© 2007 Nature Publishing Group http://www.nature.com/natureneuroscience
ARTICLES
Control of planar divisions by the G-protein
regulator LGN maintains progenitors in the
chick neuroepithelium
Xavier Morin1–3, Florence Jaouen1–3 & Pascale Durbec1,2
The spatio-temporal regulation of symmetrical as opposed to asymmetric cell divisions directs the fate and location of cells in the
developing CNS. In invertebrates, G-protein regulators control spindle orientation in asymmetric divisions, which generate progeny
with different identities. We investigated the role of the G-protein regulator LGN (also called Gpsm2) in spindle orientation and
cell-fate determination in the spinal cord neuroepithelium of the developing chick embryo. We show that LGN is located at the
cell cortex and spindle poles of neural progenitors, and that it regulates spindle movements and orientation. LGN promotes planar
divisions in the early spinal cord. Interfering with LGN function randomizes the plane of division. Notably, this does not affect
cell fate, but frequently leads one daughter of proliferative symmetric divisions to exit the neuroepithelium prematurely and to
proliferate aberrantly in the mantle zone. Hence, tight control of planar spindle orientation maintains neural progenitors in the
neuroepithelium, and regulates the proper development of the nervous system.
All neurons and glial cells that are produced during the development of
the vertebrate nervous system derive from an initial reservoir of
progenitors (P) which constitute the monolayered, pseudostratified
neuroepithelium. An initial phase of proliferation results in the
exponential expansion of this pool by symmetrical, proliferative
(P-P) divisions. The neural tube then enters a neurogenic phase during
which postmitotic neurons (N) are produced by asymmetric (P-N) or
symmetrical terminal (N-N) divisions of progenitor cells1–5.
Neuroepithelial progenitors are highly polarized along their apicalbasal axis. Sub-apical adherens junctions separate the apical membrane
from the baso-lateral domain and maintain the integrity of the
neuroepithelium4,5. Postmitotic cells lack adherens junctions and exit
the neuroepithelium to accumulate in the mantle zone. It has been
proposed that P-P divisions correlate with bisection of the apical
membrane and sub-apical attachments by the mitotic cleavage plane
(planar orientation): both daughters retain a neuroepithelial morphology6,7 (Fig. 1a). Displacement of the mitotic cleavage plane, so that it
bypasses the apical membrane, correlates with P-N divisions: the
daughter cell that inherits the apical domain remains neuroepithelial
and retains a progenitor identity, while the other leaves the ventricular
zone, and differentiates in the mantle zone6,7 (Fig. 1a). This type of
division might be favored by oblique or apico-basal spindle orientation7. In such a model, molecules that are restricted to the apical
domain might act as determinants of a neural stem fate8. Indeed,
experimentally biasing the orientation of the cleavage plane to favor
unequal partitioning of the apical domain correlates with premature
neuronal differentiation in the mouse forebrain9. Hence, precise
positioning of the mitotic spindle could be an essential regulator of
fate acquisition during cortical neurogenesis9,10. However, it is not clear
whether and how this applies to different developmental stages and
different regions of the CNS. In addition, the molecular mechanisms
that regulate spindle orientation in vertebrate neural progenitors are
largely unknown.
The link between orientation of cell division and differential fate
acquisition has been studied in asymmetric cell divisions (ACD) of
Drosophila melanogaster embryonic neuroblasts11,12. These studies
uncovered a role for inhibitory heterotrimeric G proteins (Gai)
and their regulators in controlling mitotic spindle positioning. Loss
of function of Gai (ref. 13), Gb (ref. 14) or Gg (ref. 15), and of
their regulators Pins (also called rapsynoid)16,17, Loco18 and dRic8
(refs. 19,20), all result in defective ACD, primarily caused by abnormal
spindle positioning. This unexpected function of G proteins does not
rely on classical signal transduction pathways; rather, it directly controls
mechanical forces between spindle components and the plasma
membrane11,12. In particular, Pins interacts with cortical GDP-Gai
(ref. 13) and recruits the centrosomal protein Mud to the cell’s apical
cortex21–23. Mud mutant embryos also show abnormal spindle orientation and defective ACD. Hence, Pins seems to have a pivotal role in
ACD, acting not only as a signal but also as a physical bridge between
spindle poles and the cell cortex. The Pins homologs GPR1/2 in
Caenorhabditis elegans24,25 and AGS in the sea urchin (Lytechinus
variegatus)26 have a conserved role in spindle positioning in ACD.
1Université de la Méditerranée and 2Centre National de la Recherche Scientifique UMR6216, Institute of Developmental Biology of Marseill-Luminy, Case 907,
Campus de Luminy, 13288 Marseille Cedex9, France. 3These authors contributed equally to this work. Correspondence should be addressed to X.M.
([email protected]).
Received 5 June; accepted 24 August; published online 14 October; corrected online 26 October 2007; doi:10.1038/nn1984
1440
VOLUME 10
[
NUMBER 11
[
NOVEMBER 2007 NATURE NEUROSCIENCE
CMV-GFP-cLGN
VZ
MZ
Pins has two vertebrate homologs, LGN27
a
b
c
d
e
Basal
Apical
(also called Gpsm2) and AGS3 (ref. 28) (also
t
called Gpsm1), which share highly conserved
P
protein domains and biochemical interactions. Their seven amino-terminal tetratriM
copeptide (TPR) repeats mediate interactions
cLGN E4
cLGN E7
E3
cLGN E6
cLGN
P-P (symmetric)
A
with Mud21–23 and its vertebrate homolog
GFP-cLGN
Hoechst
γ-tubulin
Merge
f
NuMA29. LGN and AGS3 have four and
T
Pins has three C-terminal G-protein regulatory (GPR, also called GoLoco) domains (see
Supplementary Fig. 1 online). GoLoco
P-N (asymmetric)
domains carry a Gai-specific GDI (guanine
dissociation inhibitory) activity30, which
A
simultaneously stabilizes GDP-Gai and comT
petes with its association with Gbg subunits31,
28
thereby promoting Gbg signaling . In the
mouse embryonic cortex, AGS3 influences
k cLGN miRNA, 55hae
spindle positioning during asymmetric divig
h
i
j
sion of neural progenitors, in a process that
involves Gbg subunits10. In vitro studies indicate that LGN could also be involved in this
process: LGN is localized at the cell cortex and
on the spindle poles32–34, and the levels of
LGN and Gai subunits in CHO (Chinese
mRFP
E4
cLGN
cNotch1
Merge
cLGN
E4.5
hamster ovary cell line) cells influence the
forces exerted on, and the position of, the Figure 1 Expression of LGN in the chick embryonic neural tube. (a) Proposed model of the relationship
spindle poles in metaphase32. Furthermore, between spindle orientation and fate acquisition in a schematic representation of the interkinetic
movements in a dividing neuroepithelial cell. From prophase to telophase, the nucleus lies just
mouse LGN can substitute for Pins in a lossunderneath the apical surface. See text for details. Green dotted line, cleavage plane; yellow line,
of-function mutation in Drosophila, and is apical membrane. A, anaphase; M, metaphase; P, prophase; T, telophase. MZ, mantle zone; VZ,
expressed in proliferating cells of the develop- ventricular zone. (b–e) Expression of cLGN is detected by in situ hybridization in the ventricular zone
ing neuroepithelium35. However, little is in thoracic sections of E3–E7 embryos. (f) Distribution of a CMV-driven GFP-cLGN fusion protein in
known about the in vivo function of LGN chick neuroepithelial metaphase cells imaged from their apical surface. Top row: cLGN is enriched
on the spindle poles and at the cell cortex. Bottom row: simultaneous expression of high levels of
in vertebrates.
In this study, we investigate the role of LGN Ct-cLGN displaces the GFP-cLGN fusion protein from the cell cortex. (g–j) Double fluorescence in situ
hybridization shows coexpression (i) of cLGN (g) and cNotch1 (h) in the neuroepithelium of E4 embryos;
in the regulation of spindle orientation and (j) higher magnification shows coexpression in a metaphase cell (top, Hoechst + cLGN; middle, Hoechst
the balance between asymmetric and sym- + cNotch1; bottom, merged image). Grey dotted line, apical surface; white dotted line, metaphase cell
metric divisions in the developing chick spinal outline. (k) Electroporation with the cLGN miRNA vector results in efficient knock-down of cLGN
cord. We show that LGN is expressed in transcript (left). The downregulation is particularly apparent in the dorsal part of the neural tube
neuroepithelial cells, and localizes to the cell (asterisk), where more red fluorescent protein (RFP) reporter signal is also visible on an adjacent
membrane and spindle poles in metaphase section (right). hae, hours after electroporation.
and anaphase. Inhibition of LGN activity in
dividing progenitors results in random spindle orientation. Notably, expression of cLGN paralleled that of cNotch1, indicating that expresthis does not affect the fate of the progeny. However, it often leads sion was restricted to neuroepithelial progenitors (Fig. 1g–j). The
proliferative daughter cells to leave the neuroepithelium prematurely transcript was downregulated in postmitotic neurons, from which it
and divide excessively in the mantle zone. Our data indicate that planar was absent, or at least undetectable by in situ hybridization.
divisions of neural progenitors depend on a conserved G-protein
We used the weak cytomegalovirus (CMV) promoter to express low
regulatory mechanism, and must be tightly controlled to maintain levels of a green fluorescent protein (GFP)-cLGN fusion protein in
neural progenitors in the neuroepithelium.
chick E3 neuroepithelial cells (see Supplementary Fig. 1 for details of
all expression vectors used). GFP-cLGN co-localized with the centroRESULTS
somal marker g-tubulin throughout the cell cycle. We found that cLGN
Chick LGN is expressed in neuroepithelial cells
was enriched at the cell cortex during metaphase and anaphase (Fig. 1f
Reverse transcriptase polymerase chain reaction (RT-PCR) experi- and Supplementary Fig. 2 online). This cortical enrichment was not
ments on chick embryonic trunks at embryonic days E3 and E4 showed detected during telophase, although the centrosomal staining
expression of cLGN, whereas we did not detect the full-length cAGS3 remained, and a weak signal, possibly corresponding to the midbody,
transcript (data not shown). All chick cAGS3 sequences in the was observed at the cleavage site (Supplementary Fig. 2). This agrees
databases share a frameshift upstream of the Gai interaction domains, with in vitro data showing that mammalian LGN is localized on the
which prevents production of a full-length protein (see Methods). We spindle poles and at the cell cortex during mitosis32,33, and is relocalized
therefore focused our analysis on cLGN.
to the midbody during cytokinesis36.
