RESEARCH ARTICLE
Characterization of the gacA-dependent surface and coral
mucus colonization by an opportunistic coral pathogen Serratia
marcescens PDL100
Cory J. Krediet1, Emily M. Carpinone2, Kim B. Ritchie3,4 & Max Teplitski1,4
1
Interdisciplinary Ecology, University of Florida-IFAS, Gainesville, FL, USA; 2Microbiology and Cell Science Undergraduate Program, University of
Florida-IFAS, Gainesville, FL, USA; 3Mote Marine Laboratory, Sarasota, FL, USA; and 4Soil and Water Science Department, University of
Florida-IFAS, Gainesville, FL, USA
Correspondence: Max Teplitski, University
of Florida-IFAS, PO Box 103610, Gainesville,
FL 32610-3610, USA. Tel.: +1 352 273 8195;
fax: +1 352 273 8284; e-mail: [email protected]
Received 25 May 2012; revised 5 November
2012; accepted 11 December 2012.
Final version published online 14 January
2013.
DOI: 10.1111/1574-6941.12064
MICROBIOLOGY ECOLOGY
Editor: Patricia Sobecky
Keywords
coral microbiology; GacS/GacA; Serratia
marcescens.
Abstract
Opportunistic pathogens rely on global regulatory systems to assess the environment and to control virulence and metabolism to overcome host defenses
and outcompete host-associated microbiota. In Gammaproteobacteria, GacS/
GacA is one such regulatory system. GacA orthologs direct the expression of
the csr (rsm) small regulatory RNAs, which through their interaction with
the RNA-binding protein CsrA (RsmA), control genes with functions in carbon metabolism, motility, biofilm formation, and virulence. The csrB gene
was controlled by gacA in Serratia marcescens PDL100. A disruption of the
S. marcescens gacA gene resulted in an increased fitness of the mutant on
mucus of the host coral Acropora palmata and its high molecular weight fraction, whereas the mutant was as competitive as the wild type on the low
molecular weight fraction of the mucus. Swarming motility and biofilm formation were reduced in the gacA mutant. This indicates a critical role for
gacA in the efficient utilization of specific components of coral mucus and
establishment within the surface mucopolysaccharide layer. While significantly affecting early colonization behaviors (coral mucus utilization, swarming motility, and biofilm formation), gacA was not required for virulence of
S. marcescens PDL100 in either a model polyp Aiptasia pallida or in brine
shrimp Artemia nauplii.
Introduction
Opportunistic bacterial pathogens, including Serratia
marcescens, can infect a number of hosts including plants,
invertebrates and vertebrate animals (Kurz et al., 2003;
Grimont & Grimont, 2006; Nehme et al., 2007). Serratia
marcescens PDL100 is a coral necrotizing pathogen associated with white pox disease in the coral Acropora palmata
(Patterson et al., 2002; Sutherland et al., 2011). The
establishment of S. marcescens PDL100 on the surfaces of
the host coral is tentatively linked to its ability to degrade
components of coral mucus and outcompete native
mucus-associated bacteria (Ritchie, 2006; Krediet et al.,
2009a, b). However, little is known about the virulence
mechanisms on which this pathogen relies to infect
corals.
ª 2012 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
Understanding the genetics of virulence in coral pathogens is important for several reasons. First, it will help
establish evolutionarily conserved virulence mechanisms
in multi-host pathogens (like S. marcescens). Second, this
knowledge will allow for comparison of virulence strategies employed by necrotizing and bleaching-inducing
coral pathogens. Lastly, defining the genetics of virulence
in coral pathogens will help address the uncertainties surrounding coral diseases, specifically, some of the current
debates on the issue still focuses on the question whether
coral diseases are true microbially induced pathologies or
whether ‘coral diseases’ are just secondary signs associated
with uncontrolled proliferation of microorganisms or various stress responses of the corals.
In this study, we chose to focus on the role of the
GacS/GacA two-component regulatory system in the
FEMS Microbiol Ecol 84 (2013) 290–301
291
gacA regulates swarming and coral mucus colonization by Serratia marcescens
interactions of the necrotizing coral pathogen S. marcescens PDL100 using a model sea anemone, Aiptasia pallida, and brine shrimp Artemia nauplii. GacS/GacA is
one of the two-component regulatory systems controlling virulence and motility in Gammaproteobacteria
(Goodier & Ahmer, 2001). Upon perception of a signal,
GacS orthologs autophosphorylate and then transphosphorylate GacA (Pernestig et al., 2001). Recently, the
metabolic end products formate and acetate were found
to stimulate BarA (the GacS homolog in Escherichia
coli); however, these stimuli may be specific to individual species, strains, or culture conditions (Chavez et al.,
2010). GacA is a FixJ/LuxR transcriptional regulator,
which is activated by transphosphorylation (typically, by
GacS, Pernestig et al., 2001; Teplitski et al., 2003). Even
though most gacA orthologs were identified as defective
in motility, virulence, or production of secondary
metabolites, all regulatory effects of GacA are likely
through its control of the Csr (Rsm) post-transcriptional regulatory system (Lapouge et al., 2008; Brencic
et al., 2009). Phosphorylated GacA is thought to dimerize and then binds within promoters of the small
regulatory csr RNAs (Suzuki et al., 2002; Teplitski et al.,
2006a, b). The csr sRNAs bind to and sequester the
regulatory protein CsrA (Romeo et al., 1993; Romeo,
1998). Binding of free CsrA to messages either stabilizes
them or targets them for degradation, and this provides
global post-transcriptional regulation of genes involved
in virulence, quorum sensing, motility, carbon acquisition,
and biofilm formation (Romeo et al., 1993; Romeo,
1998; Jones et al., 2008; Timmermans & Van Melderen,
2010).
GacA has been characterized in only two species of
Serratia. In Serratia plymuthica, GacA regulated the
production of antifungal compounds, quorum sensing, and
degradation of chitin (Ovadis et al., 2004). In S. marcescens
39006, GacS/GacA controls synthesis of the prodigiosin
pigment (Williamson et al., 2006).
Based on the role of the GacA orthologs in virulence
and carbon metabolism in Gammaproteobacteria (Romeo,
1998; Pernestig et al., 2003; Lapouge et al., 2008), we
hypothesized that GacA regulates carbon source utilization and virulence of an opportunistic pathogen, S. marcescens PDL100. To test this hypothesis, a S. marcescens
gacA disruption mutant was constructed. Consistent with
the evolutionarily conserved regulatory function of GacA,
downstream expression of csrB was strongly reduced in
the gacA mutant compared with the wild type. Upon validation of the mutant, we tested the hypothesis that GacA
regulation was important for the ability of the pathogen
to establish within coral mucus and for the control of
early colonization behaviors (swarming motility and
biofilm formation).
