofluorescent microscopy by a method described previously.22 The images were
processed by Adobe Photoshop software. In all the assays, the results
were expressed as percentages of positively stained cells.
Plasmid Constructs and Luciferase Reporter Assay
To construct human 14-3-3␧ vector, the complete coding sequence of
14-3-3␧ was amplified by polymerase chain reaction (PCR) and
cloned into pCDNA3.1⫹ vector (Invitrogen). siRNA of PPAR␦
(sense sequence: ACAGATGAAGACAGATGCACC) was purchased from Applied Biosystems. To achieve high transfection
efficiency, the endothelial-like ECV304 cells were transfected with
14-3-3␧ vector or siRNA-PPAR␦ by Effectene transfection kit
(Quiagene). For cloning 14-3-3␧ promoter, a 1.6-kb (⫺1625 to ⫹24)
5⬘-flanking region of human genomic sequence was amplified by
PCR and cloned into pGL3 luciferase reporter. 5⬘-deletion constructs
(⫺1348 to ⫹24, ⫺787 to ⫹24, ⫺412 to ⫹24 and ⫺47 to ⫹24) were
amplified by PCR and subcloned to pGL3 vector. PPAR␦-specific
response element reporter7 was kindly provided by Drs Kinzler and
Vogelstein. For the luciferase assay, ECV304 cells were transfected
with reporter constructs by Fugene 6 transfection reagent (Roche) for
48 hours. After treatment with cPGI2 or other compounds, cells were
lysed, luciferase activity was measured using a kit from Promega,
and the emitted light was determined in a luminometer. Protein
concentrations of cell lysates were determined by a protein assay kit
(Bio-Rad). Luciferase activity was expressed as relative light unit/␮g
protein.
Preparation of Mitochondrial Fraction
Mitochondrial fractions were prepared by a mitochondria isolation
kit (Sigma) as described previously.22 Nuclear and cytosolic fractions were removed by 2-step gradient centrifugation, and the
pellet-containing mitochondria was collected and stored at ⫺20°C.
heat shock protein 60 (Hsp60) was used as a mitochondrial marker.
Immunoprecipitation
cPGI2- or L-165041–treated HUVECs were harvested and immunoprecipitated with a 14-3-3␧ antibody. The immunoprecipitated complex was pulled down with protein A/G-agarose (Santa Cruz Biotechnology). After washing 5⫻, the proteins were analyzed by
Western blotting using a Bad antibody.
Western Blot Analysis
A total of 25 ␮g of cell lysate proteins were applied to each lane and
analyzed by Western blots as described previously.21 Rabbit polyclonal antibodies against 14-3-3 isoforms (␧, ␥, ␨, and ␪, diluted at
1:250 each) goat polyclonal antibodies against COX-1 (1:1000), and
Hsp60 (1:2000) 14-3-3 isoforms (␴, ␩, and ␤; diluted at 1:500 each)
were purchased from Santa Cruz Biotechnology. Rabbit polyclonal
antibody against PPAR␦ (1:500) was obtained from Cayman Chemical. Rabbit polyclonal antibodies against cleaved poly(ADPribose)polymerase (PARP) (1:500) and Bad (1:500) were purchased
from Cell Signaling. Rabbit polyclonal antibody against PGIS was
prepared as described previously.23
Chromatin Immunoprecipitation
The assay was done as described previously.24 The primers for
amplifying PPRE-containing region are: 5⬘ primer: ⫺1625CCAAGCGCCAGAAGCTG AAG⫺1606, and 3⬘ primer: ⫺1348GAGACAGAGTTGTGCTCTTG⫺1329 and non-PPRE region are: 5⬘ primer ⫺412CGTTACAGCCTCCGTCGTTC⫺393, and 3⬘ primer ⫹4GATGATCGAGAGGATCTGGTG⫹24. The resulting products of 297 bp and
436 bp, respectively, were separated by agarose gel electrophoresis.