Using in situ hybridization, we detected cLGN (also called Gpsm2), in
The cortical recruitment of LGN depends on the interaction of the
the neural tube at all stages examined from E2 to E7 (Fig. 1 and data GoLoco domains with cortical GDP-Gai subunits, which are present in
not shown) at all antero-posterior and dorso-ventral levels. The limiting quantities at the cell cortex32. An excess of GoLoco domains
CMV-GFP-cLGN
+ CX-Ct-cLGN
© 2007 Nature Publishing Group http://www.nature.com/natureneuroscience
ARTICLES
NATURE NEUROSCIENCE VOLUME 10
[
NUMBER 11
[
NOVEMBER 2007
1441
ARTICLES
β-catenin
H2B-GFP
Figure 2 cLGN regulates planar spindle
FL-cLGN
Myc
β-catenin
GFP, Hoechst
mRFP
0%
90°
90°
orientation in neuroepithelial cells.
83
79
25%
75°
(a) Quantification of the axis of division relative
10
10 75°
5 60°
3 60°
to the ventricular surface in anaphase cells. The
I
50%
0
1
value in each 151 section of the quadrants is the
45°
45°
3
75%
2 0
α
4
30°
30°
percentage of all angles (a, measured as indicated
n = 73
0° 15° n = 59
0° 15°
100%
on the top left panel in b for each construct. Most
cLGN miRNA
Ct-cLGN
cLGN miRNA
+ mLGN rescue
control (n ¼ 59) and full-length (FL)-cLGN
90°
90°
I
90°
(n ¼ 73) cells fall within the 75–901 section.
40
26
76
12 75°
12 75°
Ct-cLGN expression (n ¼ 77 cells) or cLGN
14 75°
2.5 60°
10 60°
21 60°
knock-down (n ¼ 77) results in random division
6
12
8
45°
45°
45°
axis. Expression of FL-mLGN rescues the cLGN
2.5 1
16 10 30°
14 17 30°
30°
knock-down phenotype (n ¼ 78). The red line
n = 77
n = 77
n = 78
0° 15°
0° 15°
0° 15°
I
shows the median value of a for each condition.
aPKC-ζ / mRFP β-catenin / mRFP N-cadherin / mRFP
(b) Representative examples of control, FL-cLGN,
Ct-cLGN and cLGN miRNA cells in anaphase.
Vertical bar in left panels indicates the position of
the apical membrane of the dividing cell, from
I
which b-catenin staining (red) is absent. Dotted
line indicates the axis of division, which bisects
the apical membrane in control and FL-cLGN
Myc
Ct-cLGN
cLGN miRNA
expressing cells, but bypasses it in the Ct-cLGN
expressing and cLGN miRNA cells. The anaphase
chromosomes of transfected cells are revealed by
the H2B-GFP reporter (green). (c) Antibodies to
g-tubulin (red) and to aPKC-z (blue) reveal normal
mRFP
counts and positioning of centrosomes relative
to the chromosomes, and unperturbed apical
polarity, respectively, in cLGN miRNA and Ct-cLGN expressing cells compared to controls. (d) The apical marker aPKC-z and sub-apical adherens junction
markers b-catenin and N-cadherin show the same distribution in cLGN miRNA cells as in the non-electroporated, contralateral side.
b
Ct-cLGN
cLGN miRNA
d
cLGN miRNA
should therefore titrate cortical Gai subunits. We used the strong chick
b-actin (CX) promoter to express high levels of a truncated version of
cLGN (Ct-cLGN) that contains only the C-terminal GoLoco domains,
together with low levels of the CMV-driven GFP-cLGN. As expected,
the GFP signal was no longer detected at the cell cortex of metaphase
progenitors (Fig. 1f). In the following experiments, we used expression
of Ct-cLGN as a tool to prevent the formation of a Gai-LGN-NuMA
complex and to interfere dominantly with endogenous cLGN function.
In parallel, we used a microRNA (miRNA)-based vector37 to knock
down cLGN in neuroepithelial cells (Fig. 1k).
Chick LGN is required for planar spindle orientation at E3
We investigated whether cLGN is required to orient neuroepithelial cell
divisions (Fig. 2a). At E3, most control cells (bearing a Myc tag vector)
divided within the plane of the neuroepithelium (60–901; planar
divisions), whereas very few cells divided with an oblique (30–601)
or apico-basal (0–301) axis (median division angle am ¼ 831, n ¼ 59).
The results were identical when full-length cLGN was overexpressed
(am ¼ 821, n ¼ 73, P ¼ 0.777).
Notably, both expression of Ct-cLGN and cLGN knock-down
resulted in randomization of the axis of division of neuroepithelial
cells (Fig. 2a; am ¼ 501, n ¼ 77, P o 0.001 for Ct-cLGN and am ¼ 651,
n ¼ 77, P o 0.001 for cLGN knock-down). Representative examples
are shown in Figure 2b. LGN knock-down was rescued by expression of
full-length mouse (m)LGN (am ¼ 821, n ¼ 78, P ¼ 0.661 when
compared to control), confirming the specificity of the knock-down.
Hence, cLGN is required for planar divisions. This contrasts with
previous data showing that the LGN ortholog AGS3 favors oblique and
apico-basal divisions in mouse cortical progenitors10.
Reduced spindle movements cause defective orientation
Defective spindle orientation could be caused by abnormal centrosomal counts9, loss of integrity of the apico-basal polarity38, or
1442
c
H2B-GFP
γ-tub, aPKC-ζ
© 2007 Nature Publishing Group http://www.nature.com/natureneuroscience
FL-cLGN
Myc
a
impaired spindle movements10. Knock down of cLGN or expression
of Ct-cLGN did not produce any defect in the number and position of
centrosomes relative to metaphase, anaphase or telophase chromosomes (Fig. 2c and data not shown). The localization of the apical
marker aPKC-z and of the adherens junction markers b-catenin and
N-cadherin was also indistinguishable from the control localization in
mitotic and interphase cells (Fig. 2c,d and data not shown). We then
investigated the possibility that spindle movements were impaired.
Time-lapse videomicroscopy in rat, mouse and chick embryonic
neural progenitors39–41 has shown that the metaphase plate typically
forms at a random angle relative to the ventricular surface. The spindle
then harbors intense rocking movements, until immediately before
anaphase. In E2–E3 chick embryos, most divisions are planar, irrespective of the spindle orientation at the onset of metaphase41. We used a
histone2B-GFP fusion reporter to visualize chromosomal movements
during metaphase and anaphase in dividing neural progenitors on
cultured trunk sections of E3 embryos (Fig. 3). Control cells showed
robust rocking movements (Fig. 3b and Supplementary Video 1
online), many of them performing more than half a complete revolution (Fig. 3b,d and Supplementary Fig. 3 online). By contrast, cells
expressing Ct-cLGN showed limited oscillatory movements (Fig. 3c
and Supplementary Video 2 online), and divided within 251 of their
initial position (Fig. 3c,d and Supplementary Fig. 3). The average
deviation of the mitotic spindle at 1-min intervals showed a significant
reduction in spindle movements in cells expressing Ct-cLGN (control:
19 ± 7.21 min–1; Ct-cLGN: 5.6 ± 2.21 min–1; P o 0.001; Fig. 3e). This
indicates that interactions between GoLoco domains and their cortical
partners, presumably Gai subunits, are involved in spindle movements.
Chick LGN maintains progenitors in the neuroepithelium
Randomization of the spindle orientation, by decreasing the number of
planar divisions, should increase the number of divisions in which the
cleavage plane bypasses rather than bisects the apical membrane9
VOLUME 10
[
NUMBER 11
[
NOVEMBER 2007 NATURE NEUROSCIENCE
ARTICLES
a
d
Figure 3 Ct-cLGN expression reduces metaphase
plate movements in neuroepithelial cells.