FEMS Microbiol Ecol 84 (2013) 290–301
Materials and methods
Bacterial strains and culture conditions
Bacterial strains and plasmid used in this study are listed
in Table 1. Bacteria were maintained at 80 °C in 35%
(v/v) glycerol in LB (Fisher Scientific, Atlanta, GA) or
marine broth (Difco, Becton Dickinson and Company,
Franklin Lakes, NJ). Isolated colonies were recovered on
LB or marine agar (1.5%) plates with or without antibiotics as described below. Serratia strains were routinely
grown at 30 °C and E. coli at 37 °C. Unless otherwise
specified, cultures were supplemented with the following
antibiotics: 10 lg mL 1 tetracycline (Tc10); 50 lg mL 1
kanamycin (Km50); 50 lg mL 1 gentamycin (Gm50);
and 400 lg mL 1 carbenicillin (Cb400).
Coral mucus was collected from colonies of A. palmata
at Looe Key Reef, Florida (24°32.764″N: 81°24.304″W),
in July 2011 as previously described (Ritchie, 2006). Based
on a visual assessment, colonies were deemed to be free
of signs of known coral diseases. To prepare mucus as a
growth medium, samples were prefiltered through glass
fiber filter followed by filtration through a 0.22-lm MCE
filter. Aliquots of the sample were then size-fractionated
using VivaSpin-15 spin dialysis assemblies (Sartorium
Stedim Biotech, Goettingen, Germany). High molecular
weight fractions (> 5 kDa) were brought up to volume in
filter-sterilized artificial seawater (ASW; Red Sea Coral
Pro Salt, Eilat, Israel) as described previously (Krediet
et al., 2009a, b).
Strain and plasmid construction
Primer sequences and descriptions are listed in Table 2.
Genomic DNA was isolated from S. marcescens PDL100
using a GenElute Bacterial Genomic DNA Extraction Kit
(Sigma-Aldrich, St. Louis, MO). Plasmids were purified
using the QIAprep Spin Miniprep Kit (Qiagen, Valencia,
CA), and PCR products were purified using the Illustra
GFX PCR DNA and Gel Band kit (GE Healthcare, Piscataway, NJ).
To construct the gacA disruption mutant, a 283-bp
internal fragment of gacA from PDL100 was amplified
using primers CJK136 and CJK138, and the resulting
PCR product was initially cloned into pCR2.1 (Invitrogen) to make pCJK19, confirmed by M13F/R PCR and
directionally subcloned into the EcoRI-SalI site of
pVIK112 to make pCJK20. All constructed plasmids were
transformed into chemically competent or electrocompetent E. coli DH5a, and when necessary, moved into
PDL100 by triparental conjugation with pRK600 as a
helper plasmid. Single-crossover insertion mutation was
confirmed by PCR with CJK12 and the lacZ primer from
ª 2012 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
292
C.J. Krediet et al.
Table 1. Bacterial strains and plasmids
Isolate or strain
Escherichia coli isolates
DH5a
DH5a k-pir
Serratia marcescens isolates
Serratia marcescens PDL100
Serratia marcescens CJKGacA3
Plasmids
pRK600
pCR2.1-TOPO
pBBR1-MCS5
pVIK112
pSB377
pCJK8
pCJK9
pCJK19
pCJK20
pCJK21
pCJK22
Relevant characteristic(s)
Source or reference
F-φ80lacZDM15 D(lacZYA-argF) U169
recA1 endA1 hsdR17 (rk-, mk+)
phoA supE44 k- thi-1 gyrA96 relA1
DH5a lysogenized with a bacteriophage
k434 derivative containing the pir gene
Invitrogen
Macinga et al. (1995)
Coral pathogen isolated from white
pox lesion, ATCC BAA-632, TetR
PDL100 with a disruption mutation in
gacA; gacA::lacZ, KmR
Patterson et al. (2002)
ColE1 replicon with RK2 tra genes,
conjugation helper plasmid, CmR
Cloning vector; KmR
Cloning vector, GmR
lacZY for transcriptional fusions, KmR
Promoter probe plasmid with 5.8-kb
luxCDABE cassette, CbR
pCR2.1-csrB from PDL100, KmR
PDL100 csrB promoter cloned into EcoRI
site upstream of luxCDABE cassette of
pSB337, CbR
Internal region of gacA amplified from
PDL100 and cloned into pCR2.1, KmR
Internal region of gacA from pCJK19 subcloned
into EcoRI/SalI site of pVIK112, KmR
Full-length gacA amplified from PDL100 and
cloned into pCR2.1. KmR
Full-length gacA from PDL100 from pCJK21
subcloned into EcoRI site of pBBR1-MCS5, GmR
Karunakaran et al. (2005)
This study
Invitrogen
Kovach et al. (1995)
Kalogeraki & Winans (1997)
Winson et al. (1998)
This study
This study
This study
This study
This study
This study
CbR, carbenicillin resistance; CmR, chloramphenicol resistance; GmR, gentamicin resistance; KmR, kanamycin resistance; TetR, tetracycline
resistance.
Table 2. Primers used for PCR
Primer name
DNA primers
M13F
M13R
CJK12
CJK18
CJK136
CJK138
CJK64
CJK87
CJK63
BA974
BA184
qPCR primers
CJK164
CJK165
CJK166
CJK167
Sequence
Description/target
Reference
GTAAAACGACGGCCAG
CAGGAAACAGCTATGAC
GGAGATTTTTCCTTGATTAGCGTTCT
TCGTCACGCAAAAGAACATTATATC
CATCATGTTGACTATCCATACTGAAAATC
GTCGACACTGCTCCGAGATCTCATTCACTT
ACCGAATCCGAGATGACGATGGT
GCTTTCCTGCTCCGCCGGTT
GATGGGCATGTTCGTCAACGG
CGTATGTTGTGTGGAATTGTGAGCGG
GATGTGCTGCAAGGCGATTAAGTTG
lacZY forward primer
lacZY reverse primer
gacA full-length forward primer, S. marcescens PDL100
gacA full-length reverse primer, S. marcescens PDL100
gacA internal forward primer, S. marcescens PDL100
gacA internal reverse primer, SalI site on 5′-end, PDL100
PcsrB forward primer, S. marcescens PDL100
PcsrB reverse primer, S. marcescens PDL100
csrB reverse primer, S. marcescens PDL100
lacZY forward primer
lacZY reverse primer
Invitrogen
Invitrogen
This study
This study
This study
This study
This study
This study
This study
B. Ahmer
Dyszel et al. (2010)
TCATCCTGACGCGGTTCCTCA
GAGATGCCCAGGATGTTTCAGGATAG
GGTGTAGCGGTGAAATGCGTAGAGA
GACATCGTTTACAGCGTGGACTACCA
csrB forward primer
csrB reverse primer
16S rRNA gene forward primer
16S rRNA gene reverse primer
This
This
This
This
ª 2012 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
study
study
study
study
FEMS Microbiol Ecol 84 (2013) 290–301
293
gacA regulates swarming and coral mucus colonization by Serratia marcescens
pVIK112, BA184, and DNA sequencing at the Arizona
State University Sequencing Core Facility.
