Research
Retrotransposon BARE displays strong tissue-specific differences
in expression
Marko J€a€a skel€a inen1, Wei Chang1, Cedric Moisy1,2 and Alan H. Schulman1,2
1
MTT/BI Plant Genomics Laboratory, Institute of Biotechnology, Viikki Biocenter, University of Helsinki, PO Box 65, Viikinkaari 1, FIN-00014, Helsinki, Finland; 2Biotechnology and Food
Research, MTT Agrifood Research Finland, Myllytie 10, FIN-31600, Jokioinen, Finland
Summary
Author for correspondence:
Alan H. Schulman
Tel: +358 40 768 2242
Email: [email protected]
Received: 10 June 2013
Accepted: 30 July 2013
New Phytologist (2013) 200: 1000–1008
doi: 10.1111/nph.12470
Key words: Gag, Hordeum vulgare (barley),
immunolocalization, retrotransposon replication, translation.
The BARE retrotransposon comprises c. 10% of the barley (Hordeum vulgare) genome. It is
actively transcribed, translated and forms virus-like particles (VLPs). For retrotransposons, the
inheritance of new copies depends critically on where in the plant replication occurs.
In order to shed light on the replication strategy of BARE in the plant, we have used immunolocalization and in situ hybridization to examine expression of the BARE capsid protein,
Gag, at a tissue-specific level.
Gag is expressed in provascular tissues and highly localized in companion cells surrounding
the phloem sieve tubes in mature vascular tissues. BARE Gag and RNA was not seen in the
shoot apical meristem of young seedlings, but appeared, following transition to flowering, in
the developing floral spike. Moreover, Gag has a highly specific localization in pre-fertilization
ovaries.
The strong presence of Gag in the floral meristems suggests that newly replicated copies
there will be passed to the next generation. BARE expression patterns are consistent with
transcriptional regulation by predicted response elements in the BARE promoter, and in the
ovary with release from epigenetic transcriptional silencing. To our knowledge, this is the first
analysis of the expression of native retrotransposon proteins within a plant to be reported.
Introduction
The long terminal repeat (LTR) retrotransposons (Class I transposable elements) are ubiquitous in the eukaryotes and account
for upwards of 80% of large plant genomes such as maize, wheat
and barley (Hordeum vulgare; Liu et al., 2007; Wicker et al.,
2009), where they are responsible for many of the changes in
genome size and organization over evolutionary time (Hawkins
et al., 2009; Choulet et al., 2010). They move by a ‘copy and
paste’ mechanism in a lifecycle virtually identical to that of retroviruses, excepting the lack of an extracellular infective phase
(Frankel & Young, 1998; Sabot & Schulman, 2006). Autonomous retrotransposons encode the proteins necessary to replicate
and then insert into the genome (Sabot & Schulman, 2006).
These are expressed as a polyprotein generally in one or two open
reading frames (ORFs) and include: Gag, the capsid protein that
forms the virus-like particles (VLPs); an aspartic proteinase (AP),
which cleaves the polyprotein into functional units; reverse transcriptase (RT) and RNaseH (RH), which produce cDNA from
the transcripts of the retrotransposon; integrase (INT), which
integrates the cDNA back into the genome (Kumar &
Bennetzen, 1999; Wicker et al., 2007). The lifecycle comprises
transcription of genomic copies, translation, packaging of
transcripts into VLPs, reverse transcription, and targeting of the
cDNA copy to the nucleus for integration into the genome
1000 New Phytologist (2013) 200: 1000–1008
www.newphytologist.com
(Sabot & Schulman, 2006; Wicker et al., 2007). In the Copia
superfamily of LTR retrotransposons the coding domains are
organized LTR–gag–ap–in–rt–rh–LTR as one ORF.
Retrotransposon copies may be passed to the next generation
in one of two ways: replication as part of the chromosome; or
propagation by the combined activities of RNA polymerase II
and reverse transcriptase. Both strategies present dilemmas. Accumulation of mutations at the neutral rate during genome replication will eventually lead to the extinction of a retrotransposon
family through loss of promoter activity and translational capacity. By contrast, propagation through the retrotransposon lifecycle, while 1000-fold more error-prone (Gabriel et al., 1996) than
genome replication, offers the possibility of purifying selection.
However, the tissue in which the lifecycle is carried out is critical
to whether or not newly propagated copies will be inherited. In
order for new copies of plant retrotransposons to be inherited,
they must be integrated into the chromosomes of cells that contribute clonally to the floral meristem and ultimately pass into
the nuclei of gametes.
The question of where and when in a plant retrotransposons are
replicated has been hardly studied; the lifecycles of plant retrotransposons have been examined in only a few cases. One, the
BARE retrotransposon of superfamily Copia, accounts for over
10% of the barley genome (Vicient et al., 1999; Wicker et al.,
2009). The LTR of BARE contains two promoters that drive
Ó 2013 The Authors
New Phytologist Ó 2013 New Phytologist Trust
New
Phytologist
transcription (Suoniemi et al., 1996; Vicient et al., 2005;
Chang & Schulman, 2008; Chang et al., 2013). The presence in
the BARE1 promoter of ABA (abscisic acid)-response elements
also found in water stress-induced genes (Suoniemi et al., 1996)
and the observed copy number variation of BARE1 between moist
and dry habitats together suggest that the BARE1 is stress induced
(Kalendar et al., 2000), although it is transcribed and translated as
well under normal growth conditions (Suoniemi et al., 1996;
J€a€askel€ainen et al., 1999; Vicient et al., 2001). The LTRs enclose
an internal domain encoding Gag, INT, AP, RT and RH in a
single ORF matching the Copia organization (Manninen &
Schulman, 1993; Suoniemi et al., 1998; Tanskanen et al., 2007).
Expression of BARE at the protein level has been demonstrated
in extracts from leaves, embryos and callus; the Gag and INT are
processed from the polyprotein in vivo to the predicted size. The
BARE family appears widely active; other species of the tribe Triticeae, as well as oat (Avena sativa) and rice (Oryza sativa), express
proteins of identical size to BARE Gag of barley that react to
anti-Gag antiserum (Vicient et al., 2001). In barley, formation of
VLPs that contain BARE DNA as well as Gag, INT and RT, has
been demonstrated (J€a€askel€ainen et al., 1999). BARE activity had
earlier been demonstrated in extracted whole leaves and embryos,
which are complex structures that contain many types of tissues.