Putative PPAR–retinoid X receptor (RXR) binding sites with typical
AGGTCA-X-AGGTCA motif (X denotes any nucleotide) on 143-3␧ promoter region were analyzed with P-Match 1.0 software
(gene-regulation biological databases).
Statistical Analysis
ANOVA software was used to determine statistical differences of
apoptosis, caspase 3 activity, and luciferase activity between groups.
A P value ⬍0.05 is considered to be statistically significant.
Results
PGI2 Inhibited HUVEC Apoptosis Via
PPAR␦ Activation
To evaluate the effect of PGI2 on apoptosis, we transduced
HUVECs with Ad-COPI for 48 hours, which increased
Liou et al
PGI2 Upregulates 14-3-3 Through PPAR␦ Activation
1483
Downloaded from http://atvb.ahajournals.org/ by guest on June 18, 2017
Figure 2. Functional PPAR␦ in ECs. ECV304 cells were transfected with PPRE reporter and treated with cPGI2 (0 to
50 ␮mol/L; A), Ad vectors (50 moi each; B), or siRNA vectors (C)
as indicated. Luciferase expression by PPRE reporter was measured and expressed as relative light unit (RLU)/␮g protein.
Each bar represents mean⫾SD (n⫽3).
Figure 1. Prevention of HUVEC apoptosis. HUVECs were transduced with Ad-COPI or Ad-null (50 mois) for 48 hours (A),
treated with cPGI2 (1 to 100 ␮mol/L; B), or L-165041
(50 ␮mol/L; C) for 4 hours, followed by H2O2 (0.5 mmol/L) for 4
hours. Annexin V–positive cells were analyzed by flow cytometry. Results are expressed as percentages of cells with positive
stains. Each bar represents mean⫾SD (n⫽3). P values were
determined by ANOVA program.
equivalently COX-1 and PGIS protein levels and selectively augmented PGI2 synthesis without an increase in
other eicosanoids as reported previously (supplemental
Figure I, available online at http://atvb.ahajournals.org).
Ad-COPI suppressed H2O2-induced HUVEC apoptosis
(Figure 1A) and caspase 3 activation (supplemental Figure
IIA). cPGI2 reduced annexin V–positive cells induced by
H2O2 in a concentration-dependent manner (Figure 1B),
whereas PGE2 at 50 ␮mol/L did not have an effect (data
not shown). cPGI2 suppressed caspase 3 activation (supplemental Figure IIB). L-165041 also suppressed H2O2induced annexin V cells (Figure 1C), suggesting the
involvement of PPAR␦. Because little was known about
the function of endothelial PPAR␦, we determined the
expression of PPAR␦ proteins in HUVECs by Western
blotting. Basal PPAR␦ was detected, which was increased
by cPGI2 or L-165041 (supplemental Figure IIIA). The
PPAR␦ proteins in ECs are functionally active because a
luciferase reporter containing PPREs was activated by
cPGI2 in a concentration-dependent manner (Figure 2A).
L-165041 induced PPRE reporter expression in a
concentration-dependent manner identical to cPGI2 (data
not shown).
To determine the role of PPAR␦ in regulating the
antiapoptotic activity of PGI2, we transduced HUVECs
with Ad-PPAR␦, which, as expected, increased PPAR␦
protein levels (data not shown). Coinfection of HUVECs
with Ad-PPAR␦ and Ad-COPI augmented the PPRE reporter response by 4-fold over that infected with Ad-GFP
(Figure 2B). Conversely, PPAR␦ knockdown with siRNA
abrogated the PPRE reporter activity induced by cPGI2 or
L-165041 (Figure 2C). Ad-PPAR␦ reduced H2O2-induced
Hoechst-positive cells (Figure 3A), and caspase 3 activation (supplemental Figure IIC) to a similar extent, and
knockdown of PPAR␦ expression abrogated the antiapoptotic action of cPGI2 and L-165041 (Figure 3B). Together, these results suggest an essential role of PPAR␦
activation in PGI2-mediated antiapoptotic action.