(a) Schematic representation of the metaphase
plate rotation (da) in a chick neuroepithelial cell
as observed in time-lapse analysis of cultured
sections of electroporated neural tubes. The H2BGFP fusion reporter (green) labels chromosomes
on the metaphase plate. (b,c) Movements of the
metaphase plate in representative wild-type or
Ct-cLGN expressing cells. Confocal stacks were
recorded at 1-min intervals between metaphase
plate condensation and anaphase. Successive
positions of the metaphase plate at 6 time-points
over an 18-min period are summarized in the
lower right panels of b and c, indicating a total
rotation (a) of 2351 for the control cell and 221 for
the Ct-cLGN-expressing cell. White dashed lines,
apical surface. (d) Total a rotation during
metaphase is consistently reduced in Ct-cLGNexpressing cells. (e) Successive displacements
(da) of the metaphase plate were recorded at
1-min intervals (dt). The average values (Da)
calculated for each of 10 control and 9 Ct-cLGNexpressing cells are plotted, indicating a threefold
reduction in Ct-cLGN expressing cells compared
to controls (P o 0.001). Error bars, s.e.m.
Total spindle
displacement from
metaphase onset to anaphase
δα
α = Σδα
360
H2B-EGFP
α (degrees)
Metaphase
pCX-H2B-EGFP
,
–18
,
–11
,
–7
240
Control (n = 10)
Ct-cLGN (n = 9)
120
,
–4
0
e
,
,
0
–2
,
+4
Average spindle
displacement at 1-min
intervals
∆α = [Σabs(δα)]/Σδt
α = 235°
c
,
–18
,
–11
,
–2
0
,
–7
,
∆α (degrees per min)
pCX-H2B-EGFP
+ pCX-Ct-cLGN
30
,
–4
,
+4
α = 22°
a
b
Identity of pairs of
+
GFP sister cells
100
10
0
Percentage of
two-cell clones
50
0
P-N
Ct-cLGN
Control
Ct-cLGN
100
50
50
0
N-N
Identity and position of pairs of GFP+ sister cells
Control
V-V
V-M
V-V
M-M
NATURE NEUROSCIENCE VOLUME 10
[
NUMBER 11
[
NOVEMBER 2007
0
100
V-V
V-M
50
P-N
0
100
M-M
50
V-M
N-N
Figure 4 In vivo clonal analysis of the fate and distribution of pairs
of sister cells. (a) Quantification of the identity of pairs of GFP+ sister
cells, based on Sox2 expression in control (n ¼ 137 clones) and
Ct-cLGN-expressing embryos (n ¼ 138 clones) at E4. (b) Quantification of clones based on the spatial distribution of the sister cells
in the same set of clones as in a. (c) Representative examples of all
types of clones obtained in the clonal analysis in wild-type and
Ct-cLGN–expressing clones. Combining the identity and distribution
of sister cells reveals morphologically abnormal P-P clones in
Ct-cLGN expressing embryos. These clones have either one or two
of the Sox2+ sister cells in the mantle zone (white arrows). Colored
bars represent the frequency of each type of clone in a quantitative
analysis of the same set of clones as in a and b. Many Sox2+ cells
are present in the mantle zone of Ct-cLGN–expressing embryos,
reflecting the fact that Ct-cLGN expression is not limited to GFP
clones. Sox2+GFP+ (P) and Sox2–GFP+ (N) cells are indicated with a
white arrow or an asterisk, respectively. V-V, clones with two cells in
the ventricular zone; V-M, clones with one cell in the ventricular
zone and one cell in the mantle zone; M-M, clones with two cells in
the mantle zone. The limit between ventricular zone and mantle zone
is represented by a vertical dotted line.
0
100
50
P-P
P-P
the position (ventricular versus mantle zone) and identity (P versus N)
of the daughter cells. Expression of the transcription factor Sox2 was
used as a criterion to identify progenitors.
Remarkably, the expression of Ct-cLGN did not change the frequency of P-P, P-N and N-N clones (Fig. 4a). However, the proportion
c
Position of pairs of
GFP+ sister cells
100
Control
Ct-cLGN
Control (n = 10)
Ct-cLGN (n = 9)
*
20
(Fig. 2b), possibly leading to exit of daughter cells from the ventricular
zone and to premature differentiation. We developed an in vivo clonal
analysis method to label the progeny of individual wild-type or
Ct-cLGN-expressing cells in the neural tube with a conditional GFP
reporter (see Methods). We classified the two-cell clones according to
Percentage of
two-cell clones
© 2007 Nature Publishing Group http://www.nature.com/natureneuroscience
b
GFP, Sox2
δt
0
100
V-M
50
M-M
VZ
MZ
0
M-M
VZ
MZ
1443
ARTICLES
cNotch1
Figure 5 Ectopic expression of progenitor markers in the mantle zone of
cLGN-deficient embryos. Embryos electroporated at E2 with the indicated
constructs were harvested 48 h later. (a–t) Adjacent sections were used to
visualize electroporation efficiency with GFP or mRFP expression (a,e,i,m,q),
to reveal neural progenitors by in situ hybridization with a cNotch1 probe
(b,f,j,n,r) and its target hes5-1 (c,g,k,o,s), and for the postmitotic
neuronal marker bIII-tubulin (d,h,l,p,t).
βIII-tub
hes5-1
c
d
e
f
g
h
i
j
k
l
FL-cLGN
the P-P clones expressing Ct-cLGN contained two ventricular zone
cells. Most of the other P-P clones corresponded to one ventricular
zone and one mantle zone cell, and a few consisted of two mantle zone
cells. We conclude that randomization of the spindle orientation does
not affect fate acquisition, but frequently affects P-P divisions so that
only one of the progeny remains neuroepithelial.
Ct-cLGN
Ectopic abventricular cells are still cycling progenitors
To confirm that the Sox2+ cells that exit the ventricular zone were
bona fide progenitors, we analyzed the expression of several
progenitor markers at different times after electroporation at E2. The
results at E4 (48 h after electroporation) are shown in Figure 5. In
embryos electroporated with control constructs (Myc tag, full-length
cLGN, full-length mLGN and luciferase miRNA37), expression of
cNotch1 and its target hes5-1 was restricted to progenitor cells in the
ventricular zone (Fig. 5b,c,f,g and data not shown). By contrast,
interfering with cLGN by expression of Ct-cLGN or knock-down of
cLGN resulted in the massive expression of these markers in
the mantle zone on the electroporated side of the neural tube
(Fig. 5j,k,n,o). The neuronal marker bIII-tubulin was absent in the
zone of strong ectopic cNotch1 and hes5-1 expression (Fig. 5l,p),
indicating that those cells did not express neuronal differentiation
markers. The cLGN knock-down was rescued by full-length mouse
LGN (Fig. 5q–t).
We investigated whether ectopic cells expressing progenitor markers
were proliferative, using incorporation of the thymidine analog 5bromodeoxyuridine (BrdU) during a 1-h pulse and phosphorylated
histone-H3 (PH3) as markers of cells in S-phase and M-phase,
respectively (Fig. 6). BrdU+ and PH3+ cells, which were restricted
to the ventricular zone in control embryos (Myc tag, Fig. 6a,e;
full-length cLGN, Fig. 6b,f; luciferase miRNA, not shown), were
n
o
p
q
r
s
t
miRNA + mLGN
cLGN miRNA
m
of GFP+ clones that contained two neuroepithelial daughters in the
ventricular zone was decreased (Fig. 4b). This was caused by abnormal
positioning of the daughters of P-P divisions (Fig. 4c, top); whereas all
control P-P clones consisted of two ventricular zone cells, only half of
a
FL-cLGN
b
Ct-cLGN
c
cLGN miRNA
d
Proliferating cells
in the VZ of the
electroporated side
i
150
e
f
g
h
Percentage of cells on
the contralateral side
BrdU (1 h)/ Hoechst
Myc
PH3 / Hoechst
© 2007 Nature Publishing Group http://www.nature.com/natureneuroscience
Myc
b
*
*
*
Total proliferating
cells (VZ + ectopic) in
the electroporated side
j
150
*
Percentage of cells on
the contralateral side
GFP / mRFP
a
100
50
0
**
*
*
*
100
50
0
BrdU
Myc
FL-cLGN
Control miRNA
PH3
BrdU
Ct-cLGN, VZ
cLGN miRNA, VZ
PH3
Ct-cLGN, ectopic
cLGN miRNA, ectopic
Figure 6 Hyperproliferation of abventricular progenitors in cLGN-deficient embryos. (a–h) The same embryos as in Figure 5 were used to reveal the presence of
proliferating cells in S-phase (BrdU, a–d) or M-phase (PH3, e–h). Ectopic S- and M-phases were detected in the mantle zone of Ct-cLGN and cLGN-miRNA
electroporated neural tubes. (i,j) Quantification of proliferating cells in E4 neural tubes shows a reduction in the number of proliferating cells in the ventricular
zone of embryos expressing cLGN miRNA or Ct-cLGN (i). However, the total number of proliferating cells in the neural tube, including ectopic cells in the
mantle zone (dashed part of the bar), is significantly increased (j). These values are not corrected for non-electroporated cells and are, therefore, an
underestimation of the effect of cLGN miRNA and Ct-cLGN (see Supplementary Methods). *P o 0.005; **P ¼ 0.029. Error bars, s.e.m.