The gacA::lacZ insertion/disruption mutation in
PDL100 (strain CJKgacA3) was complemented by first
amplifying full-length gacA from the genomic DNA using
primers CJK12 and CJK18. The 956-bp PCR product was
cloned into pCR2.1 to make pCJK21 and subcloned into
pBBR1-MCS5 digested with EcoRI and treated with calf
intestinal phosphatase (NEB) to yield pCJK22. The construction of pCKJ22 was confirmed by PCR using primers
BA974 and CJK18. As a negative control, pBBR1-MCS5
vector was also moved into both S. marcescens PDL100
wild type and CJKGacA3.
To construct the PcsrB-luxCDABE reporter, the promoter region of PDL100 csrB containing the predicted
upstream activation sequence (UAS, Supporting Information, Fig. S2 and Kulkarni et al., 2006) was first amplified
using primers CJK64 and CJK87. The resulting 384-bp
PCR product was cloned into pCR2.1 (making pCJK8)
and then subcloned into the EcoRI site of pSB377, resulting in plasmid pCJK9. The plasmids pCJK22 and pCJK9
were incompatible in S. marcescens; therefore, the plasmids were electroporated into uvrY33::kan E. coli RG133.
To cross-complement the E. coli uvrY mutant, the
PDL100 gacA complementation vector pCJK22 was electroporated into E. coli RG133 pCJK9. As a vector control,
the original pBBR1-MCS5 vector was also electroporated
into isogenic E. coli RG133 pCJK9.
Competitive fitness on coral mucus
Overnight cultures of S. marcescens PDL100 and CJKGacA3 were grown from glycerol stock in marine broth to
an approximate OD600 of 0.9, and cultures were serially
diluted 10-fold and mixed 1 : 1 at 104 CFU mL 1.
Strains were cultured individually and in co-culture at
starting concentrations of 102 CFU mL 1. They were
inoculated into filter-sterilized crude (total) mucus, high
molecular weight (> 5 kDa) fractioned mucus, and low
molecular weight (< 5 kDa) fractionated mucus from
A. palmata. Mono- and co-cultures were grown in triplicates and then dilution plated on marine agar supplemented with tetracycline (Tc) 10 lg mL 1 at 0, 12, 24,
48, 72, and 96 h. Competitive fitness assays on each
media type were repeated at least twice. To distinguish
between wild type and mutant, individual colonies were
patched onto selective media (marine agar supplemented
with Tc10 and kanamycin Km50) to select for the gacA
mutant. Competitive indices were calculated for each
treatment using the formula (Mout/WTout)/(Min/WTin),
where M is the proportion of mutant cells and WT is the
proportion of wild-type cells in the inoculum (in) or in
the recovered samples (out). Statistical significance of each
FEMS Microbiol Ecol 84 (2013) 290–301
competitive index was established by comparing log
values of the competitive indices using a two-tailed t-test
in JMP 9.0 Pro statistical software (SAS Institute Inc.,
Cary, NC).
Swarming motility
Swarming motility assays were performed on S. marcescens wild-type and CJKGacA3 mutant strain as well as
the complemented strain on AB swarm agar as described
previously (Alagely et al., 2011). Overnight cultures were
grown to stationary phase and subcultured 1 : 100 in
marine broth for 2 h, and 5 lL was spotted on the center
of the AB swarm agar plate. Swarming plates were
incubated at 30 °C overnight and photographed with a
Canon Eos Rebel Xsi digital camera. Images of swarming
motility presented were corrected for auto levels in Adobe
Photoshop.
Biofilm formation
Biofilm formation was tested in S. marcescens PDL100
wild type, CJKGacA3, and CJKGacA3 pCJK22. As a
control, both wild type and CJKGacA3 with the
pBBR1-MCS5 vector were tested. Cells of each strain were
diluted 1 : 100 from overnight LB cultures into 2-ml
colony-forming antigen (CFA) medium (Teplitski et al.,
2006a, b). Cultures were incubated at room temperature
at 100 r.p.m. for 6 h followed by static incubation at
room temperature for 72 h. After incubation, the biofilms
were stained with 500 lL of 1% crystal violet (in ethanol)
for 15 min and washed three times with running
de-ionized water. The stained biofilms were photographed
with a Canon Eos Rebel Xsi digital camera. Images of
biofilms presented were corrected in Adobe Photoshop
using auto default settings.
Virulence tests in A. pallida and Artemia
nauplii
Individual polyp infections with PDL100 wild type and
CJKGacA3 were performed as described previously
(Krediet et al., 2012). Individual A. pallida polyps (stalk
length approximately 1 cm) were transferred from the
stock tanks into wells of six-well plates (Corning Scientific,
Corning, NY) with 10 mL of filter-sterilized (0.22 lm)
ASW. Polyps were acclimated in the wells for 24 h at room
temperature on a tabletop rotary shaker at 70 r.p.m. For
inoculations with individual strains, overnight cultures
grown in marine broth were washed three times in filtersterilized ASW and diluted to approximately 108, 107, and
106 CFU mL 1; the water in the wells was replaced with
10 mL of these suspensions. For uninfected polyps, the
ª 2012 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
294
water in each well was replaced with 10 mL of filter-sterilized ASW. The polyps were monitored for disease signs
and were photographed daily with a Canon Eos Rebel Xsi
digital camera. Images of polyps presented were corrected
in Adobe Photoshop using auto default settings.
Artemia eggs were hatched overnight in filter-sterilized
(0.22 lm) ASW in a brine shrimp hatchery. Groups of 10
Artemia nauplii were transferred from the hatchery into
wells of 24-well plates (Corning Scientific) and treated
with 2 mL of inoculum or with 2 mL of filter-sterilized
ASW for the negative control. To prepare the inocula,
individual cultures of PDL100 wild type, CJKGacA3,
CJKGacA3 pCJK22, and CJKGacA3 pBBR1-MCS5 were
grown overnight in marine broth and in the presence of
appropriate antibiotics; CJKGacA3 was grown with
50 lg mL 1 kanamycin, and pCJK22 and pBBR1-MCS5
were maintained with 50 lg mL 1 gentamycin. Cultures
were subsequently washed three times in filter-sterilized
ASW and diluted to 108, 107, 106, and 105 CFU mL 1.
Groups of Artemia were then inoculated with the dilutions of the Serratia strains. Every 24 h for 4 days, the
surviving Artemia were counted under a dissecting microscope. Kaplan–Meier survivorship analyses were performed for each infection using JMP 9.0 Pro statistical
software (SAS Institute Inc.), and mortality across treatments was compared with a Cox proportional hazards
chi-square (v2) model (Hosmer & Lemeshow, 1999).