Upregulation of 14-3-3 Proteins by
PPAR␦ Activation
We hypothesized that PPAR␦ suppresses apoptosis by
upregulating a survival factor in ECs. We screened a
number of factors and identified 14-3-3 as a potential
target. HUVECs expressed predominantly 14-3-3␧, ␪, ␨,
and ␥ isoforms (Figure 4A). 14-3-3 ␤, ␩, and ␴ proteins
were barely detectable (Figure 4A). 14-3-3␧ was increased
by cPGI2 and L-165041 to a similar extent (⬎3-fold).
14-3-3␪ and 14-3-3␨ were increased by a lesser extent,
whereas 14-3-3␥ was unaltered (Figure 4A). We focused
on 14-3-3␧ in our subsequent experiments. Ad-PPAR␦
increased 14-3-3␧ by ⬇2-fold and augmented the effect of
cPGI2 or L-165041 by an additional 2-fold (Figure 4B).
1484
Arterioscler Thromb Vasc Biol.
July 2006
Downloaded from http://atvb.ahajournals.org/ by guest on June 18, 2017
Figure 3. Regulation of HUVEC apoptosis by PPAR␦. A,
HUVECs transduced with the indicated Ad vector were treated
with H2O2 for 4 hours. Percentages of Hoechst-positive cells
were determined by microscopy. Each bar represents
mean⫾SD (n⫽3). B, ECV304 cells transfected with siRNA or
control were treated with cPGI2 or L-165041 (10 ␮mol/L each)
for 4 hours, followed by H2O2 for 4 hours. PARP cleavage was
determined by Western blotting. This figure is representative of
2 experiments.
PPAR␦ siRNA abrogated 14-3-3␧ protein levels induced
by cPGI2 or L-165041 (Figure 4C). The control siRNA
vector had no effect. Together, these results indicate that
14-3-3␧ expression is regulated by PPAR␦ activation.
Requirement of PPREs for PGI2-Induced 14-3-3␧
Transcriptional Activation
To determine whether PGI2 stimulates 14-3-3␧ expression
via PPAR␦-mediated transcriptional activation, we transfected ECs with the 1.6-kb (⫺1625 to ⫹24) 14-3-3␧
Figure 4. Upregulation of 14-3-3 by cPGI2 and L-165041. A,
HUVECs were treated with cPGI2 (50 ␮mol/L) or L-165041
(50 ␮mol/L) for 4 hours and transduced with the indicated Ad and
treated with cPGI2 or L-165041 (B). C, ECV304 cells transfected
with siRNA were treated with cPGI2 or L-165041. 14-3-3 proteins
were analyzed by Western blots. For B and C, the top shows a
representative blot and the bottom, densitometry (n⫽3).
promoter vector. cPGI2 and L-165041 increased the luciferase activity by ⬇2-fold over the control (supplemental
Figure IIIB), which was abrogated by specific PPAR␦
siRNA (Figure 5A). Analysis of this promoter region with
P-Match 1.0 revealed 3 contiguous canonical PPREs located at ⫺1426/⫺1438, ⫺1444/⫺1456, and ⫺1465/
⫺1477. To determine whether they are required for 143-3␧ promoter activity, we constructed several 5⬘-deletion
mutants into pGL3 expression vector and transfected them
Liou et al
PGI2 Upregulates 14-3-3 Through PPAR␦ Activation
1485
14-3-3␧ Protected ECs From Apoptosis
Downloaded from http://atvb.ahajournals.org/ by guest on June 18, 2017
Because 14-3-3 binds and sequesters Bad19 and cPGI2 and
L-165041 increase 14-3-3␧ protein levels, we determined
whether 14-3-3␧ upregulation amplified Bad binding. ECs
were treated with cPGI2, L-165041, or vehicle, and the cell
lysate was immunoprecipitated with a 14-3-3␧ antibody.