Here, in order to shed light on the replication strategy of BARE
in the plant, we have used a combination of immunolocalization
and in situ hybridization to examine BARE expression at a tissuespecific level.
Materials and Methods
Plant materials and growth conditions
Barley (Hordeum vulgare L.) cv Bomi and Golden Promise was
raised in 1-l pots in a growth chamber with 18 h, 18°C light and
6 h, 14°C dark cycles. Forty days after germination, at the boot
stage before flowering when the first awns were visible – defined
as Zadoks stage 49 (Zadoks et al., 1974) – the plants were subjected to drought stress. No water was given to the plants until
the pots were dry and the first leaves showed symptoms of withering. Thereafter, the plants were maintained on 50 ml water per
day. Samples were collected 3–6 d after the first symptoms of
drought. For immunoblotting, barley root tips and steles were
collected c. 2–3 cm away from the tips of 3-d-old seedlings, and
leaves were collected from 1-wk-old seedlings. The internode,
node and inflorescence tissues including seed scales and stamens
were prepared from mature, c. 40-d-old plants.
Protein extractions and immunoblotting
The anti-Gag and -RT antisera were purified essentially as
described earlier (J€a€askel€ainen et al., 1999; Vicient et al., 2001).
The RT-RH region of BARE was amplified from cDNA with
forward (CTACCTGAAGGCTGCAAGGCTA) and reverse
(CAGCGGGTGCTACATTCAGA) primers. The PCR product
was cloned into pGEMTeasy (Promega) and transformed into
JM109 competent cells. A clone containing the correct reading
Ó 2013 The Authors
New Phytologist Ó 2013 New Phytologist Trust
Research 1001
frame was selected and amplified further using primers matching
the forward and reverse primers, but with the addition, respectively, of BamHI and XhoI restriction sites. The PCR products
were cloned into plasmid Pet14b and the plasmid RT-RH/
Pet14b was transformed into strain BL21(DE3)pLysS E. coli. The
construct was expressed and then purified on a HiTrapTM nickel
metal affinity resin (GE Healthcare Biosciences, Piscataway, NJ,
USA) column, then further purified by SDS-PAGE electrophoresis, before injection into the rabbit. The RT antiserum was raised
as before (J€a€askel€ainen et al., 1999; Vicient et al., 2001). The
proteins were extracted with Strong Denaturing Buffer (SDB)
consisting of 60 mM Tris pH 7.5, 60 mM DTT, 2% SDS and
proteinase inhibitors (10 lM E-64, 4 lM Pepstatin, 2 lM
Leupeptin). Electrophoresis was performed on Bis-Tris gels with
high-MW running buffer as described elsewhere (http://
openwetware.org/wiki/Sauer:bis-Tris_SDS-PAGE,_the_very_best;
Updyke & Engelhorn, 2000). The blotting and immunoreactions
were made as previously described (J€a€askel€ainen et al., 1999).
Paraffin embedding and immunolabeling
For immunolocalizations, plant tissues were prepared under 4%
paraformaldehyde fixative (PFA) buffered either with phosphatebuffered saline (PBS) or 10 mM Hepes pH 7.2, for 10–20 min.
The fixative was then changed to one containing 167 mM EDTA
and incubated for 1–3 h at 32°C, followed by fixation without
EDTA for 1–3 d at + 4°C. Samples were dehydrated in an ethanol series and xylene and then embedded in paraffin. Sections of
3–9 lm thickness were cut, the paraffin removed by xylene, and
the sections rehydrated with an ethanol series. Some sections were
further cleaned by incubation in 0.05% Tween-20 and the antigens were unmasked by heating the samples in a microwave oven
in 10 mM sodium citrate buffer, pH 6.0. The power setting for
the microwave oven was calibrated so that the buffer temperature
increased at a rate of 6.5°C min 1 to avoid boiling and excessive
bubble formation. The final temperature of + 86°C was reached
within 12 min. The buffer was cooled down below + 40°C and
sections washed with PBS. The sections were blocked with 5%
BSA/PBS for 35 min before 1 h 30 min incubation with primary
antibody in all cases. Sections were washed with PBS and further
incubated for 40 min with anti-rabbit IgG conjugated with alkaline phosphatase. This secondary antibody was detected with a
commercial Fuchsin staining kit (DAKO Fuchsin Substrate
Chromogen System, K0625; Dako Denmark A/S, Glostrup,
Denmark) according to the manufacturer’s directions. Color
development was allowed to proceed for 10 min for samples from
normally watered plants and 5 min from drought-stressed plants,
the times being chosen to optimize the balance between specific
staining and background. Sections were mounted in Faramount
(DAKO S3025) and photographs were taken with an Olympus
(Tokyo, Japan) Provis microscope equipped with digital camera.
In situ hybridization
A previously sequenced clone (accession AJ295226) containing
the full-length BARE1 gag was used as template for PCR
New Phytologist (2013) 200: 1000–1008
www.newphytologist.com
New
Phytologist
1002 Research
(a)
32
Gag
23
34
AP
INT
64
RT-RH
153
89
55
Flower
Node
SAM
Leaf
Internode
Root stele
Root tip
Scutellum
G. embryo
(b)
D. embryo
32
Callus
amplification with the forward primer SacI-1 (ATACGAGCT
CATGGCTCGCGGA) and the reverse primer EcoRI-2
(GGAATTCCTTTTTCTTTGGC), which match the ends of
gag and contain the restriction sites SacI and EcoRI, respectively.
The PCR product was digested with SacI and EcoRI and then
cloned into plasmid pSPT18 (DIG RNA Labeling Kit; Roche).
