pCMV6-XL4, XL5, XL6
The CMV promoter is covered under U.S. Patents 5,168,062 and 5,385,839 and its
use is permitted for research purposes only. Any other use of the CMV promoter
requires a license from the University of Iowa Research Foundation, 214 Technology
Innovation Center, Iowa City, IA 52242.
f1 ori
f1 ori
CMV promoter
CMV promoter
Sac I
T7 promoter
M13 reverse
Sma I
Amp resistant gene
MCS
pCMV6-XL4
(4707bp)
Amp resistant
gene
(4482 bp)
PolyA signal
ColE1 ori
PolyA signal
ColE1 ori
SV40 ori
T7
MC
pCMV6-XL5
M13 reverse
SV40 ori
M13 reverse
f1 ori
CMV promoter
Amp resistant gene
MCS
pCMV6-XL6
(4483bp)
Sac I
SP6
M13 reverse
Sma I
PolyA signal
ColE1
SV40 ori
1 M13 reverse
The pCMV-XL4 vector is 4.7 kb in size, and the pCMV-XL5 and pCMV-XL6
vectors are 4.5 kb in size. All three vectors contain the same polylinker (Sac I
to Sma I). The cDNA library inserts are directionally cloned between the EcoRI
and Sal I sites. Note that the Sal I site is destroyed in the cloning process. The
CMV promoter, which can be used to express the cloned cDNA, is followed by
the hGH (human growth hormone) polyA signal located downstream of the insert. The ColE1 ori is the bacterial origin of replication, the SV40 ori allows for
replication in mammalian cells and the f1 ori is the filamentous phage origin of
replication, which allows for the recovery of single-stranded plasmids. Selection of the plasmid in E. coli is conferred by the ampicillin resistance gene.
Sac I
T7 promoter
M13 reverse
Sma I
T7 RNA polymerase can be used for generating transcripts of the cDNA by in
vitro transcription. Apart from the T7 promoter site located within the polylinker
sequence in the pCMV-XL4 vector, there is a second but opposing T7 site (with a
one-base substitution on the 3’ end) located between ColE1 ori and SV40 ori. Since
a second T7 promoter site is present, the cDNA insert must first be released from
the vector. This may be accomplished by digesting with Sac 1 and Sma I before the in
vitro transcription reaction. The pCMV-XL5 vector does not have a second T7 promoter site, and the pCMV-XL6 vector has an SP6 promoter. Therefore, clones within
the XL5 or XL6 vectors do not require prior excision.
Polylinker Sequence of pCMV6-XL4, XL5 and XL6
A) pCMV6-XL4 and XL5 (EcoR I — Xho I/Sal I)
Vector Primer v1.5 >
TTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAATAACCCCGCCCCGTTGACGCAAATGGGCGGTAGGCGTGTACG
AAACCGTGGTTTTAGTTGCCCTGAAAGGTTTTACAGCATTATTGGGGCGGGGCAACTGCGTTTACCCGCCATCCGCACATGC
T7 promoter >
Sac 1
(Not for sequencing)
Not I
EcoR I
GTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGCGAATT
CACCCTCCAGATATATTCGTCTCGAGCAAATCACTTGGCAGTCTTAAAACATTATGCTGAGTGATATCCCGCCGGCGCTTAA
Xho I/Sal I Xba 1
Not I
Sma I
C- - - -Tr u e C l o n e _ I n s e r t - - - - G T C G A C T C TA G A T T G C G G C C G C G GTC ATA G C TGT T TC C TG A A C ATGTG AT C C C G G G T
G - - - -Tr u e C l o n e _ I n s e r t- - - - C A G C TG A G ATC T A A C G C C G G C G CCAGTATCG ACA A AG G AC T TGTACAC TA G G G C C C A
GGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTAATAAA
CCGTAGGGACACTGGGGAGGGGTCACGGAGAGGACCGGGACCTTCAACGGTGAGGTCACGGGTGGTCGGAACAGGATTATTT
< Vector Primer XL39
B) pCMV6-XL6 (EcoR I — Xho I/Sal I)
Vector Primer v1.5 >
TTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAATAACCCCGCCCCGTTGACGCAAATGGGCGGTAGGCGTGTACG
AAACCGTGGTTTTAGTTGCCCTGAAAGGTTTTACAGCATTATTGGGGCGGGGCAACTGCGTTTACCCGCCATCCGCACATGC
Sac 1
SP6 Promoter >
Not I
EcoR I
GTGGGAGGTCTATATAAGCAGAGCTCATTTAGGTGACACTATAGAATACAAGCTACTTGTTCTTTTTGCAGCGGCCGCGAATT
CACCCTCCAGATATATTCGTCTCGAGTAAATCCACTGTGATATCTTATGTTCGATGAACAAGAAAAACGTCGCCGGCGCTTAA
Xho I/Sal I Xba 1
Not I
Sma I
C- - - -Tr u e C l o n e _ I n s e r t - - - - C T C G A C T C TA G A T T G C G G C C G C G GTC ATA G C TGT T TC C TG A A C ATGTG AT C C C G G G T
G - - - -Tr u e C l o n e _ I n s e r t- - - - G A G C TG A G ATC T A A C G C C G G C G CCAGTATCG ACA A AG G AC T TGTACAC TA G G G C C C A
GGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTAATAAA
CCGTAGGGACACTGGGGAGGGGTCACGGAGAGGACCGGGACCTTCAACGGTGAGGTCACGGGTGGTCGGAACAGGATTATTT
< Vector Primer XL39