Luciferase assays
Two overnight cultures of each strain were grown in LB
with appropriate antibiotics at 37 °C on a rotary shaker
(220 r.p.m.). Following overnight incubation, cultures
were diluted 1/100 in LB and incubated at 37 °C for 3 h
on a rotary shaker (220 r.p.m.). Cultures were diluted to
an OD600 of 0.3 and then diluted 1/25 000 and aliquoted
into a black polystyrene 96-well plate (in quadruplicate).
Luminescence and OD600 were measured with Victor-3
(Perkin Elmer, Shelton, CT) every hour for 12 h, and the
expression of the complemented mutant was compared
with the wild-type and mutant reporter strains. Luminescence was measured as counts per second (CPS) and was
expressed as average CPS/OD600 on a log scale.
Quantitative RT-PCR (qRT-PCR)
Total RNA was extracted from overnight cultures of
S. marcescens PDL100 wild type and CJKGacA3
(OD600 = 1.1) using a GenElute Total RNA Purification
Kit (Sigma-Aldrich). DNA was removed with a DNA-Free
Kit (Applied Biosystems, Carlsbad, CA). cDNA was
synthesized using iScriptTM cDNA sysnthesis kit (Bio-Rad,
Hercules, CA). Quantitative PCRs were performed in a
ª 2012 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
C.J. Krediet et al.
reaction volume of 50 lL containing 1x iQ SYBR Green
Supermix (Bio-Rad, Hercules, CA), 200 nM each forward
and reverse primers (Table 2), and 5 ng of cDNA. DNA
concentrations were determined with the NanodropTM
spectrophotometer. Amplification and detection of DNA
were performed in four biological replications, and two
technical replicates for each biological replicate were performed with the iCycler detection system (Bio-Rad) with
optical-grade 96-well PCR plates and optical film. The
reaction conditions were 50 °C for 2 min and 95 °C for
10 min, followed by 45 cycles of 95 °C for 15 s and 60 °C
for 1 min. Data analysis was conducted with the software
supplied by Bio-Rad, and data are presented as
fold-change in expression based on the comparative CT
method using 16S rRNA gene expression as a reference
(Livak & Schmittgen, 2001; Schmittgen & Livak, 2008).
Differences of relative fold-change in gene expression
between S. marcescens PDL100 wild type and the CJKGacA3 mutant were compared using a Student’s t-test with
JMP 9.0 Pro statistical software (SAS Institute, Inc.).
Results
Regulation of csrB in a gacA-dependent
manner
The small regulatory RNA csr (rsm) are the evolutionarily
conserved targets of GacA orthologs (Romeo, 1998; Teplitski et al., 2003; Babitzke & Romeo, 2007; Brencic et al.,
2009). Even though GacA orthologs can bind within the
promoters of the horizontally acquired virulence genes
(Teplitski et al., 2003), most of the downstream regulatory effects are thought to be mediated by the Csr posttranscriptional regulatory system (Heeb & Haas, 2001;
Timmermans & Van Melderen, 2010).
To confirm the evolutionarily conserved functions of
GacA and to validate the constructed S. marcescens gacA
mutant, the regulation of csrB in a gacA-dependent manner was tested. The amino acid sequence of S. marcescens
GacA was compared with other characterized orthologs of
GacA, and conserved functional domains were identified
through sequence homology (Fig. S1). Luminescence of a
PcsrB-luxCDABE reporter plasmid, pCJK9, was tested in
the wild-type S. marcescens PDL100 and the gacA mutant
CJKGacA3. A 10-fold decrease in luminescence in the
csrB reporter was observed in the gacA mutant as compared to the wild type (Fig. 1a). The PcsrB-luxCDABE
reporter plasmid, pCJK9, was similarly regulated in the
heterologous host E. coli (Fig. 1b), and the introduction
of the wild-type copy of gacA borne on a low copy number plasmid complemented the mutation (Fig. 1b). The
vector alone did not affect luminescence in the reporter
(Fig. 1b). The csrB expression peaked during early log
FEMS Microbiol Ecol 84 (2013) 290–301
295
gacA regulates swarming and coral mucus colonization by Serratia marcescens
(a)
(b)
(c)
Fig. 1. Regulation of csrB in a gacA-dependent manner in Serratia
marcescens. To test the gacA-dependent regulation of csrB, the
region spanning the predicted csrB promoter from PDL100 was
cloned upstream of a promoterless luxCDABE cassette to make
pCJK9, and a luminescence bioassay was used to quantify expression
of the PcsrB promoter in PDL100 (a) and in an isogenic Escherichia coli
uvrY mutant (b). The luminescent reporter was moved into wild type,
the gacA mutant, and the gacA mutant complemented with pCJK22
in both S. marcescens and E. coli. Overnight cultures were grown in
LB, subcultured to an OD600 = 0.3, and further diluted 1/25 000 (the
complemented mutants were additionally diluted 1/10 to normalize
initial luminescence to that of the mutant strains). Cultures were
inoculated into wells of a 96-well black clear-bottom polystyrene
microtiter plate. Plates were incubated at 30 °C for S. marcescens
and 37 °C for E. coli, luminescence and corresponding A595 readings
were measured every hour for 12 h. Averages of two biological
replicates and four technical replicates are plotted; error bars are
standard deviations. Experiments were repeated three times, and data
from one representative experiment are shown. (c) qRT-PCR analysis
of csrB expression. The accumulation of the csrB RNA was measured
with qRT-PCR in the CJKGacA3 mutant and wild-type PDL100.
There was a significant decrease in the fold-change in csrB RNA
accumulation in CJKGacA3 compared with PDL100 using 16S rRNA
gene as an internal reference by a Student’s t-test (t = 3.896,
d.f. = 4, P = 0.0087).
0.0087). These results and the previous report demonstrating functionality of the S. marcescens PDL100 gacA borne
on a low copy number plasmid (Cox et al., 2012) suggest
that S. marcescens PDL100 carries a functional copy of
gacA, which is disrupted in the CJKGacA3 mutant.
Contribution of gacA to the fitness of the
pathogen on coral mucus
phase (OD600 ~ 0.2), which occurred 7–8 h after dilution,
and luminescence of the reporter remained constant for
the duration of the assay as culture densities increased
(Fig. 1b). The cloned promoter region of PDL100 csrB
contained the predicted UAS necessary for proper GacA
binding to the csrB promoter (Fig. S2, Kay et al., 2005;
Kulkarni et al., 2006).
To further validate the regulation of csrB in a gacAdependent manner, qRT-PCR experiments were performed.