Bad proteins in the precipitate were analyzed by Western
blots. Both cPGI2 and L-165041 increased Bad binding to
14-3-3␧ (Figure 6A). In view of increased binding by
14-3-3␧, we anticipated that cPGI2 and L-165041 suppress
Bad translocation to mitochondria. To test this, we prepared mitochondrial fractions from ECs treated with and
without H2O2, cPGI2, or L-165041. Hsp60 was included as
a mitochondrial marker. The results show that H2O2
increased Bad in the mitochondrial fraction consistent with
Bad translocation (Figure 6B). Pretreatment of cells with
cPGI2 or L-165041 blocked H2O2-induced Bad translocation to mitochondria (Figure 6B). H2O2-induced Bad mitochondrial translocation resulted in increased cytochrome
c release into cytosol, which was suppressed by cPGI2
(supplemental Figure IV). The role of 14-3-3␧ in regulating Bad-mediated apoptosis was further supported by
14-3-3␧ overexpression. Transfection of cells with 14-3-3␧
vector reduced H2O2-induced PARP cleavage to the basal
level (Figure 6C). 14-3-3␧ overexpression also suppressed
the basal PARP cleavage.
Discussion
Figure 5. PPAR␦-dependent activation of 14-3-3␧ promoter
activity. A, ECV304 cells were transfected with 1.6-kb promoter construct with or without PPAR␦-siRNA, followed by
cPGI2 or L-165041. B, ECV304 cells transduced with the indicated Ad vector were transfected with wild-type or
5⬘-deletion mutants shown at the top. Each bar represents
mean⫾SD (n⫽3); **P⬍0.01. C, Chromatin immunoprecipitation analysis of PPAR␦ binding to 14-3-3␧ promoter. Binding
was detected at ⫺1625/⫺1328, which harbors PPREs but not
at control ⫺412/⫹24.
into ECV304. Ad-COPI increased the wild-type (p1625)
promoter activity, which was enhanced by Ad-PPAR␦
(Figure 5B). Deletion of the PPRE-containing region such
as in the p1348 mutant abolished the response to Ad-COPI
and Ad-PPAR␦. Shorter 5⬘-deletion mutants (ie, p787 and
p412) failed to respond to Ad-COPI or Ad-PPAR␦ but
retained the basal promoter activity. Basal promoter activity was completely abolished in the p47 mutant (Figure
5B). To ascertain PPAR␦ binding to 14-3-3␧ promoter, we
performed chromatin immunoprecipitation with a PPAR␦specific antibody. There was little basal PPAR␦ binding to
14-3-3␧, and its binding was enhanced by cPGI2 and
L-165041 to a similar extent (Figure 5C). As controls,
PPAR␦ binding was not detected with nonimmune IgG or
with a DNA sequence located at the proximal region of the
14-3-3␧ promoter (Figure 5C).
Results from this study provide strong evidence for EC
protection by PGI2. Authentic PGI2 generated by Ad-COPI
transduction and the synthetic cPGI2 protected HUVECs
and ECV304 cells from H2O2-induced apoptosis in a
PPAR␦-dependent manner. Several pieces of evidence
support the requirement of PPAR␦ activation for the
antiapoptotic action of PGI2. First, HUVECs expressed
functional PPAR␦, which prevented H2O2-induced apoptosis. Second, PPAR␦ suppression by siRNA abrogated the
protective action of PGI2 or L-165041. Third, overexpression of PPAR␦ amplified the antiapoptotic action of PGI2.
It was reported that PPAR␦ protected keratinocytes from
apoptosis by upregulating the expression of phosphoinositide-dependent kinase (PDK) and activation of Akt.25 In
this study, we evaluated the effect of PGI2 and L-165041
on PDK-1 and Akt in HUVECs and did not detect changes
in PDK-1 protein level or phosphorylated Akt (data not
shown). In contrast, our results identified 14-3-3␧ as the
PPAR␦-driven antiapoptotic gene. Ad-COPI, cPGI2, and
L-165041 increased 14-3-3␧ protein expression, which was
abrogated by PPAR␦ siRNA and enhanced by Ad-PPAR␦.
Importantly, our results provide direct evidence for the first time
for transcriptional activation of 14-3-3␧ by PPAR␦. These
results demonstrate the requirement of PPREs for PGI2-induced
14-3-3␧ promoter activation because deletion of the PPREcontaining region of 14-3-3␧ promoter nullified the promoter
response to Ad-COPI, Ad-PPAR␦, or their combination. Activated PPAR␦ forms a heterodimer with RXR and the heterodimer binds to PPREs, which comprise 2 identical hexamers
with a single nucleotide in between via which transcription is
activated.26 The 5⬘-flanking promoter region of 14-3-3␧ harbors
1486
Arterioscler Thromb Vasc Biol.
July 2006
Downloaded from http://atvb.ahajournals.org/ by guest on June 18, 2017
Figure 6. Role of 14-3-3␧ in antiapoptosis. A, HUVECs were treated with cPGI2
or L-165041 for 4 hours. Cell lysates
were immunoprecipitated with 14-3-3␧
antibody, and Bad in immunoprecipitation was analyzed. B, HUVECs were
treated as indicated, and Bad and Hsp60
in mitochondrial fraction was analyzed.
C, ECV304 cells transfected with the
indicated vectors were treated with H2O2.
Cleaved PARP was analyzed by Western
blots. D, Schematic illustration of the
protective mechanism of PGI2 via
PPAR␦-dependent 14-3-3␧ upregulation.
3 canonical PPREs that are located contiguously between
⫺1426 and ⫺1477. Deletion of these PPREs results in loss of
promoter response to cPGI2 or L-165041. Our data show that
cPGI2 and L-165041 induced binding of PPAR␦ specifically to
this promoter region in vivo. Together, the results indicate that
14-3-3␧ is a direct target of PPAR␦, and its transcriptional
activation depends on PPAR␦ activation.
Seven isoforms of 14-3-3 proteins have been identified
in mammalian cells. They share sequence homology and
biochemical properties.17 Because 14-3-3 expression in
ECs has not been reported, we analyzed their protein levels
in HUVECs. Results show that basal 14-3-3␥ and 14-3-3␧
were detected at a higher density than other isoforms, and
basal 14-3-3␤, ␩, and ␴ were barely detectable. Because
the affinity of antibodies for each isoform may vary, the
isoform abundance cannot be accurately determined, and
the data should be interpreted with caution. However,
response to stimulation by PPAR␦ activation is clearly
isoform specific. 14-3-3␧, and to a lesser extent 14-3-3␪,
proteins are significantly upregulated by cPGI 2 or
L-165041. 14-3-3 are cytosolic proteins serving as a
scaffold to interact with a large number of proteins.27 They
play a role in protecting cells from apoptosis through their
binding and sequestering phosphorylated Bad in cytosol.19
Under apoptotic stimulation, Bad is dissociated from
14-3-3 and translocated to mitochondria, where it interacts
with Bcl-XL and disrupts the protective function of BclXL, resulting in outer membrane permeabilization, release
of cytochrome c, and activation of caspase 9 and 3.28 Our
results confirm that H2O2 induces Bad translocation to
mitochondria in HUVECs, suggesting that the basal 14-3-3
protein levels were inadequate for preventing Bad translocation. Because cPGI2 and L-165041 increase 14-3-3␧ and
augment 14-3-3␧ binding of Bad, their prevention of Bad
translocation is attributed to elevated 14-3-3␧. These
findings reveal for the first time that constitutively expressed 14-3-3␧ is transcriptionally regulated by PPAR␦,
and its upregulation confers resistance to the H2O2-induced
apoptosis. Together, our findings shed light on a novel
mechanism by which PGI2 protects ECs from apoptosis. As
illustrated in Figure 6D, we propose that PGI2 binds and
activates PPAR␦, which forms a heterodimer with RXR
and binds to specific PPREs on 14-3-3␧ promoter. PPAR␦mediated 14-3-3␧ upregulation increases the capacity of
14-3-3␧ to bind and sequester Bad, thereby reducing Bad
translocation to mitochondria and the consequent caspase 3
activation and apoptosis. It is important to note that this
protective signaling pathway is enforced by a positive
Liou et al
PGI2 Upregulates 14-3-3 Through PPAR␦ Activation
Downloaded from http://atvb.ahajournals.org/ by guest on June 18, 2017
feedback regulation. Our results show that cPGI2 and
L-165041 increased PPAR␦ protein levels by ⬇3-fold. To
our knowledge, the positive feedback regulation of PPAR␦
expression has not reported previously, and the mechanism
by which this occurs is unclear. Nevertheless, feedback
upregulation of PPAR␦ by its ligands is important in
amplifying the PPAR␦314-3-3␧ protection program.
To demonstrate the antiapoptotic action of PGI2, we
transduced HUVECs with Ad-COPI, which selectively
increased PGI2 production. The results show a consistent
inhibition of H 2 O 2 -induced annexin V–positive and
Hoechst-positive cells and caspase 3 activation. cPGI2 had
a similar effect as Ad-COPI, except that high concentrations of cPGI2 were required to inhibit H2O2-induced
apoptosis. One intriguing question is whether the intracellularly produced PGI2 by Ad-COPI acts directly on PPAR␦
without secretion into the extracellular milieu. It has been
shown that PPAR␦ is distributed in cytosol and nucleus of
ECs.29 Because intracellular PGI2 is produced at the
perinuclear membrane, PGI2 may bind cytosolic PPAR␦
and facilitates its translocation or, alternatively, may enter
nucleus, where it binds and activates PPAR␦. There is little
published data on this issue, which requires further investigation. Ad-COPI gene transfer has been shown to protect
neurons from ischemia-reperfusion injury in vivo,30 which
may be attributed to the antiapoptotic action of PGI2. This
gene transfer approach has potential for protecting blood
vessels and treating vascular diseases.
Acknowledgments
We thank Drs Vogelstein and Kinzler for providing Ad-PPAR␦ and
PPAR␦ response element reporter, Dr Jaou-Chen Huang for statistic
analysis, Shao-Tzu Tang and Hui-Ping Tseng for technical assistance, and Dr Song-Kun Shyue for performing high-performance
liquid chromatography analysis.
Sources of Funding
This work was supported by National Institutes of Health grants
R01-HL-50675 and P50-NS-23327.
Disclosures
None.
References
1. Moncada S, Vane JR. Pharmacology and endogenous roles of prostaglandin endoperoxides, thromboxane A2, and prostacyclin. Pharmacol
Rev. 1978;30:293–331.
2. Adderley SR, Fitzgerald DJ. Oxidative damage of cardiomyocytes is
limited by extracellular regulated kinases 1/2-mediated induction of cyclooxygenase-2. J Biol Chem. 1999;274:5038 –5046.
3. Cheng Y, Austin SC, Rocca B, Koller BH, Coffman TM, Grosser T,
Lawson JA, FitzGerald GA. Role of prostacyclin in the cardiovascular
response to thromboxane A2. Science. 2002;296:539 –541.
4. Hao CM, Komhoff M, Guan Y, Redha R, Breyer MD. Selective targeting
of cyclooxygenase-2 reveals its role in renal medullary interstitial cell
survival. Am J Physiol. 1999;277:F352–F359.
5. Narumiya S, Sugimoto Y, Ushikubi F. Prostanoid receptors: structures,
properties, and functions. Physiol Rev. 1999;79:1193–1226.
6. Forman BM, Chen J, Evans RM. Hypolipidemic drugs, polyunsaturated
fatty acids, and eicosanoids are ligands for peroxisome proliferator-activated receptors alpha and delta. Proc Natl Acad Sci U S A. 1997;94:
4312– 4317.
1487
7. He TC, Chan TA, Vogelstein B, Kinzler KW. PPAR␦ is an APCregulated target of nonsteroidal anti-inflammatory drugs. Cell. 1999;99:
335–345.
8. Tan NS, Michalik L, Noy N, Yasmin R, Pacot C, Heim M, Fluhmann B,
Desvergne B, Wahli W. Critical roles of PPAR beta/delta in keratinocyte
response to inflammation. Genes Dev. 2001;15:3263–3277.
9. Hao CM, Redha R, Morrow J, Breyer MD. Peroxisome proliferator-activated receptor ␦ activation promotes cell survival following hypertonic
stress. J Biol Chem. 2002;277:21341–21345.
10. Shyue SK, Tsai MJ, Liou JY, Willerson JT, Wu KK. Selective augmentation of prostacyclin production by combined prostacyclin synthase and
cyclooxygenase-1 gene transfer. Circulation. 2001;103:2090 –2095.
11. Wu KK. Inducible cyclooxygenase and nitric oxide synthase. Adv
Pharmacol. 1995;33:179 –207.
12. Liou JY, Shyue SK, Tsai MJ, Chung CL, Chu KY, Wu KK. Colocalization of prostacyclin synthase with prostaglandin H synthase-1
(PGHS-1) but not phorbol ester-induced PGHS-2 in cultured endothelial
cells. J Biol Chem. 2000;275:15314 –15320.
13. Schievella AR, Regier MK, Smith WL, Lin LL. Calcium-mediated translocation of cytosolic phospholipase A2 to the nuclear envelope and
endoplasmic reticulum. J Biol Chem. 1995;270:30749 –30754.
14. Sanduja SK, Tsai AL, Matijevic-Aleksic N, Wu KK. Kinetics of prostacyclin synthesis in PGHS-1-overexpressed endothelial cells. Am J
Physiol. 1994;267:C1459 –C1466.
15. Ham EA, Egan RW, Soderman DD, Gale PH, Kuehl FA Jr. Peroxidasedependent deactivation of prostacyclin synthetase. J Biol Chem. 1979;
254:2191–2194.
16. Egan RW, Paxton J, Kuehl FA Jr. Mechanism for irreversible selfdeactivation of prostaglandin synthetase. J Biol Chem. 1976;251:
7329 –7335.
17. Fu H, Subramanian RR, Masters SC. 14-3-3 proteins: structure, function,
and regulation. Annu Rev Pharmacol Toxicol. 2000;40:617– 647.
18. Datta SR, Dudek H, Tao X, Masters S, Fu H, Gotoh Y, Greenberg ME.
Akt phosphorylation of BAD couples survival signals to the cell-intrinsic
death machinery. Cell. 1997;91:231–241.
19. Zha J, Harada H, Yang E, Jockel J, Korsmeyer SJ. Serine phosphorylation
of death agonist BAD in response to survival factor results in binding to
14-3-3 not BCL-X(L). Cell. 1996;87:619 – 628.
20. Zhou XM, Liu Y, Payne G, Lutz RJ, Chittenden T. Growth factors
inactivate the cell death promoter BAD by phosphorylation of its BH3
domain on Ser155. J Biol Chem. 2000;275:25046 –25051.
21. Xu XM, Sansores-Garcia L, Chen XM, Matijevic-Aleksic N, Du M, Wu KK.
Suppression of inducible cyclooxygenase-2 gene transcription by aspirin and
sodium salicylate. Proc Natl Acad Sci U S A. 1999;96:5292–5297.
22. Liou JY, Aleksic N, Chen SF, Han TJ, Shyue SK, Wu KK. Mitochondrial
localization of cyclooxygenase-2 and calcium-independent phospholipase
A2 in human cancer cells: implication in apoptosis resistance. Exp Cell
Res. 2005;306:75– 84.
23. Shyue SK, Ruan KH, Wang LH, Wu KK. Prostacyclin synthase active
sites. Identification by molecular modeling-guided site-directed
mutagenesis. J Biol Chem. 1997;272:3657–3662.
24. Deng WG, Zhu Y, Wu KK. Role of p300 and PCAF in regulating
cyclooxygenase-2 promoter activation by inflammatory mediators. Blood.
2004;103:2135–2142.
25. Di-Poı̈ N, Tan NS, Michalik L, Wahli W, Desvergne B. Antiapoptotic
role of PPAR␤ in keratinocytes via transcriptional control of the Akt1
signaling pathway. Mol Cell. 2002;10:721–733.
26. Kliewer SA, Forman BM, Blumberg B, Ong ES, Borgmeyer U, Mangelsdorf
DJ, Umesono K, Evans RM. Differential expression and activation of a
family of murine peroxisome proliferator-activated receptors. Proc Natl Acad
Sci U S A. 1994;91:7355–7359.
27. Tzivion G, Avruch J. 14-3-3 proteins: active cofactors in cellular regulation by serine/threonine phosphorylation. J Biol Chem. 2002;277:
3061–3064.
28. Zha J, Harada H, Osipov K, Jockel J, Waksman G, Korsmeyer SJ. BH3
domain of BAD is required for heterodimerization with BCL-XL and
pro-apoptotic activity. J Biol Chem. 1997;272:24101–24104.
29. Bishop-Bailey D, Hla T. Endothelial cell apoptosis induced by the
peroxisome proliferator-activated receptor (PPAR) ligand 15-deoxyDelta12, 14-prostaglandin J2. J Biol Chem. 1999;274:17042–17048.
30. Lin H, Lin TN, Cheung WM, Nian GM, Tseng PH, Chen SF, Chen JJ,
Shyue SK, Liou JY, Wu CW, Wu KK. Cyclooxygenase-1 and bicistronic cyclooxygenase-1/prostacyclin synthase gene transfer protect
against ischemic cerebral infarction. Circulation. 2002;105:
1962–1969.
Downloaded from http://atvb.ahajournals.org/ by guest on June 18, 2017
Protection of Endothelial Survival by Peroxisome Proliferator-Activated Receptor-δ
Mediated 14-3-3 Upregulation
Jun-Yang Liou, Sang Lee, Dipak Ghelani, Nevenka Matijevic-Aleksic and Kenneth K. Wu
Arterioscler Thromb Vasc Biol. 2006;26:1481-1487; originally published online April 27, 2006;
doi: 10.1161/01.ATV.0000223875.14120.93
Arteriosclerosis, Thrombosis, and Vascular Biology is published by the American Heart Association, 7272
Greenville Avenue, Dallas, TX 75231
Copyright © 2006 American Heart Association, Inc. All rights reserved.
Print ISSN: 1079-5642. Online ISSN: 1524-4636
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://atvb.ahajournals.org/content/26/7/1481
Data Supplement (unedited) at:
http://atvb.ahajournals.org/content/suppl/2006/04/27/01.ATV.0000223875.14120.93.DC1
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Arteriosclerosis, Thrombosis, and Vascular Biology can be obtained via RightsLink, a service of the
Copyright Clearance Center, not the Editorial Office. Once the online version of the published article for
which permission is being requested is located, click Request Permissions in the middle column of the Web
page under Services. Further information about this process is available in the Permissions and Rights
Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Arteriosclerosis, Thrombosis, and Vascular Biology is online
at:
http://atvb.ahajournals.org//subscriptions/