1444
VOLUME 10
[
NUMBER 11
[
NOVEMBER 2007 NATURE NEUROSCIENCE
ARTICLES
e
a
TtA
CAGGS
E6: 96 hae, +72 h Dox
E7: 120 hae, +96 h Dox
nEGFP
IRES
TRE
Myc-Ct-cLGN
E3
E4
E5
E7
Without Dox injection
With Dox injection
Sacrifice
d
nEGFP
Myc
36 hae, +12 h Dox
Myc
BrdU (1 h pulse)
Ct-cLGN levels
Dox injection
nEGFP
E6
t
Electroporation
c
Myc-Ct-cLGN
PH3
E2
36 hae, –Dox
Figure 7 Ectopic progenitors cycle for several days in the mantle zone
independently from cLGN misregulation. (a) Schematic of the constructs
used for the transient expression of Ct-cLGN. pCIG-Tet-Off constitutively
expresses the transcriptional activator TtA and a nuclear GFP reporter
(nEGFP); pBI-Ct-cLGN contains Myc-tagged Ct-cLGN cDNA under the
control of the TtA responsive promoter (TRE). In the absence of doxycycline
(Dox), TtA is active. Dox binds to and inactivates TtA, silencing the
TtA-responsive promoter. (b) Time course of the protocol used to transiently
express Ct-cLGN between E2 and E3.5. Treatment with Dox blocks Ct-cLGN
expression at E3, leading to a rapid decrease in Ct-cLGN by E3.5 (red line).
In the absence of Dox (dotted red line), Ct-cLGN expression is maintained
(Ct-cLGN expression was not assessed beyond E5 in the absence of Dox). (c,d) A 12-h treatment with Dox is sufficient for complete disappearance of Ct-cLGN.
Transverse sections in the neural tube of E3.5 embryos treated (d) or not (c) with Dox at E3. Ct-cLGN levels are revealed with anti-Myc staining (red), whereas
nuclear EGFP (green) reveals the level of electroporation. (e) After they exit the ventricular zone, ectopic progenitors still proliferate in the mantle zone for up
to 4 d after Ct-cLGN extinction. Embryos were treated daily with Dox and harvested after 3 d (E6, left) or 4 d (E7, right). BrdU incorporation, PH3+ cells and
hes5-1+ cells are found in the mantle zone of the electroporated side (revealed by nEGFP, top).
hes5-1
© 2007 Nature Publishing Group http://www.nature.com/natureneuroscience
b
Ct-cLGN
TRE
nEGFP
+Dox
detected ectopically in the mantle zone of embryos electroporated
with Ct-cLGN (Fig. 6c,g) and cLGN miRNA (Fig. 6d,h). We
quantified the number of BrdU+ cells and of PH3+ cells between the
electroporated side of the neural tube and the contralateral side 48 h
after electroporation. Not surprisingly, both cLGN knock-down and
Ct-cLGN expression resulted in a significant reduction in the number
of proliferating cells in the ventricular zone of the electroporated side
(Fig. 6i). However, when we included the ectopic proliferating cells in
this analysis, we found a substantial increase in the total number of
BrdU+ and PH3+ cells on the electroporated side.
The number of ectopic proliferating progenitors consistently represented two to three times the number of cells missing from the
ventricular zone (dashed bars in Fig. 6j), indicating that ectopic
progenitors performed multiple rounds of division in the mantle
zone. To investigate this possibility, we used a tetracycline-regulated
promoter42 to induce a 24-h pulse of Ct-cLGN expression, limiting the
production of misplaced progenitors to a time window between E2 and
E3.5 (Fig. 7a–d). Under these conditions, ectopic cycling (PH3+,
BrdU+) progenitors (hes5-1+, cNotch1+) were still found in the mantle
zone at E4, E5, E6 and E7 (Fig. 7e and data not shown). Hence,
inducing defective spindle orientation in the neuroepithelium between E2 and E3.5 was sufficient to produce ectopic neural
NATURE NEUROSCIENCE VOLUME 10
[
NUMBER 11
[
NOVEMBER 2007
progenitors which remained proliferative within the mantle zone for at
least 4 d. This indicates that ectopic progenitors performed more than
one cycle. Interestingly, as observed with continuous expression of
Ct-cLGN or cLGN miRNA (Fig. 6j), BrdU+ cells were also systematically more numerous on the electroporated side of the neural tube
of embryos that had received a short pulse of Ct-cLGN expression
(134.7 ± 14.9% of the contralateral side, n ¼ 10 sections from two E6
embryos). This indicates that cLGN does not regulate the progenitor
cell cycle directly, but that excessive proliferation is a consequence of
progenitors being outside of the neuroepithelium. We conclude that
spindle orientation by cLGN is essential for the maintenance of neural
progenitors within the neuroepithelium, which is required to control
the overall proliferation of neural progenitors.
DISCUSSION
The choice between symmetric and asymmetric modes of cell division
is essential to regulate the balance between growth and differentiation
in the developing vertebrate nervous system. Several studies have
suggested that the control of orientation of the mitotic spindle in
dividing neuroepithelial cells is a key process in regulating this
choice9,10. We have shown here that a mechanism that involves the
G-protein regulator LGN regulates mitotic spindle movements to favor
1445
© 2007 Nature Publishing Group http://www.nature.com/natureneuroscience
ARTICLES
planar orientation of cell division. Interestingly, our data indicate that
spindle orientation does not dictate cell fate choice in the early spinal
cord. However, control of planar divisions by LGN is essential to
maintain progenitor cells derived from symmetric divisions within the
neuroepithelium. Failure to do so results in aberrant proliferation in
the neural tube. Our results illustrate the notion that maintenance of
proliferating cells within the neuroepithelium is not a default mechanism, and needs to be tightly controlled during mitosis to ensure proper
development of the CNS.
The G-protein regulator LGN was a likely candidate to regulate
spindle orientation in chick neuroepithelial cells: its homologs in
Drosophila and C. elegans are involved in spindle positioning in
ACD16,17,24,25, and mouse LGN can compensate for loss-of-function
of Pins in Drosophila35. The LGN paralog AGS3 also regulates spindle
orientation in asymmetrically dividing mouse cortical progenitors10. In
all these models, the fate of the progeny has been, to some extent, linked
with precise orientation of the mitotic spindle. We were therefore initially
surprised to find that interfering with cLGN function did not change cell
fate acquisition in the chick spinal cord. However, all previous studies
point to spindle positioning as the main role of the different orthologs.
Whether this is required for cell-fate choices could depend on the
necessities of a particular developmental context. For example, asymmetric positioning of the spindle in Drosophila embryonic neuroblasts or
in the C. elegans zygote is necessary to create differential identity in the
daughter cells. By contrast, in the context of early neuroepithelial
development, where maintenance of neuroepithelial architecture is a
priority during expansion of the tissue, active control of spindle
positioning is required to favor planar divisions.
LGN and its homologs therefore appear to be general effectors of
spindle orientation: they translate upstream information, provided by
specific cortical interactors, into directional information to orient the
forces exerted on the spindle poles. In cultured cells, increased levels of
Gai subunits recruit LGN and attract spindle poles to the cell cortex32.
This accounts for radial movements of the spindle poles, but does not
explain the strong tangential rotations of the spindle observed in
neuroepithelial cells. We propose that cLGN probes the cell cortex
for differential levels of GDP-Gai, leading to the accumulation and
stabilization of Gai-LGN-NuMA complexes, and attraction of the
spindle poles to specific spots on the cell cortex as the cell approaches
anaphase. Interestingly, although cLGN miRNA and Ct-cLGN constructs should, respectively, decrease and increase GDI activity, both
produced the same defect in spindle orientation. This reinforces the
view that spindle orientation relies on the formation of the Gai-LGNNuMA bridge rather than on classical Gai signaling. In agreement with
this model, in Drosophila neuroblasts, the mitotic spindle aligns with
the center of cortical crescents of high Gai, LGN and Mud accumulation13,16,17,22. We did not detect any clear asymmetric or polarized
accumulation of GFP-cLGN on the cell cortex in metaphase cells.
However, we sometimes saw a relatively stronger GFP-cLGN signal on
cortical spots (Supplementary Fig. 2). This raises the question of the
nature of these spots, and of the involvement of Gai subunits and their
regulators in their specification. Real-time monitoring of the dynamics
of these molecules distribution will help to clarify their roles in the
regulation of spindle orientation.
Interfering with cLGN did not affect the location of the progeny of
P-N divisions in the neuroepithelium. These might not depend as
crucially as P-P divisions on precise positioning of the spindle, as
most possible positions will effectively bypass the sub-apical domain
and produce non-planar divisions. However, cLGN expression is
maintained in the chick neuroepithelium at stages when most
divisions are neurogenic (Fig. 1c–e) Hence, cLGN might also regulate
1446
spindle orientation in P-N divisions in conjunction with additional
partners, such as Insc (the homolog of Drosophila Inscuteable).
Several elements support this hypothesis: Pins and mammalian LGN
interact directly with fly and mammalian Insc, which regulate
asymmetric spindle orientation in Drosophila neuroblasts43 and rat
retinal progenitors44, respectively; interaction with Inscuteable is
required for asymmetric localization of Pins in Drosophila17,45; and
finally, in mouse embryos, LGN and mInsc colocalize at the apical
cortex of epidermal progenitors that are dividing asymmetrically along
their apico-basal axis46.
In the mouse embryonic cortex, AGS3 regulates spindle movements
to promote oblique spindle orientation10. Interestingly, the study on
AGS3 function was performed at later stages of development and well
into neurogenesis; in this context, AGS3 seems to maintain a ‘stem-like’
mode of division (P-N) over terminal N-N divisions. The present study
addresses the function of LGN during the transition from exponential
growth (P-P) to neurogenesis (P-N) in the early chick spinal cord. Both
molecules control spindle orientation, but the outcome is markedly
different: LGN promotes planar divisions, whereas AGS3 promotes
oblique and apico-basal divisions. This points towards a general twostep mechanism for spindle orientation during CNS development.
Spindle orientation would be random by default. The first level of
control would rely on LGN-mediated G-protein signaling to regulate
planar divisions; the second level of control would use AGS3-mediated
G-protein regulation to disrupt planar orientation and allow oblique
and apico-basal divisions. Interestingly, AGS3 acts through Gbg
activation10, indicating that the GDI activity of its GoLoco domain is
predominant. Sequence databases and RT-PCR experiments indicate
that chick AGS3 can not be expressed as a full-length protein. However,
the GoLoco domains of AGS3 are expressed in the spinal cord of chicks
at E3 and E4 (data not shown). In addition, specific, short C-terminal
isoforms corresponding to the GoLoco domains of AGS3 are expressed
in the rat47. It is tempting to speculate that in some neuroepithelial
cells, expression of the GoLoco domains of cAGS3 could counter the
effect of cLGN to favor oblique divisions, just like the ‘dominant
negative’ Ct-cLGN used in our study.
This leads to the question of how spindle orientation and fate
acquisition are coupled. One model proposes that a neural stem-cell
fate determinant is present in the apical membrane of neural progenitors8, so that the plane of division co-ordinately controls the identity
and location of the progeny. Several studies in the mouse cortex and rat
retina show that shifting spindle orientation toward more planar10,44 or
oblique9 modes of divisions correlates with cell fate changes. In
particular, in the mouse embryonic cortex, loss of planar spindle
orientation resulting from knock-down of the spindle pole-associated
protein Aspm9 results in premature neurogenesis, suggesting that there
has been a shift from P-P to P-N division. By contrast, cLGN knockdown or Ct-cLGN expression in the chick, which also decrease planar
spindle orientation, clearly do not promote P-N divisions. What causes
this discrepancy? In addition to its effect on spindle orientation, LGN
could also control the polarized distribution of a neural stem fate
determinant. However, in Drosophila neuroblasts, loss of Pins only
occasionally results in mislocalization of cell fate determinants17; in
addition, expression of the GoLoco domains of Pins (Ct-Pins) disrupts
neither apico-basal polarity nor polarized distribution of cell fate
determinants in Drosophila neuroblasts, but only affects spindle
orientation and asymmetry45,48. Similarly, we detected no defect in
apico-basal polarity in cLGN knock-down or Ct-cLGN expressing
chick embryos (Fig. 2d). Rather, differential effects of spindle misorientation on fate acquisition might be explained by stage or regional
differences: there is indications that simply altering mitotic spindle
VOLUME 10
[
NUMBER 11
[
NOVEMBER 2007 NATURE NEUROSCIENCE
© 2007 Nature Publishing Group http://www.nature.com/natureneuroscience
ARTICLES
orientation is not sufficient to induce neuronal production before the
normal onset of neurogenesis in the caudal neural tube41. Together
with the present study, this indicates that the neuroepithelium might
initially contain non-committed progenitors, whose divisions are by
default proliferative (P-P), regardless of spindle orientation49. However,
maintenance of their progeny within the neuroepithelium is not a
default mechanism and requires precise control of spindle orientation.
We show that LGN is an essential regulator of this process. Switching to
neurogenesis involves progressive commitment of progenitors to a
neurogenic state. At this stage, differential fate acquisition (P-N) might
require coordination between asymmetric segregation of cell fate
determinants and spindle reorientation. In the future, it will be
important to determine the specific relationship between spindle
orientation and fate acquisition at different stages of neurogenesis,
and in different regions of the developing CNS.
LGN is also expressed in mouse and chick cortical progenitors
(ref. 35 and our unpublished data). It will be interesting to compare
its function between spinal and cortical progenitors at different developmental stages, and in particular to investigate whether LGN and
AGS3 have similar or opposite effects on spindle orientation, cell
division and fate acquisition.
METHODS
Cloning of cLGN. Virtual cDNA sequences of cLGN and cAGS3 coding regions
were obtained by DNA blasts of mouse LGN and AGS3 sequences on chick
expressed sequence tag (EST; http://www.chick.umist.ac.uk/) and genomic
databases (http://www.ncbi.nlm.nih.gov/BLAST/). The sequences that encode
cAGS3 all contain a frameshift between the TPR and GoLoco domains,
preventing the production of a full-length protein. In addition, the TPR and
GoLoco domains of cAGS3 are never found together in ESTs. Oligonucleotides
spanning the start and stop codons of cLGN were designed, and a full-length
coding cDNA was amplified by PCR from a chick embryonic cDNA library
prepared by J. Hazan (King’s College, London). For details of in ovo electroporation, expression constructs, in situ hybridization, immunohistochemistry
and statistical analysis, see Supplementary Methods online and Supplementary Figure 1.
Angle measurements. To measure angles in anaphase and telophase, we
acquired optical sections from 12-mm-thick cryostat sections on a Zeiss
Axioskop microscope equipped with the Apotome module and a 63
objective, using Zeiss Axiovision 4.6 software. We used b-catenin staining,
which strongly labels adherens junctions and faintly delineates the baso-lateral
membrane, to distinguish anaphase and telophase cells from cells that had just
finished cytokinesis. Only cells in which both chromosome sets were visible on
at least three consecutive optical sections at 1-mm intervals were retained. We
measured the relative angle between a line bisecting the two chromosome sets
and the apical surface (Fig. 2b) using the angle measurement module in
Axiovision. For time-lapse images, stack projections were imported into
Axiovision. Cells whose equatorial plane remained perpendicular to the
x-y plane (that is, rotating in the x-y plane around the z axis) throughout metaphase were selected for angle measurements. Successive angles
formed by the projection of the equatorial plane on the x-y plane during
the time-sequence were measured relative to its position at the onset
of metaphase.
Time-lapse analysis. Electroporated embryos were harvested 24 h after
electroporation, and the neural tube was dissected in PBS at room temperature.
We cut 200-mm-thick transverse sections at the brachial and thoracic levels with
a McIlwain tissue chopper, and mounted them in F12 medium/1% low melt
agarose on bottom glass culture dishes (Mattek)41. Plates were then equilibrated
at 38 1C for 30 min in the heated chamber of a spinning disk confocal
microscope (CSU-10, Perkin Elmer). We recorded 20–35-mm-thick z stacks
(1 mm between individual sections) at 1-min intervals for 3–10 h. We
reconstituted projections of 15–20-mm-thick stacks with Metamorph imaging
software, and reconstructed movies in Adobe Premiere Software.
NATURE NEUROSCIENCE VOLUME 10
[
NUMBER 11
[
NOVEMBER 2007
Clonal analysis. A conditional GFP reporter vector (pFlox-pA-EGFP, 1 mg ml–1)
was introduced with a control or Ct-cLGN construct (2 mg ml–1) into E3
embryos. A Cre recombinase expression vector (pCX-Cre) was added at a low
concentration (0.025 ng ml–1) to clonally activate GFP expression in individual
neural progenitors. The identity and spatial distribution of the progeny of these
cells in the neural tube was analyzed after they had completed one division.
Vector concentrations of 1–2 mg ml–1 typically result in transfection of multiple
vector units per cell and high expression. The 40,000-fold dilution of the Cre
expression vector ensures that excision of the loxP site flanked by SV40-PolyA
from pFloxpA-EGFP (Supplementary Fig. 1) will result in high and sustained
GFP expression in clonally dispersed cells. Very few neurogenic divisions occur
between E2 and E3, and the Sox2-negative mantle zone is very thin at E3. By E4,
the mantle zone becomes much thicker and easier to distinguish from the
ventricular zone. E4 was therefore chosen as the time for our clonal analysis. We
determined that 24 h after electroporation was the optimal time to obtain
maximum numbers of two-cell clones: embryos were therefore electroporated at
E3. E4 embryos with rare GFP+ cells (12 control and 7 Ct-cLGN-expressing
embryos) were selected under a fluorescence-equipped dissecting microscope
and the brachial/upper thoracic region was dissected and fixed for 2 h in 4%
formaldehyde/PBS. We stained 60-mm-thick vibratome sections with an antibody to Sox2 and the nuclear Hoechst dye and mounted them for analysis.
z stacks were obtained for each two-cell clone using a Zeiss Apotome microscope. Nuclei in the ventricular zone are elongated along the apico-basal axis
and are more densely packed than in the mantle zone. These criteria were used
to identify the border between the two zones and to determine whether GFP+
cells lay within the ventricular zone or the mantle zone.
Conditional gene expression. E2 embryos were electroporated with a mixture
of pCIG-Tet-Off (2 mg ml–1) and pBI-Myc-Ct-cLGN (2 mg ml–1). pCIG-Tet-Off
constitutively expresses the transcriptional regulator TtA and a nuclear GFP
reporter; pBI-Ct-cLGN contains Myc-tagged Ct-cLGN cDNA under the control
of the TtA-responsive promoter. TtA is inactivated upon treatment with the
tetracycline analog doxycycline (Dox), thereby silencing the TtA-responsive
promoter42. Twenty-four hours after electroporation (and every 24 h thereafter
until sacrifice), Dox (150 ml, 9 mg ml–1)50 was deposited through the tape seal
on top of embryos using a 26G needle. Embryos were given a 1-h BrdU pulse
before fixation at E3.5, E4, E5, E6 or E7. In a series of control embryos, an
additional initial dose of Dox was applied at the time of electroporation and
embryos were harvested at E4 and E5. Neither Myc expression nor ectopic
BrDU+ cells were observed in these embryos (data not shown).
Note: Supplementary information is available on the Nature Neuroscience website.
ACKNOWLEDGMENTS
This work was supported by the French Centre National de la Recherche
Scientifique and an Association Française contre les Myopathies grant (11942SR-C) to X.M. F.J. is the recipient of a PhD fellowship from the French Ministry
for Higher Education and Research. We thank J. Hazan (King’s College London,
UK) for RT-PCR cloning of the full-length chick LGN cDNA, D. Henrique
(University of Lisbon, Portugal) for the hes5-1 plasmid, K. Hadjantonakis (SloanKettering Institute, New York) for the pCX-H2B-EGFP plasmid, F. Yu (Temasek
Life Sciences Laboratory, Singapore) and R. Kaushik (IMCB, Singapore) for
mouse LGN cDNA, and the PICsL imaging core facility for
expert technical assistance. We thank C. Goridis and V. Dubreuil (Ecole Normale
Supérieure, Paris), W. Chia (Temasek Life Sciences Laboratory, Singapore),
A. Moqrich (IBDML Marseille) and members of the Durbec group for critical
reading of the manuscript.
AUTHOR CONTRIBUTIONS
X.M. and P.D. supervised the project, X.M. and F.J. performed the experiments
and X.M. wrote the manuscript.
Published online at http://www.nature.com/natureneuroscience
Reprints and permissions information is available online at http://npg.nature.com/
reprintsandpermissions
1. Rakic, P. Specification of cerebral cortical areas. Science 241, 170–176 (1988).
2. McConnell, S.K. Constructing the cerebral cortex: neurogenesis and fate determination.
Neuron 15, 761–768 (1995).
3. Fishell, G. & Kriegstein, A.R. Neurons from radial glia: the consequences of asymmetric
inheritance. Curr. Opin. Neurobiol. 13, 34–41 (2003).
1447
© 2007 Nature Publishing Group http://www.nature.com/natureneuroscience
ARTICLES
4. Huttner, W.B. & Brand, M. Asymmetric division and polarity of neuroepithelial cells.
Curr. Opin. Neurobiol. 7, 29–39 (1997).
5. Gotz, M. & Huttner, W.B. The cell biology of neurogenesis. Nat. Rev. Mol. Cell Biol. 6,
777–788 (2005).
6. Chenn, A. & McConnell, S.K. Cleavage orientation and the asymmetric inheritance of
Notch1 immunoreactivity in mammalian neurogenesis. Cell 82, 631–641 (1995).
7. Kosodo, Y. et al. Asymmetric distribution of the apical plasma membrane during
neurogenic divisions of mammalian neuroepithelial cells. EMBO J. 23, 2314–2324
(2004).
8. Huttner, W.B. & Kosodo, Y. Symmetric versus asymmetric cell division during neurogenesis in the developing vertebrate central nervous system. Curr. Opin. Cell Biol. 17,
648–657 (2005).
9. Fish, J.L., Kosodo, Y., Enard, W., Paabo, S. & Huttner, W.B. Aspm specifically maintains
symmetric proliferative divisions of neuroepithelial cells. Proc. Natl. Acad. Sci. USA
103, 10438–10443 (2006).
10. Sanada, K. & Tsai, L.H. G protein bw subunits and AGS3 control spindle orientation and
asymmetric cell fate of cerebral cortical progenitors. Cell 122, 119–131 (2005).
11. Bellaiche, Y. & Gotta, M. Heterotrimeric G proteins and regulation of size asymmetry
during cell division. Curr. Opin. Cell Biol. 17, 658–663 (2005).
12. Yu, F., Kuo, C.T. & Jan, Y.N. Drosophila neuroblast asymmetric cell division: recent
advances and implications for stem cell biology. Neuron 51, 13–20 (2006).
13. Schaefer, M., Petronczki, M., Dorner, D., Forte, M. & Knoblich, J.A. Heterotrimeric
G proteins direct two modes of asymmetric cell division in the Drosophila nervous
system. Cell 107, 183–194 (2001).
14. Fuse, N., Hisata, K., Katzen, A.L. & Matsuzaki, F. Heterotrimeric G proteins regulate
daughter cell size asymmetry in Drosophila neuroblast divisions. Curr. Biol. 13,
947–954 (2003).
15. Izumi, Y., Ohta, N., Itoh-Furuya, A., Fuse, N. & Matsuzaki, F. Differential functions of
G protein and Baz-aPKC signaling pathways in Drosophila neuroblast asymmetric
division. J. Cell Biol. 164, 729–738 (2004).
16. Schaefer, M., Shevchenko, A. & Knoblich, J.A. A protein complex containing Inscuteable and the Ga-binding protein Pins orients asymmetric cell divisions in Drosophila.
Curr. Biol. 10, 353–362 (2000).
17. Yu, F., Morin, X., Cai, Y., Yang, X. & Chia, W. Analysis of partner of inscuteable, a novel
player of Drosophila asymmetric divisions, reveals two distinct steps in inscuteable
apical localization. Cell 100, 399–409 (2000).
18. Yu, F. et al. Locomotion defects, together with Pins, regulates heterotrimeric G-protein
signaling during Drosophila neuroblast asymmetric divisions. Genes Dev. 19,
1341–1353 (2005).
19. Wang, H. et al. Ric-8 controls Drosophila neural progenitor asymmetric division by
regulating heterotrimeric G proteins. Nat. Cell Biol. 7, 1091–1098 (2005).
20. Hampoelz, B., Hoeller, O., Bowman, S.K., Dunican, D. & Knoblich, J.A. Drosophila
Ric-8 is essential for plasma-membrane localization of heterotrimeric G proteins.
Nat. Cell Biol. 7, 1099–1105 (2005).
21. Bowman, S.K., Neumuller, R.A., Novatchkova, M., Du, Q. & Knoblich, J.A. The
Drosophila NuMA homolog Mud regulates spindle orientation in asymmetric cell
division. Dev. Cell 10, 731–742 (2006).
22. Izumi, Y., Ohta, N., Hisata, K., Raabe, T. & Matsuzaki, F. Drosophila Pins-binding protein
Mud regulates spindle-polarity coupling and centrosome organization. Nat. Cell Biol. 8,
586–593 (2006).
23. Siller, K.H., Cabernard, C. & Doe, C.Q. The NuMA-related Mud protein binds Pins and
regulates spindle orientation in Drosophila neuroblasts. Nat. Cell Biol. 8, 594–600
(2006).
24. Colombo, K. et al. Translation of polarity cues into asymmetric spindle positioning in
Caenorhabditis elegans embryos. Science 300, 1957–1961 (2003).
25. Gotta, M., Dong, Y., Peterson, Y.K., Lanier, S.M. & Ahringer, J. Asymmetrically
distributed C. elegans homologs of AGS3/PINS control spindle position in the early
embryo. Curr. Biol. 13, 1029–1037 (2003).
26. Voronina, E. & Wessel, G.M. Activator of G protein signaling in asymmetric cell divisions
of the sea urchin embryo. Dev. Growth Differ. 48, 549–557 (2006).
27. Mochizuki, N., Cho, G., Wen, B. & Insel, P.A. Identification and cDNA cloning of a novel
human mosaic protein, LGN, based on interaction with G alpha i2. Gene 181, 39–43
(1996).
1448
28. Takesono, A. et al. Receptor-independent activators of heterotrimeric G protein signaling
pathways. J. Biol. Chem. 274, 33202–33205 (1999).
29. Du, Q., Stukenberg, P.T. & Macara, I.G. A mammalian partner of inscuteable binds
NuMA and regulates mitotic spindle organization. Nat. Cell Biol. 3, 1069–1075
(2001).
30. Siderovski, D.P., Diverse-Pierluissi, M. & De Vries, L. The GoLoco motif: a Galphai/o
binding motif and potential guanine-nucleotide exchange factor. Trends Biochem. Sci.
24, 340–341 (1999).
31. Willard, F.S., Kimple, R.J. & Siderovski, D.P. Return of the GDI: the GoLoco motif in cell
division. Annu. Rev. Biochem. 73, 925–951 (2004).
32. Blumer, J.B., Kuriyama, R., Gettys, T.W. & Lanier, S.M. The G protein regulatory (GPR)
motif-containing Leu-Gly-Asn-enriched protein (LGN) and Gia3 influence cortical positioning of the mitotic spindle poles at metaphase in symmetrically dividing mammalian
cells. Eur. J. Cell Biol. 85, 1233–1240 (2006).
33. Du, Q. & Macara, I.G. Mammalian Pins is a conformational switch that links NuMA to
heterotrimeric G proteins. Cell 119, 503–516 (2004).
34. Kaushik, R., Yu, F., Chia, W., Yang, X. & Bahri, S. Subcellular localization of LGN during
mitosis: evidence for its cortical localization in mitotic cell culture systems and its
requirement for normal cell cycle progression. Mol. Biol. Cell 14, 3144–3155
(2003).
35. Yu, F. et al. A mouse homologue of Drosophila pins can asymmetrically localize and
substitute for pins function in Drosophila neuroblasts. J. Cell Sci. 116, 887–896
(2003).
36. Blumer, J.B., Chandler, L.J. & Lanier, S.M. Expression analysis and subcellular
distribution of the two G protein regulators AGS3 and LGN indicate distinct functionality. Localization of LGN to the midbody during cytokinesis. J. Biol. Chem. 277,
15897–15903 (2002).
37. Das, R.M. et al. A robust system for RNA interference in the chicken using a modified
microRNA operon. Dev. Biol. 294, 554–563 (2006).
38. Reinsch, S. & Karsenti, E. Orientation of spindle axis and distribution of plasma
membrane proteins during cell division in polarized MDCKII cells. J. Cell Biol. 126,
1509–1526 (1994).
39. Adams, R.J. Metaphase spindles rotate in the neuroepithelium of rat cerebral cortex.
J. Neurosci. 16, 7610–7618 (1996).
40. Haydar, T.F., Ang, E., Jr. & Rakic, P. Mitotic spindle rotation and mode of cell division in
the developing telencephalon. Proc. Natl. Acad. Sci. USA 100, 2890–2895
(2003).
41. Roszko, I., Afonso, C., Henrique, D. & Mathis, L. Key role played by RhoA in the balance
between planar and apico-basal cell divisions in the chick neuroepithelium. Dev. Biol.
298, 212–224 (2006).
42. Gossen, M. & Bujard, H. Tight control of gene expression in mammalian cells by
tetracycline-responsive promoters. Proc. Natl. Acad. Sci. USA 89, 5547–5551
(1992).
43. Kraut, R., Chia, W., Jan, L.Y., Jan, Y.N. & Knoblich, J.A. Role of inscuteable in orienting
asymmetric cell divisions in Drosophila. Nature 383, 50–55 (1996).
44. Zigman, M. et al. Mammalian inscuteable regulates spindle orientation and cell fate in
the developing retina. Neuron 48, 539–545 (2005).
45. Yu, F., Ong, C.T., Chia, W. & Yang, X. Membrane targeting and asymmetric localization of
Drosophila partner of inscuteable are discrete steps controlled by distinct regions of the
protein. Mol. Cell. Biol. 22, 4230–4240 (2002).
46. Lechler, T. & Fuchs, E. Asymmetric cell divisions promote stratification and differentiation of mammalian skin. Nature 437, 275–280 (2005).
47. Pizzinat, N., Takesono, A. & Lanier, S.M. Identification of a truncated form of the G
protein regulator AGS3 in heart that lacks the tetratricopeptide repeat domains. J. Biol.
Chem. 276, 16601–16610 (2001).
48. Cai, Y., Yu, F., Lin, S., Chia, W. & Yang, X. Apical complex genes control mitotic spindle
geometry and relative size of daughter cells in Drosophila neuroblast and pI asymmetric
divisions. Cell 112, 51–62 (2003).
49. Wilcock, A.C., Swedlow, J.R. & Storey, K.G. Mitotic spindle orientation distinguishes
stem cell and terminal modes of neuron production in the early spinal cord. Development
134, 1943–1954 (2007).
50. Hilgers, V., Pourquie, O. & Dubrulle, J. In vivo analysis of mRNA stability using the
Tet-Off system in the chicken embryo. Dev. Biol. 284, 292–300 (2005).
VOLUME 10
[
NUMBER 11
[
NOVEMBER 2007 NATURE NEUROSCIENCE
Supplementary information
Control of planar divisions by LGN maintains progenitors in the chick neuroepithelium
Xavier Morin, Florence Jaouen and Pascale Durbec
Supplementary Figure 1: Domain organization of LGN and summary of the different constructs
used in this study.
Like its mammalian homologues, cLGN contains 7 N-terminal TPR repeats and 4 C-terminal GoLoco
domains.
In pFlox-pA-Green, a SV40 polyA sequence is flanked by 34bp loxP sites, and can be excised upon
Cre mediated site-specific recombination, to allow transcription of the GFP reporter.
Supplementary Figure 2: Distribution of a GFP::cLGN fusion protein in chick neuroepithelial
cells
A CMV driven GFP::cLGN fusion protein was expressed at low levels in the neuroepithelium. The
neural tube was cut in half through its midline and the electroporated side of the neural tube was flatmounted with the apical surface facing the coverslip. Cells were imaged from their apical surface. Two
examples are provided for each stage of the cell cycle. Double arrows on the cartoons on the left
panels indicate the levels at which optical sections were obtained. γ-tubulin staining indicates the
centrosomes, and Hoechst the nuclei. In interphase cells, GFP::cLGN is enriched on the centrosome
which lies just underneath the apical surface, but is also visible in the cytoplasm, although this might
be unspecific staining due to the saturation of sub-cellular distribution machinery. In metaphase and
early anaphase the GFP signal is enriched on spindle poles and at the cell cortex. In telophase, the
signal disappears from the cell cortex but is still visible on the spindle pole and enriched at a site
probably corresponding to the midbody (white arrow).
Supplementary Figure 3: time course of metaphase plate positions in control and Ct-cLGN
expressing cells.
Curves of the metaphase plate displacements over time at one minute intervals, relative to the initial
position at the onset of metaphase, for 9 control and 7 Ct-cLGN expressing cells. The curves illustrate
oscillations and changes in the direction of metaphase plate movements. The position at the beginning
of anaphase (time = 0) relative to the initial position at the onset of metaphase (position = 0) represents
the total displacement α (as shown in Fig. 3d). The difference (δα) between positions measured at
successive time points was used to calculate the average displacement Δα (as presented in Fig. 3e).
Supplementary Video 1: Time-lapse analysis of metaphase movements in a control embryo
H2B-EGFP is used as a chromosomal reporter. The ventricular surface (apical) is on top. Each frame
is a projection of a 21μm thick stack of confocal sections taken at 1μm z-intervals. Frames were taken
at 1 minute intervals over a 200 minutes period. Most metaphase nuclei display strong rotation and
oscillatory movements. Coloured asterisks mark several representative cells during prophase, and are
erased at the onset of metaphase for better visualization of metaphase movements and anaphase.
Supplementary Video 2: Time-lapse analysis of metaphase movements in a Ct-cLGN expressing
embryo
H2B-EGFP is used as a chromosomal reporter. The ventricular surface (apical) is on top. Each frame
is a projection of a 21µm thick stack of confocal sections taken at 1µm z-intervals. Frames were taken
at 1 minute intervals over a 180 minutes period. Metaphase nuclei display very weak oscillatory
movements. Coloured asterisks mark several representative cells during prophase, and are erased at the
onset of metaphase for better visualization of metaphase movements and anaphase.
Supplementary methods
In ovo electroporation
48-52 hours old chick embryos (HH 13-14) were electroporated in ovo essentially as described 1. The
DNA solution was injected in the neural tube at the thoracic level and typically diffused from the
lumbar to the upper cervical level. An Intracell square-wave electroporator was used, and five 50ms
pulses of 25V were given at 100ms intervals. A pair of 5mm Gold plated electrodes (BTX Genetrode
model 512) separated by a 4mm interval was used. For the clonal analysis, electroporation was
performed with the same conditions on 72 hours old embryos.
DNA concentrations used:
Control (6-Myc vector), FL-cLGN, Ct-cLGN were used at 2µg/µl, together with a GFP reporter (GFP
or H2B-EGFP) at 1µg/µl. The miRNA vectors were used at 2.5µg/µl, alone or in combination with
H2B-EGFP at 1µg/µl for the angle measurement experiments.
For cLGN miRNA rescue experiments, the mouse LGN vector was added at 1.25µg/µl.
In situ hybridisation and immunohistochemistry
In situ hybridization and immunohistochemistry on gelatin mounted cryosections or vibratome
sections were performed essentially as previously described 2.
In situ probes:
cLGN: a 560 bp fragment corresponding to amino acids 258-446 of cLGN was PCR amplified with
cLGN-A and cLGN-C oligonucleotides and cloned into TopoII vector. The fragment was then excised
with BamHI and XhoI and recloned in pBluescript SK. The antisense probe was synthesized with T7
RNA polymerase after BamHI linearization.
cNotch1: an 850 bp fragment was PCR amplified with T3 and T7 oligonucleotides from a cNotch1
EST clone (#ChEST891h8 from the BBSRC collection, http://www.chick.umist.ac.uk/) and used
directly as a template for antisense probe synthesis with T3 RNA polymerase.
cHES5.1: a 1600 bp EST clone containing cHES5.1 coding sequence and 3’UTR was obtained from
Dr Domingos Henrique. The antisense probe was synthesized with T3 RNA polymerase after NotI
linearization.
Primary antibodies:
N-Cadherin (A-CAM clone GC-4): mouse monoclonal, Sigma 2542: 1/50 dilution
β-catenin: mouse monoclonal, BD Biosciences 610153: 1/100 dilution
γ-tubulin (GTU-88): mouse monoclonal, Sigma T6557: 1/1000 dilution
Neuronal specific βIII-tubulin (TUJ-1): mouse monoclonal BAbCO MMS-435P: 1/1000 dilution
BrdU: mouse monoclonal, DAKO M0744: 1/100 dilution
Phospho-Histone3: rabbit polyclonal, Upstate 06-570: 1/400 dilution
aPKC-ζ: rabbit polyclonal, Santa Cruz sc-206 : 1/500 dilution
Myc (clone 9E10): mouse monoclonal, Sigma M5546, 1/1000 dilution
For the BrdU antibody, cryosections were equilibrated at room temperature, degelatinized in PBS at
37°C for 5 minutes, then incubated for 15 minutes in 2N HCl/PBS/0.1% TritonX-100, and neutralized
for 20 minutes in a 0.1M tetraborate solution (pH8.5) before a 30 minute blocking step in PBS/0.1%
TritonX-100/10%FCS.
For the γ-tubulin antibody, degelatinized cryosections or half embryos sectioned along their midline
were incubated for 5 minutes in 100% acetone preequilibrated at -20°C, and rinsed twice in PBS at
room temperature before the blocking step.
Secondary antibodies coupled to Cy3 or Cy5 were obtained from Jackson laboratories, and
typically used at 1/200 dilutions.
Cloning of expression vectors
Full-length cLGN cDNA was PCR amplified using the following oligonucleotides: cLGN-5’-start
replaces the ATG codon with an EcoRI site; cLGN-3’-stop introduces a SalI compatible XhoI site
immediately after the stop codon. A full-length mLGN cDNA was obtained from Drs Rachna Kaushik
and Fengwei Yu.
To create pCX-Myc, a 6-Myc tag 3 was PCR amplified from pCS2+MT vector with 6Myc-5’ and
6Myc-3’ oligonucleotides, digested with MunI and cloned into EcoRI linearized pCAGGS, therefore
destroying the EcoRI site from pCAGGS. pCX-Myc contains EcoRI and XhoI sites immediately after
the 6-Myc sequence. These were used to clone PCR amplified FL-cLGN (oligos cLGN-5’-start and
cLGN-3’-stop), Ct-cLGN (amino acids 384-642: oligos cLGN-5’-inter and cLGN-3’-stop), FL-mLGN
(oligos mLGN-5’-start and mLGN-3’-stop) in frame downstream of the 6Myc tag sequence to create
pCX-FL-cLGN, pCX-Ct-cLGN and pCX-FL-mLGN.
To create pBI-Ct-cLGN, the Myc-Ct-cLGN coding sequence was reamplified from pCX-Ct-cLGN,
using oligonucleotides 5’lead and cLGN3’-stop. The PCR fragment was digested with XhoI and NotI,
and cloned into pBI-Tet (Clontech) digested with SalI and NotI. pCIG-Tet-Off was created by cloning
the tTA cDNA (PCR amplified with oligonucleotides Tet-Off-5’ and Tet-Off-3’ from Clontech’s pTetOff vector) into pCIG 4 digested with XhoI and EcoRI.
To create pGFP-cLGN, the EcoRI/XhoI FL-cLGN PCR fragment was cloned in-frame downstream of
EGFP in EcoRI/SalI cut pEGFP-C1 (Clontech).
For cLGN knock-down, several target sites (mi-192, mi-1879, mi-1578, and mi-870) were chosen in
the cLGN coding sequence according to recommendations described in 5. 192, 1879, 1578 and 870
correspond to the position of the first base of the target site in the cLGN coding sequence. Vectors
were constructed to insert mi-192, mi-1578, and mi-1879 in the first hairpin sequence of pRFPRNAiC 5. Mi-870 was then inserted in the second hairpin sequence. All constructs produced similar
results, but the most efficient and reproducible results, as judged by the number of ectopic BrdU+ cells
observed in the mantle zone 48 hours after electroporation, were obtained with a single hairpin mi192. Only results with this construct are presented in this study, and the sequence of the
oligonucleotides used for the mi-192 construct is provided in the table below.
All vectors were sequenced to check for potential PCR amplification errors. Full details regarding the
construction of the vectors used in this study can be obtained upon request to XM.
Oligonucleotides used
GGGCTGTGGAAGCACAGGCCTGCTAC
cLGN-A
CCTGCAGAACTTTGGAAGCGGGTGCC
cLGN-C
GCGAATTCAGAGGCTTCTTGCCTGGAGCTGGCT
cLGN-5’-start
GCGAATTCAGTAGGACGTCGTCACAGTATGGAG
cLGN-5’-inter
GCCTCGAGTCAGCTAGAACTTGGTCCTTTAATAGCAG
cLGN-3’-stop
GCCGCGGCCGCGAATACAAGCTACTTGTTCTTTTTGCA
5’-lead
mLGN-5’-start GACAATTGGGAAGCTTCTTGCCTTGAG
GACTCGAGTTATTTTCCCGAATGCTTAAATTCC
mLGN-3’-stop
CGCTCGAGCCACCATGTCTAGATTAGATAAAAGTAAAGTGATTAACA
Tet-Off-5’
GCGAATTCTACCCACCGTACTCGTCAA
Tet-Off-3’
GACAATTGATTTAGGTGACACTATACAAT
6Myc-5’
GACAATTGGTAATACGACTCACTATAGTT
6Myc-3’
GAGAGGTGCTGCTGAGCGTGAATACCATCACCATGATTTATAGTGAAGCCACAGATGTA
mi-192-for
ATTCACCACCACTAGGCAGGAATACCATCACCATGATTTATACATCTGTGGCTTCACT
mi-192-rev
Image acquisition and processing
Non fluorescent in situ hybridisation images (Fig. 1b-e and Fig. 1k) were acquired on a Zeiss upright
microscope with a 10x objective, using the ACT-1 software. Time lapse images (Fig. 3) were acquired
on a Zeiss Axiovert-200 inverted microscope equipped with the CSU-10 spinning disk confocal head
(Perkin Elmer), a heating chamber, using the Metamorph acquisition software and a 40x oil immersion
objective.
All other images were acquired on a Zeiss Axioskop II upright microscope equipped with the
Apotome optical sectioning module, using the Axiovision 4.6 software. Objectives used were
- a 63x oil immersion objective for angle measurements on fixed sections (Fig. 2b-c), close up on
fluorescent in situ hybridisation (Fig. 1j), clonal analysis (Fig. 4c) and cLGN::GFP subcellular
localisation (Fig. 1f and Supplementary Figure 2)
- a 10x objective for E6 and E7 sections shown in Figure 7d
- a 20x objective for all other images.
Additional information regarding the microscopes can be found on http://www.picsl.univ-mrs.fr.
Where necessary, images were given minimal colour enhancement (brightness and contrast) to
equilibrate channel intensities, either in Axiovision 4.6 software or after importation into Adobe
Photoshop CS2 software. For cLGN::GFP expression (Fig. 1f and Supplementary Figure 2), we
noticed that cells with stronger GFP signal did not display a clear subcellular localisation, probably
due to saturation of the interaction with Gαi subunits. By contrast, cells with a lower expression level
had a more contrasted signal. Therefore, we chose images in which GFP was barely detectable, and
enhanced the signal by increasing the contrast and modifying the gamma. Similar modifications were
applied to all GFP images.
Quantification of proliferating cells
Quantification of M-phase cells: PH3-positive cells were counted directly under the fluorescence
microscope using a 20x objective. For each embryo (n = 4 to 6 embryos per condition), the percentage
of PH3 positive cells on the electroporated versus contralateral side of the neural tube was calculated,
based on cell counts from a minimum of 8 successive 12μm cryostat sections taken at the upper
thoracic or brachial level (n > 100 PH3+ cells/side/embryo).
Quantification of S-phase cells: S-phase cells that had incorporated BrdU during a 1hr pulse before
fixation were counted on photographs of anti-BrdU labelled 12μm cryostat sections. Single optical
sections were acquired in the middle of the cryostat sections, using a 20x objective on a Zeiss
Apotome microscope. Cells were then counted using the Zeiss Axiovision 4.6 event counting module.
BrdU+ cells (n = 4 to 6 embryos per construct) were counted on the electroporated and contralateral
sides (n > 140 BrdU+ cells/side/ section) of representative sections at the upper thoracic and brachial
levels, separated by 200 to 300 μm intervals (4-6 sections/embryo). The percentage of BrdU+ cells on
the electroporated side versus contralateral side was calculated for each embryo as the average of the
percentage calculated in each section of the embryo. The data were then compared using Students ttest.
Since electroporation is mosaic (typically less than 40% of the cells are electroporated), the figures
presented in Figure 6i–j are an underestimation of the actual effect of cLGN-miRNA and Ct-cLGN. A
direct measure of the ratio of proliferating versus non-proliferating cells within the xFP+ (mRFP or
GFP, depending on the construct used) populations would probably give a more accurate figure.
However, high variability in the levels of xFP intensity from cell to cell makes it virtually impossible
to properly identify all xFP-positive cells in a section, and is also likely to introduce some bias. We
therefore decided to quantify the effect of cLGN-miRNA and Ct-cLGN on proliferation by comparing
the electroporated versus contralateral sides of each embryo.
Statistical analysis:
Paired analysis of small samples was performed using SigmaStat software. Students t test was used for
all data samples that passed the normality test. For angle measurements shown in Figure 2, a MannWhitney was used, and statistical significance was assessed on the median value.
References
1.
Funahashi, J., et al. Role of Pax-5 in the regulation of a mid-hindbrain organizer's
activity. Development, growth & differentiation 41, 59-72 (1999).
2.
Tiveron, M.C., Hirsch, M.R. & Brunet, J.F. The expression pattern of the transcription
factor Phox2 delineates synaptic pathways of the autonomic nervous system. J Neurosci 16,
7649-7660 (1996).
3.
Roth, M.B., Zahler, A.M. & Stolk, J.A. A conserved family of nuclear
phosphoproteins localized to sites of polymerase II transcription. J Cell Biol 115, 587-596
(1991).
4.
Megason, S.G. & McMahon, A.P. A mitogen gradient of dorsal midline Wnts
organizes growth in the CNS. Development 129, 2087-2098 (2002).
5.
Das, R.M., et al. A robust system for RNA interference in the chicken using a
modified microRNA operon. Dev Biol 294, 554-563 (2006).