In late log cultures, the accumulation of the csrB
transcript was significantly reduced in the gacA mutant
compared with the wild type (Fig. 1c; t4 = 3.896, P =
FEMS Microbiol Ecol 84 (2013) 290–301
To test how gacA contributes to the efficient utilization of
coral mucus by S. marcescens, competitive fitness experiments were carried out on crude (total) and size-fractionated
mucus from A. palmata. When grown individually, the wild
type and the gacA mutant grew similarly and reached the
same final densities on the crude and high molecular
weight coral mucus (Fig. 2). However, within the 1 : 1
co-cultures on crude mucus and high molecular weight
coral mucus, the gacA mutant dominated the culture after
12 h of growth and continued throughout the rest of the
growth curve (Fig. 2b and d). The wild type was not
competitive against the mutant on crude mucus or high
molecular weight mucus and represented only 5–10%
of the overall population. On low molecular weight
fractionated mucus, the two strains grew similarly in
monocultures (Fig. 2e). However, in their co-culture, the
competitive fitness of the wild type increased and was
nearly equal with the gacA (Fig. 2f). This suggests that
the efficiency of the utilization of high molecular weight
fraction of the mucus glycoprotein is dependent on the
ª 2012 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
296
C.J. Krediet et al.
(a)
(c)
(e)
(b)
(d)
(f)
Fig. 2. Competitive fitness of Serratia marcescens PDL100 and CJKGacA3. To test the importance of gacA regulation of metabolism for growth
of S. marcescens on coral mucus, both wild type and CJKGacA3 were grown in mono- and co-cultures on mucus of Acropora palmata. For
competition experiments, overnight cultures were serially diluted and mixed 1 : 1. Cultures in (a) crude (total) mucus of A. palmata, (c) high
molecular weight (> 5 kDa) fraction of A. palmata mucus, or (e) low molecular weight (< 5 kDa) fraction of A. palmata mucus were inoculated
at 102 CFU mL 1. Cultures were incubated at 30 °C with shaking. To enumerate cells at 12, 24, 48, 72, and 96 h, cultures were dilution plated
onto marine agar supplemented with Tc10. In all three mucus types, both strains grew similarly in monocultures. To estimate the percentage of
each strain within co-culture (competitive fitness), colonies were patched onto marine agar supplemented with Tc10 and Km50 to differentiate
between the wild type and the mutant. The relative proportion of the wild type is shown as the gray portion of the stacked column. Competitive
fitness experiments were repeated at least twice, and averages are shown (error bars are standard error). On crude (total) mucus (b) and high
molecular weight fraction of the mucus (d), the wild type was not competitive against the mutant (competitive index = 1.169 and 0.939,
respectively). However, the competitive fitness of the wild type was increased on low molecular weight fraction of mucus (f) and was as
competitive as the mutant (competitive index = 0.082).
gacA-mediated regulatory pathways, while the GacA regulon is dispensable during growth on the low molecular
weight fraction.
Surface swarming motility and biofilm
formation
In addition to indirectly regulating carbon metabolism
through CsrA, GacA is known to regulate swarming
motility and biofilm formation (Goodier & Ahmer, 2001;
(a)
(b)
Teplitski et al., 2006a; Gauthier et al., 2010). Swarming
assays on AB soft (0.4%) agar plates revealed that S. marcescens PDL100 swarms in a branching dendritic pattern
(Fig. 3a, Alagely et al., 2011). The gacA mutant was also
capable of surface spreading but with an altered architecture of the swarm colony (Fig. 3b), which lacked the
three-dimensionality and extensive dendritic pattern. The
swarming phenotype was complemented by the plasmidborne gacA, while a pBBR1-MCS5 vector did not alter
the swarming behavior of the mutant (Fig. 3c and d).
(c)
(d)
Fig. 3. Regulation of swarming motility in Serratia marcescens PDL100 by gacA. (a) Swarming of S. marcescens PDL100 on AB 0.4%. Individual
cultures of a CJKGacA3 (b), CJKGacA3 pBBR1-MCS5 (vector control) (c), and CJKGacA3 pCJK22 (complemented mutant) (d) were grown
in marine broth, diluted 1 : 100, and grown for 2 h. After incubation, 5 lL was spotted onto an AB 0.4% swarm agar plate and incubated at
30 °C overnight. The experiments were repeated three times; data from one representative experiment are shown.
ª 2012 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
FEMS Microbiol Ecol 84 (2013) 290–301
297
gacA regulates swarming and coral mucus colonization by Serratia marcescens
The disruption of gacA reduced the ability of the strain
to form biofilms on glass (but not on polystyrene). After
72 h of incubation, biofilms stained with crystal violet
were significantly reduced in the gacA mutant compared
with the wild type (Fig. 4a and b). Just as with the
swarming phenotype, complementation with the wildtype copy of gacA fully restored biofilm formation to
wild-type levels (Fig. 4d), and the addition of the empty
pBBR1 vector had no effect on biofilm formation in the
gacA mutant (Fig. 4c).
been previously estimated at 5 9 107 CFU mL 1 (Krediet
et al., 2012).
Brine shrimp Artemia nauplii are commonly used as
surrogate models for virulence challenge (Austin et al.,
2005; Defoirdt et al., 2006). Serratia marcescens PDL100
was able to cause mortality of brine shrimp at 107, 108,
and 109 CFU mL 1 concentrations (data not shown).
Challenge with the gacA mutant or the complemented
strains did not significantly affect virulence.
Discussion
Virulence in surrogate invertebrate models
Aiptasia pallida is a Cnidarian and has been proposed as
a model to study cellular and molecular biology of corals
and their associated microorganisms (Weis et al., 2008).
The hypothesis that GacA regulates virulence behaviors in
the coral pathogen was tested by infecting individual polyps at three doses of both wild type and the gacA mutant
(Fig. 5). As S. marcescens PDL100 is a necrotizing pathogen, mortality was defined as complete degradation of
the Aiptasia polyp. After 24 h of incubation at the highest concentration (108 CFU mL 1), the polyps compressed their stalks, retracted their tentacles, and
exhibited darkening of the tissue in response to infection
by both the wild type and the mutant. These responses
were seen to a lesser degree at the 107 CFU mL 1 treatment and rarely at the 106 CFU mL 1 concentration
(Fig. 5). There was no significant difference in virulence
of the two strains after 7 days of incubation. Both polyps
infected with 108 CFU mL 1 succumbed to infection
after 24 h, while no mortality at each of the lower concentrations was observed. These data suggest that the
LD50 for the mutant is equal to the wild type, which has
(a)
(b)
Virulence mechanisms of coral pathogens often vary with
the type of disease manifestation the pathogen causes. For
example, the well-characterized coral-bleaching pathogen
Vibrio shiloi first employs flagellar-dependent chemotaxis
toward the mucus of Oculina patagonica (Banin et al.,
2000). Once attracted to coral mucus, V. shiloi adhesin
binds to b-galactoside residues on the coral surface, then
penetrates into the epidermal cells, multiplies within the
cells of the polyp, and finally produces toxins that inhibit
photosynthesis, bleach and lyse the symbiotic zooxanthellae (Banin et al., 2000; Rosenberg & Falkovitz, 2004). The
coral pathogen Vibrio coralliilyticus causes both bleaching
and coral tissue necrosis through production of a temperature-regulated zinc metalloprotease (Sussman et al.,
2009; Kimes et al., 2011). Chemotaxis toward mucus is
also critical for virulence of the bleaching and necrotizing
coral pathogen V. coralliilyticus (Meron et al., 2009). The
pathogen inhibits photosystem-II in zooxanthellae, causes
paling of the coral tissue, and spreads tissue lesions across
the colony culminating in mortality, although the exact
mechanism is not fully understood (Sussman et al.,
2008).