The DIG-labeled gag antisense RNA probe was transcribed with
T7 RNA polymerase and the sense-strand control probe was
synthesized by SP6 RNA polymerase, following the supplier’s
protocol. The probes were treated with DNaseI (Ambion) and
gel-purified. The tissue sections were first deparaffinized in xylene
and then hydrated through an ethanol series. After hydrolyzing
the protein, the sections were post-fixed in 4% paraformaldehyde
and dehydrated through an ethanol series. The hybridization was
done in 800 ll hybridization solution containing 100 ll 109
in situ salts (3 M NaCl, 100 mM Tris pH 8, 100 mM NaH2PO4
pH 6.8, 50 mM EDTA), 400 ll deionized formamide, 200 ll
50% dextran sulfate, 10 ll 1009 Denhardt’s solution, 100 ll
tRNA (10 mg ml 1), and 2 ll RNase inhibitor. The probe was
first denatured for 2–5 min at 80°C in 10 ll hybridization buffer
before the remaining buffer was added. The hybridization was
made overnight at 55°C. After hybridization, the slides were
washed and blocked with blocking solution (1% blocking reagent
in Maleic acid buffer, pH 7.5), anti-Dig antibody 1 : 100 added
to each slide, and the slides incubated for 1 h. Hybridizations
were detected by adding 150 ll of NBT/BCIP (Promega) premix
to each slide, incubating in darkness for 12 h, and then
visualized.
150
90
55
31
Fig. 1 Expression and processing of retrotransposon BARE-encoded
proteins. (a) Diagram of BARE open reading frame showing the four
encoded proteins processed from the polyprotein and their predicted
molecular weight (MW). Below, processing forms and observed MW
following autocatalytic cleavage by integral AP proteinase. (b) Immunoblot
of barley (Hordeum vulgare) cv Bomi organ extracts reacted to anti-Gag
antiserum. Sample details: D. embryo, dormant, dry embryo; G. embryo,
4 d after germination; Scutellum, 4 d after germination; SAM, shoot apical
meristem, 4 d after germination; Flower, before fertilization. Mass in kD
estimated from gel mobility is shown on the right.
Transcription factor binding sites
unprocessed polyprotein was weakly detected in root steles and
internodes.
Searches for binding sites in the BARE1 LTR that recognize transcription factors were carried out online using the PlantPan
(Plant Promoter Analysis Navigator; Chang et al., 2008) as well
as with SIGNAL SCAN (Prestridge, 1991). The LTR of accession Z17327 served as the query sequence.
BARE is expressed as RNA and protein in apical
meristematic regions
Results
BARE proteins are expressed and processed throughout the
plant during development
The BARE ORF encodes a polyprotein predicted to be 153 kD
(Fig. 1). According to the lifecycle model for retrotransposons
and retroviruses, as well as previous results (J€a€askel€ainen et al.,
1999), this polyprotein is cleaved by the integral AP proteinase to
release the RT-RH complex, Gag and INT. Immunoblotting
with an anti-Gag antibody (Fig. 1) reveals successive processing
of the polyprotein to generate the expected intermediate forms of
the polyprotein containing Gag with one or more of the other
domains cleaved off. The full-length polyprotein, as well as 89
and 55 kD intermediates and the 31 kD mature Gag forms, are
detected in varying relative proportions in all organs analyzed
(Fig. 1b). The amount of mature Gag detected varied from tissue
to tissue, being most abundant in nodes, in developing embryos
and in germinating embryos and scutellum, whereas the
New Phytologist (2013) 200: 1000–1008
www.newphytologist.com
The variability in BARE protein expression seen in immunoblotting of barley organs raised the question of whether BARE might
be differentially expressed in a tissue-specific manner within the
organs. To address this, immunolocalizations with anti-Gag antiserum were carried out. The Gag showed intense localization in
root tips in the region of the root initial cells, as visualized in longitudinal sections (Fig. 2a), particularly in the root cap and in cell
files of the cortex corresponding to the expected position of the
vasculature. Cross-sections from the root apex (Fig. 2b–d) show
strong staining for Gag in cells across the stele at the level of the
meristem. A combination of immunolocalization and DAPI
staining of nuclei in meristem cells at various stages of division
(Fig. 2f–h) showed that the Gag is associated with the cytoplasm,
but is not restricted to the perinuclear region. The nuclei themselves appear devoid of Gag. The nondividing cells in the root
cap (Fig. 2e) showed localization also in cytoplasmic granules,
which are likely to be amyloplasts and associated statoliths. In an
extended view (Supporting Information Fig. S1a), Gag is found
throughout the root but appears most abundant in the vascular
initials, meristem and root cap. The BARE RT (Fig. S1b) is
detectable above background concentrations throughout the root
Ó 2013 The Authors
New Phytologist Ó 2013 New Phytologist Trust
New
Phytologist
Research 1003
(a)
(b)
(e)
(c)
(f)
(d)
(g)
(h)
Fig. 2 Immunolocalization of BARE capsid protein Gag in barley (Hordeum vulgare) root tips. (a) Longitudinal section of root tip from germinating embryo
(bar, 200 lm). (b–d) Cross-section of the root tip approximately corresponding to the position shown by the line on (a). (b) Immunolocalization, (c)
combined DAPI staining and immunolocalization, (d) DAPI staining. (e) Higher magnification of cells from the root cap with Gag immunolocalization (top
row), combined DAPI staining and immunolocalization (middle row), and DAPI staining (bottom row). (f–h) Higher magnification of cells from crosssections corresponding to (b–d) with nuclei at various stages of division. Rows are as for (e).
in a pattern resembling Gag, but at a lower abundance as
expected from the stoichiometry of VLPs (Yap et al., 2000).
The axillary shoot apical meristems of young plantlets (Fig. 3a)
displayed strong Gag expression. The meristematic tissues giving
rise to leaf primordia and the inflorescence, already formed as a
rudimentary spike by 18 d after germination (Fig. 3a), stained
intensely for the presence of Gag, while the pre-immune controls
(Fig. 3b) showed no response. Gag was abundant also in the provascular tissue between the shoot and radicle, but not in the
parenchyma. BARE RNA showed a localization pattern similar to
Gag (Fig. 3c).
Earlier in germination, before differentiation of the floral
meristem and leaf primordia, Gag protein and BARE transcripts are present only at low concentrations in the embryonic shoot (Figs 4b,e, S2a,b). However, at the same stage, the
scutellum and aleurone displayed intense staining for Gag,
with high concentrations in vascular tissues of the embryonic
axis (Fig. S2c,d), although the starchy endosperm displayed
only minor and spotty staining (not shown, but similar to
Fig. S4a). This tissue-specific expression pattern cannot be
resolved in the whole-embryo immunoblots (Fig. 1). Closer
examination revealed that the scutellar epithelium and four
sub-epithelial cell layers strongly express the Gag protein, but
an adjacent cell layer that separates the scutellum from the
embryo had very little Gag (Fig. S2c).
Given the sharp polarization of Gag localization in the scutellum, we examined the correlation between the presence of the
protein and BARE RNA in this tissue by in situ hybridization
(Fig. 4). Across the scutellum and embryo as a whole, the
amounts of RNA and Gag corresponded (Fig. 4b,e), the scutellum at 4 d after germination showing intense Gag protein expression. In sharp contrast, the cell layer of the scutellum adjacent to
the embryo shows little Gag (Fig. 4, Fig. S2c) but the BARE
RNA is present more strongly there than in the surrounding cells
(Fig. 4c). Hence, it appears that the RNA produced in this cell
layer is not used to synthesize Gag protein in the same cells.
Ó 2013 The Authors
New Phytologist Ó 2013 New Phytologist Trust
(a)
(c)
F
X
V
(b)
P
X
(d)
Fig. 3 Expression of Gag and BARE RNA in barley (Hordeum vulgare)
shoots. Longitudinal sections of barley shoot tips 18 d after germination.
(a) Reaction to anti-Gag IgG. (b) Reaction to pre-immune serum as the
control. (c) In situ hybridization with antisense probe corresponding to gag
region. (d) Control in situ hybridization with sense probe for gag. The
primordial spike containing floral and (at base) leaf meristems (F),
parenchymatous ground tissue (P) and pro-vascular tissue (V), and axillary
meristems (X) are labelled. Bar, 500 lm.
New Phytologist (2013) 200: 1000–1008
www.newphytologist.com
New
Phytologist
1004 Research
(b)
(a)
(c)
(d)
M
S
Fig. 4 Expression of Gag and RNA in barley
(Hordeum vulgare) scutellum and embryo.
(a) Scutellum and adjoining segment of
embryo; immunolocalization with Gag IgG.
(b) Embryo and scutellum; in situ
hybridization, antisense probe, gag region.
Boxed region corresponds to images in (c)
and (d). (c) Scutellum; in situ hybridization,
antisense probe, gag region (d) Scutellum;
in situ hybridization, sense (control) probe,
gag region. (e) Embryo and scutellum,
immunolocalization with Gag IgG. Boxed
region corresponds to image in (a). Sections
are longitudinal from embryos 4 d after
germination. S, scutellum; M, shoot apical
meristem.
S
(e)
M
BARE Gag and RT are present in barley ovaries and
developing grains
The genomes of cells in the ovule of Arabidopsis are demethylated and consequently transcribe TEs (Slotkin et al., 2009); with
this in mind, we examined the corresponding tissues in barley for
BARE protein expression. As shown in Fig. 5 (and in greater
detail for Gag in Fig. S3), Gag and RT are strongly localized to
specific cell types in the pre-fertilization ovule of barley. The cells
of the ovary wall show only a weak Gag signal, except for those of
the provascular tissue connecting the ovary to the spike. However, large concentrations of Gag are present in the chlorenchymatous tissue adjacent to the ovule, as well as in the outer and
inner integuments and chalaza of the ovule. Within the ovule,
the antipodal cells are strongly stained. RT displays the same
localization pattern as Gag, albeit at the expected lower concentrations. During grain development, Gag accumulated in the
aleurone (Fig. S4) and embryo; by maturity (Fig. 1), the embryo
is rich in Gag.
BARE Gag is strongly expressed and drought responsive in
vascular tissues
The presence of BARE Gag in the floral and embryo provascular tissues led us to examine the vasculature of adult plants.
Immunolocalization on internode cross-sections (Fig. 6a,b)
showed that Gag accumulates in the vascular bundles but not
New Phytologist (2013) 200: 1000–1008
www.newphytologist.com
(a)
(b)
W
(c)
N
Z
T
I
C
P
Fig. 5 Expression of BARE Gag and reverse transcriptase (RT) in barley
(Hordeum vulgare) pre-fertilization ovules. (a) Pre-immune serum, (b)
anti-Gag IgG, (c) anti-RT IgG. C, chlorenchyma; I, integuments; N,
nucellus; P, provascular tissue; T, antipodal cells; W, ovary wall; Z, chalaza.
Anatomical identification and nomenclature according to Engell (1989).
Bar, 1 mm.
in the surrounding parenchyma. The amount of Gag depends
on the position of the bundle within the plant; more is seen
in axillary stems and leaf sheaths than in the main stem
(Fig. 6a,b). Vascular bundles of the outer leaf sheaf display a
small amount of Gag. Within the vasculature, Gag shows specific localization. It is not seen in the collenchymatic tissue
surrounding the vascular bundles (Fig. 6a,b). Within the
Ó 2013 The Authors
New Phytologist Ó 2013 New Phytologist Trust
New
Phytologist
Research 1005
P
(a)
Fig. 6 Immunolocalization of BARE Gag in
barley (Hordeum vulgare) vascular tissues.
Cross-sections of stem above node, reacted
to anti-Gag IgG (a, d, g). Similar sections but
drought treated (b, e, h). Pre-immune
controls from drought-treated sections (c, f,
i). Labeled tissues and cells: A, axillary stem;
C, companion cells; F, phloem; L, leaf sheath;
O, collenchyma; P, parenchyma; S, sievetube elements of phloem; T, tracheids of
xylem; X, xylem. Box in (c) corresponds to
fields shown in (d–f).
1.0 mm
A
F
C
X
(e)
(f)
P
(g)
S T
200 µm
(h)
(i)
200 µm
C
vascular bundles, Gag is not seen in the xylem vessels or in
the peripheral cells, but is highly concentrated in companion
cells surrounding the phloem sieve tubes (Fig. 6d,e). Gag
localization to the companion cells is clearer in longitudinal
sections (Fig. 6g,h), where the dense staining of nuclei is
apparent (Fig. S5).
Gag expression in the vascular tissue was strengthened by
drought treatment, in a variety-dependent manner. Golden
Promise shows more wilting throughout the plant in response to
drought treatment than does cv Bomi. Even for Bomi, immunoreactions on sections require shorter incubations (5 vs 10 min)
in drought-treated (Fig. 6b,e,h) than in control stems for similar
staining levels in the vasculature. Immunoblots, which both
resolve the precursor forms from the processed Gag that is assembled into VLPs and allow samples to be processed together, show
that cv Golden Promise responded to drought more strongly in
terms of Gag than did cv Bomi (Fig. 7). The drought-treated
samples, particularly in the 5th internode and the 6th node, contain more mature Gag than samples from normally watered
plants. Little uncleaved polyprotein was detected in the droughttreated samples, whereas it was still detectable in normally
watered plants, particularly in the nodes. The amount of the
90 kD processed form of the polyprotein remained unchanged
throughout.
Discussion
For retrotransposons, their replicative lifecycle both enables their
copy number to grow into the many thousands in the host
genome and provides a feedback loop for maintaining activity
while deleterious mutations of genomic copies can occur at the
neutral rate, in the absence of selective advantage for the plant.
However, for newly replicated copies of BARE or other
Ó 2013 The Authors
New Phytologist Ó 2013 New Phytologist Trust
(c)
L
O
(d)
(b)
1
i
2
D
3
4
n
5
6
7
i
8
W
n
9 10 11 12
Fig. 7 Immunoblot of drought-stressed and normally watered tissues.
Drought (D, lanes 1–6) and normally watered (W, lanes 7–12) samples of
barley (Hordeum vulgare) cv Golden Promise reacted with anti-Gag
antibody. Internodes (i) and nodes (n) were collected for each treatment.
Lanes correspond to: 1, second internode; 2, fifth internode; 3, sixth
internode, 4, first node; 5, sixth node; 6, seventh node. Lanes 7–12 parallel
samples as in lanes 1–6. Thirty microlitre total protein was loaded per lane.
Arrows correspond to full-length polyprotein (153 kD), processed form
(89 kD), mature Gag (32 kD).
retrotransposons to be inherited, integration events inevitably
must occur in cells giving rise clonally to the next generation.
The lifecycle requires the presence of retrotransposon-encoded
RNA and proteins, something that has not been examined before
in plants within organs or tissues. Using antibodies raised to the
capsid protein Gag, the most abundant of the retrotransposonencoded proteins, we were able to examine the question. We
observed large differences in expression level from tissue to tissue.
The strong Gag and RNA localization in the floral meristems
and mature embryos, in particular, appear consistent with a strategy of replication within cells giving rise ultimately to gametes so
that newly integrated copies can be inherited; it also corresponds
to expression of BARE RNA from the TATA2 of the LTR
(Chang & Schulman, 2008; Chang et al., 2013).
New Phytologist (2013) 200: 1000–1008
www.newphytologist.com
1006 Research
Nevertheless, strong protein expression was seen also in tissues
that do not give rise to gametophytes, such as vascular tissues,
aleurone and scutellum. This may be a byproduct of either BARE
promoter response elements needed for replication in target tissues or generalized activation associated with epigenetic state. In
root tips, the Gag localization resembles that of auxin transport
pathways in Arabidopsis (Marchant et al., 1999).
Localization of BARE Gag in the vascular tissue or vascular initials but not in the surrounding parenchyma was seen elsewhere
in the plant as well. There was little mature Gag compared to the
unprocessed polyprotein seen in root tips, and comparatively
little nuclear staining with anti-Gag antibodies there. This suggests that, in root tips, the BARE lifecycle is hindered by lack of
polyprotein processing to form Gag and thence VLPs, which
then can be localized to the nucleus (Kim et al., 2005; Sabot &
Schulman, 2006; McLane et al., 2008). The polyprotein is processed by AP, a step that could be a replication control point;
aspartic proteinase inhibitors, which would be required for such
control, are known for plants (Headey et al., 2010) and present
in phloem exudates (Walz et al., 2004). Callus cells also contain
comparatively little mature Gag for the amount of polyprotein
detected.
Gag expression is increased by drought treatment, and the
153-kD polyprotein disappears in favor of the mature 32-kD
Gag under drought stress. This indicates that either the polyprotein is processed by the AP or it is degraded in the stressed plants.
The appearance of the mature size Gag and the presence of 95 kD
partially processed polyprotein in the stressed plants supports the
processing scenario. The increase in Gag seen in the vascular
tissue as a response to drought mirrors the presence of an abscisic
acid (ABA) response element (Suoniemi et al., 1996) in the LTR
(ABI4, Table S1) and the eco-geographic correlation between
high BARE copy number and water scarcity (Kalendar et al.,
2000). Moreover, ABA is translocated in the phloem (Hartung
et al., 2002), synthesized companion cells and xylem parenchyma
cells as well as in root tips and hypocotyls (Koiwai et al., 2004),
and produced in response to water stress (Davies & Zhang,
1991). Hence, the BARE Gag and RNA localization pattern in
the vasculature is consistent with a role for ABA in BARE
activation.
In germinating grains, Gag protein was very abundant and
localized in the scutellum in particular, and mirrored the overall
level of BARE RNA expression. The scutellum plays an important
role in the germination of monocot seeds, by both secreting
hydrolytic enzymes from its endothelium, absorbing the glucolytic and proteolytic products, and translocating them to the embryo
(Potokina et al., 2002). The scutellum differentially expresses at
least tens of genes (Potokina et al., 2002), and shows specific or
differential expression of transcription factors (Postma-Haarsma
et al., 1999; Isabel-LaMoneda et al., 2003; Kovalchuk et al.,
2012). The Gag accumulation pattern matched that of the SAD
transcription factor of barley, a DOF-class protein that binds the
pyrimidine box and activates transcription of a GA-induced
promoter (Isabel-LaMoneda et al., 2003). The BARE LTR
contains 15 putative promoter elements (Table S1) matching
motifs of GAMYB, DOF, AMYBOX2, TATCCAOSAMY and
New Phytologist (2013) 200: 1000–1008
www.newphytologist.com
New
Phytologist
WBOXHVISO1, all of which are associated with gibberellin
response or regulation of amylase activity or sugar metabolism
(Huang et al., 1990; Gubler et al., 1999; Yanagisawa & Schmidt,
1999; Sun et al., 2005; Haseneyer et al., 2008; Gaur et al., 2011).
Hence, the BARE protein expression pattern and the promoter
analyses, taken together, are consistent with transcriptional regulation by gibberellin and expression in the embryo and seed.
Strong Gag localization and BARE RNA expression was seen
in floral meristems and axillary shoot apical meristems, but not
in the shoot apical meristem of young seedlings before transition to floral spike formation when Gag appeared in the tissue.
We haven’t examined RNA and Gag expression in the stages
between the transition to flowering and spikelet maturation.
However, their presence in the floral spike implies that new
BARE insertions there will be carried clonally to the ovary even
if BARE expression is downregulated at intervening stages. The
expression of BARE in the floral spike appears to be a good
strategy to favor passage of new retrotransposon copies into the
following generation.
It has been generally held that uncontrolled replication of
retrotransposons is selected against, due to the potentially deleterious effects of disruptive integration into genes and of genome
size growth. BARE and other retrotransposons of high copy number in large genomes such as barley are found mainly in ‘seas’ of
repetitious DNA between ‘gene islands’, mitigating mutagenic
effects (Shirasu et al., 2000; Wicker et al., 2005; Baucom et al.,
2009). Moreover, in meristems, a deleterious retrotransposon
insertion causing cell death or delayed replication would not be
inherited due to consequent replacement of that cell by its neighbors. The repeat regions are also generally heterochromatic, suggesting that most retrotransposon copies in them will be
epigenetically silenced (Mirouze et al., 2009; Saze & Kakutani,
2011). Some retrotransposons, moreover, have been shown to be
post-transcriptionally silenced by small RNAs (Slotkin &
Martienssen, 2007; Slotkin, 2010). However, we show here that
Gag is present in the pre-fertilization ovary, in the chlorenchyma,
integuments, chalaza and antipodal cells. The expression of
BARE in these cells consequently may reflect demethylation as
seen in the ovule of Arabidopsis for the production of siRNAs
targeted at TEs (Slotkin et al., 2009; Calarco & Martienssen,
2011).
The data presented here suggest that BARE employs a replication strategy that could explain its high copy number in the
genome, in contrast to retrotransposons such as Tnt1 or Tos17,
which are rare in the genome and quiescent during plant development, but mobilized by tissue culture and transcriptionally activated by some stresses (Grandbastien et al., 2005; Cheng et al.,
2006). In this regard, the importance of ABA in regulating flower
development under water stress in Arabidopsis (Fitzpatrick et al.,
2011) and its accumulation in spikes of drought-sensitive wheat
(Ji et al., 2011) may help explain both the vascular and floral
spike expression and the drought responsiveness of Gag in the
vasculature that we report here. However, it remains to be established, within the tissues and cells in which BARE is expressed,
what further control mechanisms may be operating to restrict
BARE propagation.
Ó 2013 The Authors
New Phytologist Ó 2013 New Phytologist Trust
New
Phytologist
The advent of new copies depends on the lifecycle of the retrotransposon being completed. Blocks, in cells ultimately passing
nuclei to the next generation, to transcription, translation, packaging into VLPs, reverse transcription, nuclear localization or
integration will attenuate retrotransposon propagation. Hence,
our work establishes the basis for probing the relationship
between the RNA and protein expression patterns and integration events. To answer the question of which RNA and protein
expression sites ultimately give rise to newly integrated copies in
the following generation, it will be necessary to create marked
cDNA copies and retrotransposon proteins under tissue-specific
promoters and monitor the fate of these constructs transgenic
lines. This task is currently in progress.
Acknowledgements
We thank Anne-Mari Narvanto for expert technical assistance.
This work was supported by a grant from the Academy of Finland (Project 123074).
References
Baucom RS, Estill JC, Chaparro C, Upshaw N, Jogi A, Deragon JM,
Westerman RP, Sanmiguel PJ, Bennetzen JL. 2009. Exceptional diversity,
non-random distribution, and rapid evolution of retroelements in the B73
maize genome. PLoS Genetics 5: e1000732.
Calarco JP, Martienssen RA. 2011. Genome reprogramming and small
interfering RNA in the Arabidopsis germline. Current Opinion in Genetics and
Development 21: 134–139.
Chang W, J€a€a skel€a inen M, Li S-P, Schulman AH. 2013. BARE retrotransposons
are replicated and translated via distinct RNA pools. PLoS ONE 8: e72270.
Chang W, Schulman AH. 2008. BARE retrotransposons produce multiple
groups of rarely polyadenylated transcripts from two differentially regulated
promoters. Plant Journal 56: 40–50.
Chang WC, Lee TY, Huang HD, Huang HY, Pan RL. 2008. PlantPAN:
Plant Promoter Analysis Navigator, for identifying combinatorial
cis-regulatory elements with distance constraint in plant gene group. BMC
Genomics 9: 561.
Cheng C, Daigen M, Hirochika H. 2006. Epigenetic regulation of the rice
retrotransposon Tos17. Molecular Genetics and Genomics 276: 378–390.
Choulet F, Wicker T, Rustenholz C, Paux E, Salse J, Leroy P, Schlub S, Le
Paslier M-C, Magdelenat G, Gonthier C et al. 2010. Megabase level
sequencing reveals contrasted organization and evolution patterns of the wheat
gene and transposable element spaces. Plant Cell 22: 1686–1701.
Davies WJ, Zhang J. 1991. Root signals and the regulation of growth and
development of plants in drying soil. Annual Review of Plant Physiology and
Plant Molecular Biology 42: 55–76.
Engell K. 1989. Embryology of barley: time course and analysis of controlled
fertilization and early embryo formation based on serial sections. Nordic Journal
of Botany 9: 265–280.
Fitzpatrick AH, Bhandari J, Crowell DN. 2011. Farnesol kinase is involved in
farnesol metabolism, ABA signaling and flower development in Arabidopsis.
Plant Journal 66: 1078–1088.
Frankel AD, Young JA. 1998. HIV-1: fifteen proteins and an RNA. Annual
Review of Biochemistry 67: 1–25.
Gabriel A, Willems M, Mules EH, Boeke JD. 1996. Replication infidelity during
a single cycle of Ty1 retrotransposition. Proceedings of the National Academy of
Sciences, USA 93: 7767–7771.
Gaur VS, Singh US, Kumar A. 2011. Transcriptional profiling and in silico
analysis of Dof transcription factor gene family for understanding their
regulation during seed development of rice Oryza sativa L. Molecular Biology
Reporter 38: 2827–2848.
Ó 2013 The Authors
New Phytologist Ó 2013 New Phytologist Trust
Research 1007
Grandbastien MA, Audeon C, Bonnivard E, Casacuberta JM, Chalhoub B,
Costa AP, Le QH, Melayah D, Petit M, Poncet C et al. 2005. Stress activation
and genomic impact of Tnt1 retrotransposons in Solanaceae. Cytogenetic and
Genome Research 110: 229–241.
Gubler F, Raventos D, Keys M, Watts R, Mundy J, Jacobsen JV. 1999. Target
genes and regulatory domains of the GAMYB transcriptional activator in cereal
aleurone. Plant Journal 17: 1–9.
Hartung W, Sauter A, Hose E. 2002. Abscisic acid in the xylem: where does it
come from, where does it go to? Journal of Experimental Botany 53: 27–32.
Haseneyer G, Ravel C, Dardevet M, Balfourier F, Sourdille P, Charmet G,
Brunel D, Sauer S, Geiger HH, Graner A et al. 2008. High level of
conservation between genes coding for the GAMYB transcription factor in
barley (Hordeum vulgare L.) and bread wheat (Triticum aestivum L.)
collections. Theoretical and Applied Genetics 117: 321–331.
Hawkins JS, Proulx SR, Rapp RA, Wendel JF. 2009. Rapid DNA loss as a
counterbalance to genome expansion through retrotransposon proliferation in
plants. Proceedings of the National Academy of Sciences, USA 106: 17 811–
17 816.
Headey SJ, Macaskill UK, Wright MA, Claridge JK, Edwards PJ, Farley PC,
Christeller JT, Laing WA, Pascal SM. 2010. Solution structure of the squash
aspartic acid proteinase inhibitor (SQAPI) and mutational analysis of pepsin
inhibition. Journal of Biological Chemistry 285: 27 019–27 025.
Huang N, Sutliff TD, Litts JC, Rodriguez RL. 1990. Classification and
characterization of the rice alpha-amylase multigene family. Plant Molecular
Biology 14: 655–668.
Isabel-LaMoneda I, Diaz I, Martinez M, Mena M, Carbonero P. 2003. SAD: a
new DOF protein from barley that activates transcription of a cathepsin B-like
thiol protease gene in the aleurone of germinating seeds. Plant Journal 33: 329–
340.
J€a€a skel€a inen M, Mykk€a nen AH, Arna T, Vicient C, Suoniemi A, Kalendar R,
Savilahti H, Schulman AH. 1999. Retrotransposon BARE-1: expression of
encoded proteins and formation of virus-like particles in barley cells. Plant
Journal 20: 413–422.
Ji X, Dong B, Shiran B, Talbot MJ, Edlington JE, Hughes T, White RG,
Gubler F, Dolferus R. 2011. Control of abscisic acid catabolism and abscisic
acid homeostasis is important for reproductive stage stress tolerance in cereals.
Plant Physiology 156: 647–662.
Kalendar R, Tanskanen J, Immonen S, Nevo E, Schulman AH. 2000. Genome
evolution of wild barley (Hordeum spontaneum) by BARE-1 retrotransposon
dynamics in response to sharp microclimatic divergence. Proceedings of the
National Academy of Sciences, USA 97: 6603–6607.
Kim MK, Claiborn KC, Levin HL. 2005. The long terminal repeat-containing
retrotransposon Tf1 possesses amino acids in gag that regulate nuclear
localization and particle formation. Journal of Virology 79: 9540–9555.
Koiwai H, Nakaminami K, Seo M, Mitsuhashi W, Toyomasu T, Koshiba T.
2004. Tissue-specific localization of an abscisic acid biosynthetic enzyme,
AAO3, in Arabidopsis. Plant Physiology 134: 1697–1707.
Kovalchuk N, Wu W, Eini O, Bazanova N, Pallotta M, Shirley N, Singh R,
Ismagul A, Eliby S, Johnson A et al. 2012. The scutellar vascular
bundle-specific promoter of the wheat HD-Zip IV transcription factor shows
similar spatial and temporal activity in transgenic wheat, barley and rice. Plant
Biotechnology Journal 10: 43–53.
Kumar A, Bennetzen J. 1999. Plant retrotransposons. Annual Review of Genetics
33: 479–532.
Liu R, Vitte C, Ma J, Mahama AA, Dhliwayo T, Lee M, Bennetzen JL. 2007. A
GeneTrek analysis of the maize genome. Proceedings of the National Academy of
Sciences, USA 104: 11 844–11 849.
Manninen I, Schulman AH. 1993. BARE-1, a copia-like retroelement in barley
(Hordeum vulgare L.). Plant Molecular Biology 22: 829–846.
Marchant A, Kargul J, May ST, Muller P, Delbarre A, Perrot-Rechenmann C,
Bennett MJ. 1999. AUX1 regulates root gravitropism in Arabidopsis by
facilitating auxin uptake within root apical tissues. EMBO Journal 18: 2066–
2073.
McLane LM, Pulliam KF, Devine SE, Corbett AH. 2008. The Ty1 integrase
protein can exploit the classical nuclear protein import machinery for entry into
the nucleus. Nucleic Acids Research 36: 4317–4326.
New Phytologist (2013) 200: 1000–1008
www.newphytologist.com
New
Phytologist
1008 Research
Mirouze M, Reinders J, Bucher E, Nishimura T, Schneeberger K, Ossowski S,
Cao J, Weigel D, Paszkowski J, Mathieu O. 2009. Selective epigenetic control
of retrotransposition in Arabidopsis. Nature 461: 427–430.
Postma-Haarsma AD, Verwoert II, Stronk OP, Koster J, Lamers GE, Hoge
JH, Meijer AH. 1999. Characterization of the KNOX class homeobox
genes Oskn2 and Oskn3 identified in a collection of cDNA libraries
covering the early stages of rice embryogenesis. Plant Molecular Biology 39:
257–271.
Potokina E, Sreenivasulu N, Altschmied L, Michalek W, Graner A. 2002.
Differential gene expression during seed germination in barley (Hordeum
vulgare L.). Functional and Integrative Genomics 2: 28–39.
Prestridge DS. 1991. SIGNAL SCAN: a computer program that scans DNA
sequences for eukaryotic transcriptional elements. Computer Applications in the
Biosciences: CABIOS 7: 203–206.
Sabot F, Schulman AH. 2006. Parasitism and the retrotransposon life cycle in
plants: a hitchhiker’s guide to the genome. Heredity 97: 381–388.
Saze H, Kakutani T. 2011. Differentiation of epigenetic modifications between
transposons and genes. Current Opinion in Plant Biology 14: 81–87.
Shirasu K, Schulman AH, Lahaye T, Schulze-Lefert P. 2000. A contiguous
66 kb barley DNA sequence provides evidence for reversible genome
expansion. Genome Research 10: 908–915.
Slotkin RK. 2010. The epigenetic control of the Athila family of retrotransposons
in Arabidopsis. Epigenetics 5: 483–490.
Slotkin RK, Martienssen R. 2007. Transposable elements and the epigenetic
regulation of the genome. Nature Reviews Genetics 8: 272–285.
Slotkin RK, Vaughn M, Borges F, Tanurdzic M, Becker JD, Feijo JA,
Martienssen RA. 2009. Epigenetic reprogramming and small RNA silencing of
transposable elements in pollen. Cell 136: 461–472.
Sun C, Palmqvist S, Olsson H, Boren M, Ahlandsberg S, Jansson C. 2005. A
novel WRKY transcription factor, SUSIBA2, participates in sugar signaling in
barley by binding to the sugar-responsive elements of the iso1 promoter. Plant
Cell 15: 2076–2092.
Suoniemi A, Narvanto A, Schulman AH. 1996. The BARE-1 retrotransposon is
transcribed in barley from an LTR promoter active in transient assays. Plant
Molecular Biology 31: 295–306.
Suoniemi A, Tanskanen J, Pentik€a inen O, Johnson MS, Schulman AH. 1998.
The core domain of retrotransposon integrase in Hordeum: predicted structure
and evolution. Molecular Biology and Evolution 15: 1135–1144.
Tanskanen JA, Sabot F, Vicient C, Schulman AH. 2007. Life without GAG: the
BARE-2 retrotransposon as a parasite′s parasite. Gene 390: 166–174.
Updyke TV, Engelhorn SC 2000. System for pH-neutral stable electrophoresis
gel. In: United States Patent 6,162,338. Alexandria, VA USA: USPTO.
Vicient CM, J€a€a skel€ainen M, Kalendar R, Schulman AH. 2001. Active
retrotransposons are a common feature of grass genomes. Plant Physiology 125:
1283–1292.
Vicient CM, Kalendar R, Schulman AH. 2005. Variability, recombination, and
mosaic evolution of the barley BARE-1 retrotransposon. Journal of Molecular
Evolution 61: 275–291.
Vicient CM, Suoniemi A, Anamthawat-Jonsson K, Tanskanen J, Beharav A,
Nevo E, Schulman AH. 1999. Retrotransposon BARE-1 and its role in genome
evolution in the genus Hordeum. Plant Cell 11: 1769–1784.
New Phytologist (2013) 200: 1000–1008
www.newphytologist.com
Walz C, Giavalisco P, Schad M, Juenger M, Klose J, Kehr J. 2004. Proteomics
of curcurbit phloem exudate reveals a network of defence proteins.
Phytochemistry 65: 1795–1804.
Wicker T, Sabot F, Hua-Van A, Bennetzen J, Capy P, Chalhoub B, Flavell AJ,
Leroy P, Morgante M, Panaud O et al. 2007. A unified classification system
for eukaryotic transposable elements. Nature Reviews Genetics 8: 973–982.
Wicker T, Taudien S, Houben A, Keller B, Graner A, Platzer M, Stein N. 2009.
A whole-genome snapshot of 454 sequences exposes the composition of the
barley genome and provides evidence for parallel evolution of genome size in
wheat and barley. Plant Journal 59: 712–722.
Wicker T, Zimmermann W, Perovic D, Paterson AH, Ganal M, Graner A,
Stein N. 2005. A detailed look at 7 million years of genome evolution in a
439 kb contiguous sequence at the barley Hv-eIF4E locus: recombination,
rearrangements and repeats. Plant Journal 41: 184–194.
Yanagisawa S, Schmidt RJ. 1999. Diversity and similarity among recognition
sequences of Dof transcription factors. Plant Journal 17: 209–214.
Yap MW, Kingsman SM, Kingsman AJ. 2000. Effects of stoichiometry of
retroviral components on virus production. Journal of General Virology 8:
2195–2202.
Zadoks JC, Chang TT, Konzak CF. 1974. A decimal code for the growth stages
of cereals. Weed Research 14: 415–421.
Supporting Information
Additional supporting information may be found in the online
version of this article.
Fig. S1 Immunolocalization of retrotransposon BARE–encoded
Gag and RT in roots.
Fig. S2 Immunolocalization of Gag in barley grains.
Fig. S3 Immunolocalization of Gag in the pre-fertilization ovule.
Fig. S4 Immunolocalization of Gag in developing barley grains.
Fig. S5 Gag Immunolocalization in drought-stressed barley vascular tissues of the internode.
Table S1 Putative transcription factor binding sites in the LTR
of BARE1
Please note: Wiley Blackwell are not responsible for the content
or functionality of any supporting information supplied by the
authors. Any queries (other than missing material) should be
directed to the New Phytologist Central Office.
Ó 2013 The Authors
New Phytologist Ó 2013 New Phytologist Trust