(c)
(d)
Fig. 4. Biofilm formation in Serratia marcescens PDL100 and CJKGacA3. To test the importance of gacA for biofilm formation in S. marcescens,
individual cultures of S. marcescens PDL100 (a), CJKGacA3 (b), CJKGacA3 pBBR1-MCS5 (c), and CJKGacA3 pCJK22 (d) were grown in marine
broth at 30 °C overnight and diluted 1 : 100 into CFA medium in virgin borosilicate glass tubes. They were incubated at room temperature (22–
24 °C) with shaking (70 r.p.m.) for 6 h followed by 72 h of static incubation. Biofilms were stained with 1% crystal violet in ethanol, rinsed, and
photographed. These results were reproducible with biological replicates repeated in three individual assays. The experiments were repeated
three times (four independent cultures for each experiment). Data from one representative experiment are shown.
FEMS Microbiol Ecol 84 (2013) 290–301
ª 2012 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
298
Fig. 5. Survivorship of Aiptasia pallida polyps infected with Serratia
marcescens. Tenfold dilutions of overnight cultures of S. marcescens
PDL100 and CJKGacA3 were inoculated into microtiter plate wells
with A. pallida. Infections were maintained at room temperature
(22–24 °C) with illumination. Due to limitations in the number of
polyps available, a total of 14 A. pallida polyps were used to test the
virulence of S. marcescens PDL100 over a 7-day period. Two polyps
were used per dilution. Polyps were scored daily for disease signs or
mortality. Both strains appear equally virulent, causing 100%
mortality when polyps were infected at 108 CFU mL 1. No polyp
mortality was observed at the lower concentrations over the 7-day
period.
Serratia marcescens is a multi-host opportunistic pathogen
capable of infecting invertebrates, animals, and humans.
When S. marcescens first colonizes the intestinal mucous
lining of Caenorhabditis elegans and Drosophila melanogaster,
the pathogen adheres to the epithelial cells, with the
O-antigen playing a key role in resistance to host defenses
(Kurz & Ewbank, 2000; Kurz et al., 2003; Nehme et al.,
2007). Once attached to the epithelial cells of insects, the
pathogen produces cytotoxins that lead to tissue necrosis
(Carbonell et al., 2000). In the coral A. palmata, S. marcescens PDL100 is a strictly necrotizing pathogen.
ª 2012 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
C.J. Krediet et al.
Even though multiple strains of S. marcescens are capable of infecting corals (Sutherland et al., 2010, 2011),
mechanisms of virulence are not yet known. To investigate
potential mechanisms that modulate interactions of
S. marcescens PDL100 with the coral, the hypothesis that
gacA played a role in competitive fitness on coral mucus
was tested. gacA was found to control competitive fitness
on high molecular weight and not on low molecular weight
fractions of mucus of A. palmata. When the wild-type and
gacA mutant strains were grown on low molecular weight
fractions of coral mucus, the competitive fitness of the wild
type increased and led to a relatively equal proportion of
each strain in the culture (competitive index = 0.083). Protease activities (as measured on skim milk agar plates) were
not different in the mutant and the wild type (data not
shown), thus the degradation of the proteinaceous backbone of mucus is not the likely explanation of the observed
phenotype, even though gacA orthologs are known to
control proteases in other bacteria (Ovadis et al., 2004; Cui
et al., 2008; Gauthier et al., 2010).
The increased fitness of the gacA mutant is reminiscent of
the phenotype of the E. coli uvrY (gacA) mutant (Pernestig
et al., 2003). Escherichia coli uvrY mutant was more fit than the
wild type in a complex laboratory medium (LB) over a 10-day
period; however, the wild type dominated the culture when
grown on minimal media with glucose or other glycolytic
substrates as the sole carbon source (Pernestig et al., 2003).
This led to the conclusion that the growth advantage of the
mutant on carbon sources that enter downstream of glycolysis
could be due to the fact that (1) the mutants were defective in
shifting between metabolic pathways, which were not necessary
during the long-term culture conditions of the co-culture; or
(2) due to the relative downregulation of gluconeogenic
enzymes by the Csr system in the mutants, the mutants conferred a growth advantage because these pathways were less
important and rather were a burden in the wild-type bacteria
(Pernestig et al., 2003). The ability to shift between metabolic
pathways seems to be important for the ability of opportunistic
coral pathogens to utilize the carbon sources available in mucus
to outcompete the native coral-associated microbiota and
establish within the new environmental niches.
Virulence is often associated with GacA in Gammaproteobacteria, although the contribution of gacA to the phenotype varies depending on the model (Lapouge et al., 2008;
Gauthier et al., 2010). We did not observe any role for gacA
in controlling virulence of S. marcescens in surrogate hosts,
A. pallida, and Artemia. Even though GacA does not seem
to control virulence in the Aiptasia polyp model, it is not
entirely clear whether the same phenotype will be obtained
in A. palmata. Control of virulence and other phenotypes
is not universal across all Gammaproteobacteria as the regulation by GacA is indirect (Heeb & Haas, 2001; Lapouge
et al., 2008).
FEMS Microbiol Ecol 84 (2013) 290–301
gacA regulates swarming and coral mucus colonization by Serratia marcescens
The mutation in gacA in S. marcescens PDL100 led to
significant differences in surface colonization abilities:
biofilm formation and surface swarming were significantly
affected in the mutant. These differences are consistent
with the reports in other bacteria and indicate an important function for gacA in modulating surface-associated
behaviors in the pathogen (Goodier & Ahmer, 2001).
Even though S. marcescens PDL100 did not reduce virulence of the mutant in Aiptasia or Artemia models, our
results suggest an important function for gacA in controlling colonization of coral surfaces, through the regulation
of surface motility (swarming), biofilm formation, and
utilization of specific components in coral mucus. Our
previous studies demonstrated that native coral-associated
bacteria capable of disrupting swarming, biofilm formation, and mucus utilization in S. marcescens (Alagely
et al., 2011; Krediet et al., 2012) can also decrease virulence of the pathogen in Aiptasia. Because the gacA mutation did not affect virulence of the pathogen, it is
reasonable to hypothesize that the native microorganisms
characterized earlier target regulatory pathways and functions that are downstream of gacA.
Acknowledgements
This research was funded by the grant 9184-12 from the
National Geographic Society Committee for Exploration
and by ‘Protect Our Reefs’, a program managed by Mote
Marine Laboratory with the proceeds from the statewide
sales of Protect Our Reefs specialty license plates and
administered through a peer-reviewed mechanism. This
research was also funded in part by the Dart Foundation.
M.T. is a Smithsonian Burch Fellow.
References
Alagely A, Krediet CJ, Ritchie KB & Teplitski M (2011)
Signaling-mediated cross-talk modulates swarming and
biofilm formation in a coral pathogen Serratia marcescens.
ISME J 5: 1609–1620.
Austin B, Austin D, Sutherland R, Thompson F & Swings
J (2005) Pathogenicity of vibrios to rainbow trout
(Oncorhynchus mykiss, Walbaum) and Artemia nauplii.
Environ Microbiol 7: 1488–1495.
Babitzke P & Romeo T (2007) CsrB sRNA family:
sequestration of RNA-binding regulatory proteins. Curr
Opin Microbiol 10: 156–163.
Banin E, Ben-Haim Y, Fine M, Israely T & Rosenberg E (2000)
Virulence mechanisms of the coral bleaching pathogen Vibrio
shiloi. Proceedings of the 9th International Coral Reef Symposium,
Bali, Indonesia, 23–27 October 2000. 2: 1261–1266.
Brencic A, McFarland KA, McManus HR, Castang S, Mogno I,
Dove SL & Lory S (2009) Th GacS/GacA signal transduction
system of Pseudomonas aeruginosa acts exclusively through
FEMS Microbiol Ecol 84 (2013) 290–301
299
its control over the transcription of the RsmY and RsmZ
regulatory small RNAs. Mol Microbiol 73: 434–445.
Carbonell GV, Della Colleta HHM, Yano T, Darini ALC, Levy
CE & Fonseca BAL (2000) Clinical relevance and virulence
factors of pigmented Serratia marcescens. FEMS Immunol
Med Microbiol 28: 143–149.
Chavez RG, Alvarez AF, Romeo T & Georgellis D (2010) The
physiological stimulus for the BarA sensor kinase. J Bacteriol
192: 2009–2012.
Cox CE, Zaragoza WJ, Krediet CJ & Teplitski M (2012)
Bioassays for the detection of compounds that disrupt
biofilm formation in c-proteobacteria. Biofouling Methods
(Dobretsov S, ed), pp. 416. Wiley-Blackwell, Hoboken, NJ.
Cui Y, Chatterjee A, Yang H & Chatterjee AK (2008)
Regulatory network controlling extracellular proteins in
Erwinia carotovora subsp. carotovora: FlhDC, the master
regulator of flagellar genes, activates rsmB regulatory RNA
production by affecting gacA and hexA (lrhA) expression.
J Bacteriol 190: 4610–4623.
Defoirdt T, Crab R, Wood TK, Sorgeloos P, Verstraete W &
Bossier P (2006) Quorum sensing-disrupting brominated
furanones protect the gnotobiotic brine shrimp Artemia
franciscana from pathogenic Vibrio harveyi, Vibrio
campbellii, and Vibrio parahaemolyticus isolates. Appl
Environ Microbiol 72: 6419–6423.
Dyszel JL, Soares JA, Swearingen MC, Lindsay A, Smith JN &
Ahmer BMM (2010) E. coli K-12 and EHEC Genes
Regulated by SdiA. PLoS ONE 5: e8946.
Gauthier JD, Jones MK, Thiaville P, Joseph JL, Swain RA,
Krediet CJ, Gulig PA, Teplitski M & Wright AC (2010) Role
of GacA in virulence of Vibrio vulnificus. Microbiology 156:
3722–3733.
Goodier RI & Ahmer BM (2001) SirA orthologs affect both
motility and virulence. J Bacteriol 183: 2249–2258.
Grimont F & Grimont PA (2006) The Genus Serratia. The
Prokaryotes, Vol. 6 (Dworkin M, Falkow S, Rosenberg E,
Schleifer KH & Stackebrandt E, eds), pp. 219–244. Springer,
New York.
Heeb S & Haas D (2001) Regulatory roles of the GacS/GacA
two-component system in plant- associated and other
gram-negative bacteria. Mol Plant Microbe Interact 14:
1351–1363.
Hosmer DW & Lemeshow S (1999) Applied Survival Analysis.
Wiley & Sons, New York.
Jones MK, Warner EB & Oliver JD (2008) csrA inhibits the
formation of biofilms by Vibrio vulnificus. Appl Environ
Microbiol 74: 7064–7066.
Kalogeraki VS & Winans SC (1997) Suicide plasmids
containing promoterless reporter genes can simultaneously
disrupt and create fusions to target genes of diverse bacteria.
Gene 188: 69–75.
Karunakaran R, Mauchline TH, Hosie AH & Poole PS (2005)
A family of promoter probe vectors incorporating
autofluorescent and chromogenic reporter proteins for
studying gene expression in Gram-negative bacteria.
Microbiology 151: 3249–3256.
ª 2012 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
300
Kay E, Dubuis C & Haas D (2005) Three small RNAs jointly
ensure secondary metabolism and biocontrol in
Pseudomonas fluorescens CHA0. P Natl Acad Sci USA 102:
17136–17141.
Kimes NE, Grim CJ, Johnson WR et al. (2011) Temperature
regulation of virulence factors in the pathogen Vibrio
coralliilyticus. ISME J 6: 835–846.
Kovach ME, Elzer PH, Hill DS, Robertson GT, Farris MA,
Roop RM & Peterson KM (1995) 4 new derivatives of the
broad-host-range cloning vector pBBR1-MCS, carrying
different antibiotic-resistance cassettes. Gene 166: 175–176.
Krediet CJ, Ritchie KB & Teplitski M (2009a) Catabolite
control in a coral white pox pathogen, Serratia marcescens
PDL100. Dis Aquat Organ 87: 57–66.
Krediet CJ, Ritchie KB, Cohen M, Lipp EK, Sutherland KP &
Teplitski M (2009b) Utilization of mucus from the coral
Acropora palmata by the pathogen Serratia marcescens and
by environmental and coral commensal bacteria. Appl
Environ Microbiol 75: 3851–3858.
Krediet CJ, Ritchie KB, Alagely A & Teplitski M (2012)
Members of native coral microbiota inhibit glycosidases and
thwart colonization of coral mucus by an opportunistic
pathogen. ISME J 1–11. DOI: 10.1038/ismej.2012.164
Kulkarni PR, Cui X, Williams JW, Stevens AM & Kulkarni RV
(2006) Prediction of CsrA-regulating small RNAs in bacteria
and their experimental verification in Vibrio fischeri. Nucleic
Acids Res 34: 3361–3369.
Kurz CL & Ewbank JJ (2000) Caenorhabditis elegans for the
study of host–pathogen interactions. Trends Microbiol 8:
142–144.
Kurz CL, Chauvet S, Andres E et al. (2003) Virulence factors
of the human opportunistic pathogen Serratia marcescens
identified by in vivo screening. EMBO J 22: 1451–1460.
Lapouge K, Schubert M, Allain FHT & Haas D (2008) Gac/
Rsm signal transduction pathway of c-proteobacteria: from
RNA recognition to regulation of social behaviour. Mol
Microbiol 67: 241–253.
Livak KJ & Schmittgen TD (2001) Analysis of relative gene
expression data using real-time quantitative PCR and the 2
(T)(-Delta Delta C) method. Methods 25: 402–408.
Macinga DR, Parojcic MM & Rather PN (1995) Identification
and analysis of aarP, a transcriptional activator of the
2′-N-acetyltransferase in Providencia stuartii. J Bacteriol 177:
3407–3413.
Meron D, Efrony R, Johnson WR et al. (2009) Role of flagella
in virulence of the coral pathogen Vibrio coralliilyticus. Appl
Environ Microbiol 75: 5704–5707.
Nehme NT, Liegeois S, Kele B et al. (2007) A model of
bacterial intestinal infections in Drosophila melanogaster.
PLoS Pathog 3: 1694–1709.
Ovadis M, Liu X, Gavriel S, Ismailov Z, Chet I & Chernin L
(2004) The global regulator genes from biocontrol strain
Serratia plymuthica IC1270: cloning, sequencing, and
functional studies. J Bacteriol 186: 4986–4993.
Patterson KL, Porter JW, Ritchie KB et al. (2002) The
etiology of white pox, a lethal disease of the Caribbean
ª 2012 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
C.J. Krediet et al.
elkhorn coral, Acropora palmata. P Natl Acad Sci USA 99:
8725–8730.
Pernestig AK, Melefors O & Georgellis D (2001)
Identification of UvrY as the cognate response regulator
for the BarA sensor kinase in Escherichia coli. J Biol Chem
276: 225–231.
Pernestig AK, Georgellis D, Romeo T, Suzuki K, Tomenius H,
Normark S & Melefors O (2003) The Escherichia coli BarAUvrY two-component system is needed for efficient
switching between glycolytic and gluconeogenic carbon
sources. J Bacteriol 185: 843–853.
Ritchie KB (2006) Regulation of microbial populations by
coral surface mucus and mucus-associated bacteria. Mar
Ecol Prog Ser 322: 1–14.
Romeo T (1998) Global regulation by the small RNA-binding
protein CsrA and the non-coding RNA molecule CsrB. Mol
Microbiol 29: 1321–1330.
Romeo T, Gong M, Liu MY & Brun-Zinkernagel AM (1993)
Identification and molecular characterization of csrA, a
pleiotropic gene from Escherichia coli that affects glycogen
biosynthesis, gluconeogenesis, cell size, and surface
properties. J Bacteriol 175: 4744–4755.
Rosenberg E & Falkovitz L (2004) The Vibrio shiloi/Oculina
patagonica model system of coral bleaching. Annu Rev
Microbiol 58: 143–159.
Schmittgen TD & Livak KJ (2008) Analyzing real-time PCR
data by the comparative C(T) method. Nat Protoc 3: 1101–
1108.
Sussman M, Willis BL, Victor S & Bourne DG (2008) Coral
pathogens identified for white syndrome (WS) epizootics in
the Indo-Pacific. PLoS ONE 3: e2393.
Sussman M, Mieog JC, Doyle J, Victor S, Willis BL & Bourne
DG (2009) Vibrio zinc-metalloprotease causes
photoinactivation of coral endosymbionts and coral tissue
lesions. PLoS ONE 4: e4511.
Sutherland KP, Porter JW, Turner JW et al. (2010) Human
sewage identified as likely source of white pox disease of the
threatened Caribbean elkhorn coral, Acropora palmata.
Environ Microbiol 12: 1121–1131.
Sutherland KP, Shaban S, Joyner JL, Porter JW & Lipp EK
(2011) Human pathogen shown to cause disease in the
threatened elkhorn coral Acropora palmata. PLoS ONE 6:
e23468.
Suzuki K, Wang X, Weilbacher T et al. (2002) Regulatory
circuitry of the CsrA/CsrB and BarA/UvrY systems of
Escherichia coli. J Bacteriol 184: 5130–5140.
Teplitski M, Goodier RI & Ahmer BM (2003) Pathways
leading from BarA/SirA to motility and virulence gene
expression in Salmonella. J Bacteriol 185: 7257–7265.
Teplitski M, Al-Agely A & Ahmer BMM (2006a)
Contribution of the SirA regulon to biofilm formation in
Salmonella enterica serovar Typhimurium. Microbiology
152: 3411–3423.
Teplitski M, Goodier RI & Ahmer BM (2006b) Catabolite
repression of the SirA regulatory cascade in Salmonella
enterica. Int J Med Microbiol 296: 449–466.
FEMS Microbiol Ecol 84 (2013) 290–301
301
gacA regulates swarming and coral mucus colonization by Serratia marcescens
Timmermans J & Van Melderen L (2010) Post-transcriptional
global regulation by CsrA in bacteria. Cell Mol Life Sci 67:
2897–2908.
Weis VM, Davy SK, Hoegh-Guldberg O, Rodriguez-Lanetty
M & Pringle JR (2008) Cell biology in model systems as
the key to understanding corals. Trends Ecol Evol 23:
369–376.
Williamson NR, Fineran PC, Leeper FJ & Salmond GPC
(2006) The biosynthesis and regulation of bacterial
prodiginines. Nat Rev Microbiol 4: 887–899.
Winson MK, Swift S, Hill PJ et al. (1998) Engineering the
luxCDABE genes from Photorhabdus luminescens to provide
a bioluminescent reporter for constitutive and promoter
FEMS Microbiol Ecol 84 (2013) 290–301
probe plasmids and mini-Tn5 constructs. FEMS Microbiol
Lett 163: 193–202.
Supporting Information
Additional Supporting Information may be found in the
online version of this article:
Fig. S1. CLUSTALW alignment of deduced GacA protein
from S. marcescens PDL100 (top row) and other characterized GacA orthologs.
Fig. S2. Serratia marcescens PDL100 csrB.
ª 2012 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved