J. Phycol. 43, 171–185 (2007)
r 2007 by the Phycological Society of America
DOI: 10.1111/j.1529-8817.2006.00298.x
PHYLOGENY AND SYSTEMATICS OF THE GENUS MONOMORPHINA (EUGLENACEAE)
BASED ON MORPHOLOGICAL AND MOLECULAR DATA1
Sylwia Kosmala, Rafa! Milanowski, Kamil Brzo´ska, Ma!gorzata Pe˛kala, Jan Kwiatowski and Bo(ena Zakrys´2
Department of Plant Systematics and Geography, Warsaw University, Al. Ujazdowskie 4, PL-00-478 Warszawa, Poland
Morphological studies of 16 strains belonging to
the genus Monomorphina revealed a single, parietal,
orbicular chloroplast in their cells. The chloroplast
has a tendency to be perforated and disintegrates in
aging populations and thus may appear to be many
chloroplasts under the light microscope. A single
chloroplast in the cells of Cryptoglena skujae is also
parietally located and highly perforated. It never
forms a globular and closed structure, but is open
from the side of the furrow, resembling the letter C.
We have verified the Monomorphina pyrum group
(M. pyrum–like) on the basis of phylogenetic analysis of SSU rDNA and morphological data. The
strain CCAC 0093 (misidentified as M. reeuwykiana)
diverges first on the SSU rDNA phylogenetic tree.
The rest of the M. pyrum–like strains form a tight
cluster, subdivided into several smaller ones. Because morphological differences between the M. pyrum–like strains (including the strain CCAC 0093)
do not conform to the tree topology, we suggest that
they all (except the strain CCAC 0093) belong to M.
pyrum. We designate a new species, M. pseudopyrum,
for the strain CCAC 0093, solely on the basis of molecular characters. We also suggest that M. reeuwykiana and similar species should stay in Phacus and
Lepocinclis unless detailed molecular and morphological studies show otherwise. Emended diagnoses
of the genera Monomorphina and Cryptoglena and
the species M. aenigmatica are also proposed, as
well as the delimitation of an epitype for M. pyrum,
the type species for the genus Monomorphina.
letic (Linton et al. 2000, Moreira et al. 2001, Müllner
et al. 2001, Brosnan et al. 2003, Nudelman et al. 2003)
and probably a sister group with respect to the genus
Cryptoglena Ehrenb. (Marin et al. 2003, Milanowski
et al. 2006). However, Marin et al. (2003) resurrected
the generic name Monomorphina. In this same study,
about a dozen species of Phacus Dujard. and Lepocinclis
Perty were reclassified and integrated into either
Monomorphina Mereschk. or Cryptoglena Ehrenb.
Emended diagnoses were made for both genera, taking into account the secondary structure of 18S rDNA.
Some diagnostic features of the species being reclassified (including Monomorphina pyrum, the type species
for the genus)—such as the number and the shape of
chloroplasts, the presence of pyrenoids, large paramylon grain morphology, the degree of the cell flatness,
or the kind of pellicle ornamentation (ribs or stripes)—
were taken into account (Marin et al. 2003). However,
an analysis of living strains, allowing assessment of the
variability of diagnostic morphological features, was
not performed. Since the description of the type species by Ehrenberg in 1832 (as Euglena pyrum), there has
been no unequivocal diagnostic description of this
common and cosmopolitan taxon, particularly with respect to chloroplast number and morphology, despite
the long history of its investigation (Schmitz 1884,
Dangeard 1910, Dre(epolski 1925, Goor 1925, Chadefaud 1937, Krichenbauer 1937, Bourrelly 1961, Popova and Safonova 1976).
Therefore, there is a need for the following: (1)
comparative studies taking into account molecular and
morphological characters of species included within
the genera Monomorphina and Cryptoglena, (2) reconstruction of their phylogenetic relationships, (3) verification of morphological diagnostic features for
particular species and designation of an epitype for
M. pyrum, and (4) emended diagnoses of the genera
Monomorphina and Cryptoglena and the species M. aenigmatica (Dre(ep.) Nudelman et Triemer.
Key index words: chloroplast; Cryptoglena; Euglena; Euglenaceae; Euglenida; Euglenophyta; molecular phylogeny; Monomorphina; morphology; SSU
rDNA
Abbreviations: BA, Bayesian analysis; bs, nonparametric bootstrap; di, decay index; ML, maximum
likelihood; MP, maximum parsimony; NJ, neighbor
joining; nt, nucleotide; pp, posterior probability
MATERIALS AND METHODS
Euglenoid strains and culture conditions. Twenty-two strains
used in the molecular study are listed in Table 1. Seventeen
of these strains were subjected to detailed morphological
studies: 15 of them represented the M. pyrum group (M. pyrum–like), one represented the M. aenigmatica (Dre(ep.)
Nudelman et Triemer [ 5 M. striata (Francé) Marin et Melkonian], and one represented Cryptoglena skujae Marin et
Melkonian ( 5 C. agilis Ehrenb.). All strains were cultivated
in a liquid soil–water medium enriched with a small piece of a
It was recently shown that on the basis of phylogenetic analyses of chloroplast (16S) and cytoplasmic
(18S) ribosomal RNA genes that the genus Monomorphina Mereschk. (treated as part of Phacus) is monophy1
Received 13 September 2005. Accepted 24 October 2006.
Author for correspondence: e-mail [email protected].
2
171
172
S. KOSMALA ET AL.
TABLE 1. Euglenoid strains and the corresponding 18S rDNA GenBank accession numbers for the taxa used in this study.
Taxon
Strain
Accession number
Cryptoglena pigra Ehrenb.
Cryptoglena skujae Marin et Melkonian
Monomorphina aenigmatica (Dre(epolski)
Nudelman et Triemer
Monomorphina pyrum (Ehrenb.) Meresch.
CCAP 1212/1
SAG 10.88 (as Phacus agilis)
CCAP 1261/9 ( 5 ASW 08012) (as Phacus aenigmaticus)
AJ532437
AJ532438
AJ532432
UTEX-2354 (as Phacus pyrum)
ACOI 2801 (as Phacus megalopsis)
ACOI 2819 (as Phacus megalopsis)
ACOI 2338 (as Phacus pyrum)
ASW 08010 (as Phacus pseudonordstedtii)
ACOI 2669 (as Phacus inconspicus)
ACOI 2778 (as Phacus megalopsis)
ACOI 2581 (as Phacus megalopsis)
ACOI 2583 (as Phacus megalopsis)
CCAC 0095 ( 5 M1683) (as Phacus pseudonordstedtii)
AICB 277 (as Phacus pseudonordstedtii)
ASW 08011 (as Phacus pseudonordstedtii)
AICB 511 (as Phacus pseudonordstedtii)
ACOI 2566 (as Phacus pyrum)
ACOI 2544 (as Phacus pyrum)
SAG 1224-5 ( 5 UTEX-1305; 5 CCAP 1261/4b) (as Lepocinclis ovata)
AF112874
DQ117003
DQ117002
DQ117000
AF283316
DQ116997
DQ116996
DQ117004
DQ116998
AJ532434
DQ117007
AJ532435
DQ116995
DQ116999
DQ117005
AF061338
DQ117006
DQ117001
AJ532433
Monomorphina pseudopyrum sp. nov.
ACOI 2266 (as Phacus strongylus)
CCAC 0093 ( 5 M-1768) (as Monomorphina reeuwykiana)
Accession numbers of new sequences are in boldface, and those of short sequences are underlined.
garden pea (medium 3c, SAG Göttingen, Germany; Schlösser
1994), under identical conditions, in a growth chamber
maintained at 171C and a 16:8 light:dark (L:D) cycle, approximately 27 mmol photons m–2 s–1 provided by coolwhite fluorescent tubes.
Morphological observations. Cells were collected from various stages of development from cultures growing for 2–12
weeks. The observations were made under a Nikon Eclipse600 light microscope with Nomarski contrast (Nikon, Tokyo,
Japan), equipped with the software for image recording and
processing. Photographic documentation was performed by
the digital camera Nikon DX-1200 connected to the microscope.
Biometric studies. The biometric measurements were made
using the LUCIA Measurement program (Laboratory Imaging S. R. O., Prague, Czech Republic). One hundred randomly chosen, actively swimming cells from each of the 15
strains representing the M. pyrum–like group were analyzed.
For each strain, the length and the width of the cell as well as
the length of the hyaline tail-piece were measured. The data
were analyzed using Statistica (StatSoft Inc., Tulsa, OK,
USA).
Confocal microscopy. All observations were made on material preserved with a 10% solution of glutaraldehyde by adding one drop of a fixative and one drop of water to the fresh
material placed on the slide. The cells were then viewed on a
Zeiss LSM 510 confocal laser scanning microscope (Zeiss,
Jena, Germany), at an excitation wavelength of 543 nm.
DNA isolation, amplification, and sequencing. The total DNA
was isolated from 20 to 30 mg of the centrifuged cells by
using the DNeasy Tissue Kit (Qiagen GmbH, Hilden, Germany) in accordance with the manufacturer’s protocol (with
a proteinase K addition). Primers for PCR amplification and
sequencing are shown in Table 2. Long sequences were obtained for seven strains with primers 5 0 and 3 0 , whereas the
shorter sequences for six additional strains were obtained
with primers 5 0 and 557R (Tables 1 and 2). Fifty milliliters of
a reaction mixture, containing 1 U of Taq polymerase (Qiagen), 0.2 mM dNTPs, 2 mM MgCl2, 10 pmol of each primer,
reaction buffer (Qiagen), and 10–50 ng DNA, was used. The
PCR protocol consisted of an initial 5 min at 951C, followed
by five initial cycles comprising 1 min at 951C, 1 min 30 s at
40–541C, and 45 s–1 min 45 s at 721C; and then 30 cycles
comprising 30 s at 951C, 30 s at 48–561C; and 30 s–1 min 30 s
at 721C. The final extension step was performed for 7 min at
72oC. The PCR products were sized on agarose gels and
purified using the QIAEXII Gel Extraction Kit (Qiagen).
Purified PCR products were sequenced using the BigDye
Terminator Cycle Sequencing Ready Reaction Kit (Applied
Biosystems, Foster City, CA, USA). All readings from the ABI
Prism 310 DNA sequenator (Applied Biosystems), after the
removal of primer sequences, were assembled into ‘‘contigs’’
by the SeqMan program from the LASERGENE package
(DnaStar, Madison, WI, USA) and checked manually for consistency.
Sequence accession numbers, alignment, and phylogenetic analysis. The GenBank accession numbers for 13 new sequences
TABLE 2. Primers for PCR amplification and sequencing of
euglenoid 18S rDNA (Elwood et al. 1985, slightly modified).
Primer
18S5 0
18S382F
18S557R
18S570F
18S892R
18S906F
18S1125R
18S1141F
18S1263R
18S1891F
18S3 0
Position of
3 0 end
89
483
668
682
1293
1307
1539
1555
1677
1910
2127
Sequence (5 0 –3 0 )
CAGTGGGTCTGTGAATGGCTCC
AGGGTTCGATTCCGGAG
TTACCGCAGCTGCTGGC
GTGCCAGCAGCTGCGGT
AGAATTTCACCTCTG
CAGAGGTGAAATTCT
CAATTCCTTTAAGTTTC
CAAACTTAAAGGAATTG
GAGCGGCCATGCACCAC
TGCATGCTAGAGCCAACAGC
CGACGGGCGGTGTGTACAAGT
Position of the 3 0 end refers to 18S rDNA of Euglena gracilis
(GenBank accession no. M12677).
PHYLOGENY AND SYSTEMATICS OF MONOMORPHINA
reported in this paper and other SSU rDNA sequences used
for phylogenetic analyses are shown in Table 1. The alignment of sequences, obtained using ClustalX1.8 (Thompson
et al. 1997) with default options, was manually checked
and edited according to the secondary structure of Euglena
gracilis as suggested by Wuyts et al. (2002). Phylogenetic
analyses were performed separately on two 18S rDNA
alignments (one consisting of the 16 long sequences, and
the other consisting of all 22 sequences), yielding essentially
identical results when relevant. Sites of uncertain homology,
which could not be unambiguously aligned, were removed.
After removal, 1954 positions were left in the alignments, of
which 1489 characters were constant, and 357 and 356 were
MP informative in the 22-sequence and 16-sequence alignments, respectively. The w2 tests for the two alignments
showed homogeneous nucleotide distributions (P 5 1.00),
permitting reliable phylogenetic analyses. The alignment consisting of the 22 sequences used for analyses is
available in the EMBL-Align database (accession number
ALIGN_000961).
Distance (NJ), maximum likelihood (ML), and maximum
parsimony (MP) analyses, as well as the homogeneity test (w2)
of nucleotide composition were performed by PAUP*, Version
4.0b6 for Microsoft Windows (Swofford 1998). To find the best
tree, the heuristic search option was used with the default options, but with random taxon addition and the number of replicates depending on the method used (1000 for MP and 10 for
ML). Bootstrap support for specific nodes (Felsenstein 1985)
was estimated with the default options, but with random taxon
addition (100 for MP and NJ, 10 for ML) using 1000, 1000,
and 100 bootstrap replications, for MP, NJ, and ML analyses,
respectively, as implemented in PAUP*. Models of sequence
evolution and their parameters for ML and NJ methods were
chosen, separately for each of the alignments, by Modeltest 3.6
(Posada and Crandall 1998). Auto decay indices (Bremer 1994)
were calculated by AutoDecay 4.0.2 (Eriksson 1998) for MP
analyses. Bayesian analyses were performed, and their model
parameters were estimated by MrBayes 3.0B4 program (Huelsenbeck and Ronquist 2001), except for the TrNef þ G model,
where all parameters but the shape parameter were estimated
by Modeltest. Four Markov chains were run, with 1,000,000
generations per chain, and the first 1000 trees were discarded.
The sequences of Cryptoglena were used to root the trees, which
were drawn by Tree View, Version 1.6.1 for Microsoft Windows
(Page 1996).
RESULTS
Light and confocal microscope observations. Light
microscope observations of 15 M. pyrum–like strains,
one strain of M. aenigmatica, and one strain of
C. skujae showed certain intra- and interpopulation
morphological differentiation depending mostly on
the age of the population. This differentiation concerned such diagnostic features as chloroplast number,
shape, and location; paramylon grain morphology;
and cell size, shape, and degree of flatness.
Chloroplasts: Light and confocal microscope observations of the 16 strains of Monomorphina in all cases
showed the presence of a single, parietal, closed (orbicular) chloroplast (Figs. 1, f, g, p, and r; 2, e, l, p,
and x; and 3f; see also supplementary materials [Fig.
S1, b, c, g, h, and m; Fig. S3, c, i, and s; Fig. S4, c, h, i,
m–p]), which never formed a uniformly continuous,
flat structure. Depending on the age of the culture
and individual features, it was more or less crimped
173
and perforated. This creasing was aligned with the
curvature of the ribs in all strains (Figs. 2, f, g–k, m, s,
and t; and 3, b, g, and h) except for M. aenigmatica
(Fig. 2, c and d). In young cells, the chloroplast had a
reticular form with small, irregular holes (Fig. 1, a, b,
h, j, n, and r; 2, f, g, j, k, m–o; and 3, b, c, e, and g; see
also supplementary materials [Fig. S1, e, k, and l; Fig.
S2, a, d–g; Fig. S3, a, d, j–l; and Fig. S4, j, k, o, and
p]), which steadily became larger (Figs. 1, c and e; 2,
c, d, h, i, and r–t; and 3, a and h–j; see also supplementary materials [Fig. S1, d, f, and n; Fig. S2, h, o, r,
and s; Fig. S3, d; Fig. S4, d–f]) as the population aged,
resulting in the disintegration of the chloroplast into
numerous lobes of different sizes, connected to one
another by means of narrow bridges, conspicuously
visible under a confocal microscope (Figs. 2, c, d, u, w,
y, and z; 3, a, d, k, and l). Such a disintegrated chloroplast appeared under the light microscope as separate, more or less numerous entities (two large or
more smaller ones) (Fig. 1, d, e, i, k, and l; see also
supplementary materials [Fig. S1, i, j, and o; Fig. S2,
k, and l; Fig. S3, e, and f; and Fig. S4, l]), which in
reality constituted an integral entity. The cells with
such disintegrated chloroplasts retained the ability to
divide, but the division rate was much less than that
of the young populations. Upon being transferred to
a fresh medium, the chloroplast quickly reconstructed itself, and after only a few days, the cells with
proper (not disintegrated) chloroplasts dominated in
the populations. In C. skujae, a single, perforated,
parietal chloroplast (Figs. 1s; 2, a and b) was not
crimped and had a shape of a cylinder opened from
the side of the furrow (Fig. 2a). Perforations had the
form of large holes or deep indentations on the edges
(Fig. 2b). No pyrenoids were observed under the
confocal microscope in any of the surveyed strains.
However, in a small number of cells from three
strains (ACOI 2669, AICB 511, and M. aenigmatica),
two to four unidentified structures, possibly haplopyrenoids (pyrenoids with a single cap of paramylon
located on the inner surface of the chloroplast), were
observed (Fig. 1, m–p; see also supplementary materials [Fig. S4, a, b, m, and n]).
Paramylon grains: In young, not overly crowded
cultures of M. pyrum–like strains, the cells divided
vigorously, depositing two relatively small, platelike,
lateral paramylon grains. Often so tiny and thin that
only the application of Nomarski differential interference contrast allowed their detection, they were
always parietal, that is, located between the chloroplast and the pellicle (Fig. 1, f and k; see also supplementary materials [Fig. S1, g, and h; Fig. S4, c]). As the
population aged, the rate of cell divisions decreased and
the lateral paramylon grains were steadily becoming
larger (both in thickness and in diameter), eventually
occupying almost the entire space between the chloroplast and the pellicle (Fig. 2p; see also supplementary
materials [Fig. S1, c, d, and j; Fig. S2, b, n, and o; Fig. S3,
i, o, p, and s]). During growth, the number of small, variously shaped paramylon grains deposited throughout the
174
S. KOSMALA ET AL.
whole cytoplasm also increased, resulting in the inflation
and reshaping of the cells and the progressive smoothing
out of the initially protruding and sharp-edged ribs,
which are a characteristic feature of the pellicle (Fig. 1,
a, h, and i; see also supplementary materials [Fig. S1, a;
Fig. S2, m; Fig. S3, b, g, and h; Fig. S4, g; and Fig. S5,
a–i]. In the case of M. aenigmatica, the number of large,
parietal, platelike grains was also dependent on the age
of the cells. There were usually three (rarely two) paramylon grains in young cells (Fig. 1p) and four in old
cells. In cells of the single representative of the genus
Cryptoglena (C. skujae), there were always two platelike
paramylon grains (Fig. 1s; see also supplementary materials [Fig. S4, r, s]), which changed only with respect to
thickness as the population aged. A full photographic
record of the number and morphology of large paramylon grains is available online.
Cell size: According to this feature, the 15 surveyed
M. pyrum-like strains were divided into two distinct
groups: (1) strains with cell length >40 mm (41–
44 14 –17 mm), including ACOI 2266, ACOI 2338,
ACOI 2801, and ACOI 2819; and (2) strains with cell
PHYLOGENY AND SYSTEMATICS OF MONOMORPHINA
length under 40 mm (26–37 9–15 mm), including
AICB 277, AICB 511, CCAP 1261/4b, ACOI 2544,
ACOI 2566, ACOI 2581, ACOI 2583, ACOI 2669,
ACOI 2778, CCAC 0093, and CCAC 0095 (the smallest cells observed were of the strain ACOI 2669
[26 10 mm]). The entire length of the cell (including the tail-piece), but not its width (which displayed
a continuous distribution), was a distinguishing attribute. The length of the tail-piece was proportional
to the overall length of the cell (Table 3).
Cell shape: Three shape categories were devised to
discern between the M. pyrum–like strains. They were
conventionally termed: (1) pear/spindle-shaped—
strains AICB 277, AICB 511, ACOI 2338, ACOI
2544, ACOI 2566, ACOI 2669, ACOI 2801, ACOI
2819, and CCAC 0093 (Table 3; Fig. 1, j and k–o; see
also supplementary materials [Fig. S2, a–s; Fig. S3, a–
s; Fig. S4, a–f; Fig. S5, d–i]); (2) pear-shaped—strains
CCAP 1261/4b, ACOI 2581, ACOI 2583, and ACOI
2778 (Table 3; Fig. 1, a and b–f; see also supplementary materials [Fig. S1, a–o; Fig. S5, a and b]); (3)
lengthy/pear-shaped—strain ACOI 2266 (Table 3;
Fig. 1g–i; see also supplementary materials [Fig. S4,
g–l; Fig. S5, c]). The pear/spindle-shaped and
lengthy/pear-shaped cells changed into pear-shaped
cells when the cells became very old and bore two
large platelike paramylon grains and a number of
small, ovoid grains.
Cell flatness: Monomorphina pyrum–like strains were
divided into three categories regarding this trait: (1)
distinctly oblate—strains ACOI 2338, ACOI 2801,
and ACOI 2819 (Table 3; see also supplementary
materials [Fig. S2, c; Fig. S5, d and e]); (2) slightly
oblate—strains AICB 277, AICB 511, ACOI 2544,
ACOI 2566, ACOI 2669, and CCAC 0093 (Table 3;
see also supplementary materials [Fig. S3, r; Fig. S5,
f–i]); and (3) ovoid (circular at cross-section)—strains
CCAP 1261/4b, ACOI 2581, ACOI 2583, ACOI 2778,
175
and ACOI 2266 (Table 3; see also supplementary
materials [Fig. S5, a–c]). This feature was to some
extent dependent on the population’s age; the older
cells were stuffed with a large number of paramylon
grains that were always ovoid. The cells of C. skujae
were distinctly oblate, while those of M. aenigmatica
were ovoid, with a tendency toward slight flattening
during swimming.
Pellicle ornamentation (stripes or ribs): All the M. pyrum–like strains had, by and large, characteristic protruding ribs. However, their size and the extent of
protrusion (sharpness) were proportional to the cell
size. Therefore, during observations, the strains with
small cells (CCAP 1261/4b, ACOI 2581, ACOI 2583,
ACOI 2669, and ACOI 2778) appeared as having
smaller and more protruding ribs in comparison with
the rest of the strains. Moreover, this characteristic
was dependent on the age of the population—in the
old, expanded cells, filled with paramylon grains, the
ribs lost their sharpness and assumed the shape of
wide stripes (Fig. 1, a and b–o; see also supplementary materials [Figs. S1–S5]). However, the peeling
away of the pellicle from the cytoplasm was never
observed, not even when the cells were dying. In M.
aenigmatica and C. skujae, the pellicle was striped and
the ribs were never observed (Fig. 1, r and s; see also
supplementary materials [Fig. S4, m, o–s]).
Phylogenetic analysis. We have obtained 13 new
Monomorphina 18S rDNA sequences: seven long and
six short. A 2250 nt-long sequence alignment was
prepared, consisting of 16 long and six short sequences covering approximately the first 600 positions. Each short sequence had at least one long
counterpart that was identical in the corresponding
region. Thus, short sequences from the ACOI 2801
and ACOI 2819 strains were identical to the long sequences from the ACOI 2338, ASW 08010, and
UTEX-2354 strains; a short sequence from ACOI
FIG. 1. Light microscope photographs showing an overview of living cells and chloroplast organization for Monomorphina pyrum, M.
pseudopyrum, M. aenigmatica, and Cryptoglena skujae. (a–d) Pear-shaped, ovoid cells of the strain M. pyrum ACOI 2778 ending with a sharp,
hyaline tail; the pellicle has innumerous conspicuous hyaline keels (arrows). (a–c) A single, spherical chloroplast with irregular, small
holes visible in young cells (arrowheads). (d) In old cells, the single chloroplast disintegrates into more or less numerous lobes of different
size, which appear as separate entities. (e, f ) Cells of M. pyrum ACOI 2583. (e) Disintegration of a chloroplast—deep indentations divide
the uniform surface of a chloroplast into long lobes. (f) The cross-section of a young cell with a visible, centrally located nucleus and a
single parietal chloroplast; a small but conspicuous paramylon plate is visible between the chloroplast and the pellicle. (g–i) Lengthy/
pear-shaped, ovoid cells of M. pyrum ACOI 2266 with prominent (sharp) pellicle ribs (arrows). (g) A large nucleus visible in a cross-section
of the cell with an orbicular chloroplast located between the nucleus and the pellicle. (h) Small perforations visible within the chloroplast
(arrowheads). (i) Advanced chloroplast disintegration—numerous lobes appear as separate fragments. (j) Pear/spindle-shaped, distinctly
oblate cell of M. pyrum ACOI 2338, with small, noticeable perforations (arrowheads). (k) Two chloroplast lobes, connected to one another
by means of narrow bridges (arrowhead) in the cell of M. pyrum ACOI 2801, which appear as two separate structures. A conspicuous
paramylon plate is located between the chloroplast and the pellicle. (l) Apparent disintegration of the chloroplast into two lobes inside the
pear/spindle-shaped cell of M. pseudopyrum CCAC 0093 (as M. reeuwykiana). (m) The cell of M. pyrum ACOI 2669 with two spherical
structures (haplopyrenoids ?) (arrowheads); a conspicuous, lateral paramylon plate (arrow) is located between the pellicle and the chloroplast. (n–o) Cells of M. pyrum AICB 511. (n) A perforated chloroplast and three spherical structures (haplopyrenoids ?) are visible
inside the cell (arrowheads). (o) Four spherical structures (haplopyrenoids ?) are noticeable in the cell. (p, r) Pear-shaped cells of M.
aenigmatica CCAP 1261/9 with a hyaline spine at the posterior end. (p) Optical cross-section of the cell with a centrally located nucleus and
a parietal, spherical chloroplast with haplopyrenoids present on its inner side (arrowheads); three conspicuous lateral paramylon plates
are located between the pellicle and the chloroplast (arrows). (r) A pellicle with numerous spiral stripes (arrow) and the parietal chloroplast with numerous small perforations (arrowhead). (s) The cell of Cryptoglena skujae SAG 10.88, resembling a coffee bean, without a
conspicuous, hyaline posterior tail; a single, parietal chloroplast forms an open cylinder (in the shape of the letter C); two lateral shieldshaped paramylon grains are located between the chloroplast and the pellicle (arrows). N, nucleus; C, chloroplast. Scale bars, 10 mm.
176
S. KOSMALA ET AL.
2581 was identical to long sequences from the ACOI
2778 and ACOI 2583 strains; a short AICB 277 strain
sequence was identical to long sequences from the
ASW 08011, CCAC 0095, and AICB 511 strains; a
short sequence from ACOI 2544 was identical to a
long sequence from ACOI 2566; and a short sequence
from CCAP 1261/4b was identical to a long sequence
from the SAG 1224-5 strain (Table 1; Fig. 4).
Figure 4 shows the majority-rule tree obtained by
Bayesian analysis for the 22-sequence alignment with
Cryptoglena as an outgroup. The trees obtained by
other methods (NJ, MP, ML, and BA) have essentially
the same topology with similar branch support (bs,
bootstrap; di, decay index; or pp, posterior probabilities). Monomorphina aenigmatica, representing a morphologically well-distinguished species, branches off at
PHYLOGENY AND SYSTEMATICS OF MONOMORPHINA
the base of the Monomorphina clade. The sister clade,
formed by the M. pyrum–like species, the main subject
of this study, is divided into two well-defined sister
groups, one of which consists of a single CCAC 0093
strain with slightly flattened pear/spindle-shaped cells,
while the other contains an assemblage of strains forming two, well-defined main branches. In the upper
branch, there are three types of strains: slightly flattened pear/spindle-shaped cells (ACOI 2669), considerably flattened pear/spindle-shaped cells (ACOI 2801,
ACOI 2819, ACOI 2338), and oblate pear-shaped cells
(ACOI 2778, ACOI 2583, ACOI 2581), all forming
well-defined clades. The lower branch is not a very
well-resolved assemblage. It is mainly composed of
strains with slightly flattened pear/spindle-shaped cells
(CCAC 0095, AICB 277, AICB 511, ACOI 2566, ACOI
2544), plus one strain with oblate pear-shaped cells
(CCAP 1261/4b) and one with lengthy/pear-shaped
cells (ACOI 2266).
The positioning of strain CCAC 0093 at the base of
the M. pyrum–like clade, the presence of strains with
identical morphology (AICB 277, AICB 511, ACOI
2544, ACOI 2566) in the lower branch, and the presence in the upper branch of a strain (ACOI 2669) with
identical morphology but substantially smaller cells
seem to suggest that slightly flattened pear/spindleshaped cells represent the original form, from which
all other forms evolved, some (nearly identical to each
other) more than once. Thus, four strains with identical morphology but distinct from the rest by having
ovoid, not oblate, cells are located on two separate
branches of the tree. Three of them (ACOI 2778,
ACOI 2583, ACOI 2581) form a well-defined clade
on the upper branch, while the fourth (CCAP 1261/4b
known as L. ovata) is located on the lower branch. The
phylogenetic tree reflects substantial genetic diversification of the M. pyrum–like strains, despite their similar
morphology. We consequently propose that all strains
contained in that clade, except the strain CCAC 0093,
represent the same taxon—M. pyrum (Ehrenb.) Mereschk. For the strain CCAC 0093, which is diverged
substantially from the rest of the M. pyrum–like strains,
we designate a new species name M. pseudopyrum. This
species is indistinguishable from M. pyrum morphologically, but can be distinguished on the molecular
177
level (Table 4; Fig. 4). The overall similarity of the
strains is presented in Table 4. The similarity between
the M. pyrum strains is 96.31 1.67; between M. pyrum
and M. pseudopyrum, 89.60 0.37; and between M.
aenigmatica and the two other Monomorphina species,
87.19 0.54.
TAXONOMIC REVISION
Monomorphina Mereschkowsky, Trudy S.-Peterburgsk.
Obshch. Estestvoisp. 8(2): 295–96. 1877. Emend. Kosmala
et Zakrys´. Emended diagnosis: Cells ovoid or slightly oblate (circular or widely elliptical in cross-section) and
rigid; numerous spiral stripes or a few conspicuous
hyaline keels of the pellicle extending to form a pronounced tail; one parietal, spherical chloroplast (usually more or less perforated); haplopyrenoids (one or
more?) present on the inner side of the chloroplast;
and two or three (rarely 4) conspicuous lateral paramylon plates located between the pellicle and the chloroplast.
Type species: Monomorphina pyrum (Ehrenberg)
Mereschkowsky, Trudy S.-Peterburgsk. Obshch. Estestvoisp. 8 (2): 295, 296, pl. 2, fig. 21. 1877. Emend. Kosmala et Zakryś.
Emended diagnosis: Cells pear-shaped, pear/spindleshaped, lengthy/pear-shaped (25–46 9–19 mm);
ovoid or slightly oblate (circular or widely elliptical in
cross-section); with a sharp, hyaline, posterior tail; pellicle with innumerous conspicuous hyaline keels; two
conspicuous lateral paramylon plates located between
the pellicle and the chloroplast. With the four SSU
rDNA signature sequences:
P1: GGCCTTTGGAATGCCCCTCCCTGCTGA
CAAGGG
P2: CAATCTTGCCAGGCTCTTTCTCATCAAA
GCCAGCGGGATCTG
P3: GTCAAGGCCTTCAGGGACACA
P4: TGACAAAGCACCGCCCAGATGGGCC
Basionym: Euglena pyrum Ehrenberg. Abh. Königl.
Akad. Wiss. Berlin Phys. Kl. 1831: 72, pl. I, fig. V. 1832.
Lectotype: Here designated fig. V in Ehrenberg, d. c.
Epitype: Permanently preserved material of strain
ACOI 2778 (cells in resin, for EM), deposited at the
herbarium of the Department of Plant Systematic and
FIG. 2. Confocal electron microscope photographs showing the chloroplast organization of Cryptoglena skujae and of representatives
of the genus Monomorphina. (a, b) A single, parietal chloroplast forms an open cylinder (in the shape of the letter C) in cells of C. skujae. (a)
A chloroplast discontinuity (furrow) (arrow) is visible on the ventral side of the cell. (b) Relatively large holes are visible in the chloroplast
(arrowhead). (c–e) M. aenigmatica CCAP 1261/9. (c, d) A single, closed (orbicular) chloroplast with numerous, relatively large holes
throughout the whole surface (arrowheads). (e) Optical cross-section through the cell showing parietal localization of the chloroplast. (f,
g) A chloroplast has irregular, small holes (arrowheads), and its surface is folded following the curvature of pellicle ribs in young cells of
M. pyrum CCAP 1261/4b. (h, i) Holes of various sizes and shapes (arrowheads) in the chloroplast of M. pyrum ACOI 2583. (j–l) Cells of M.
pyrum ACOI 2778. (j, k) Folded surface of the chloroplast with small perforations. (l) Optical cross-section of the cell showing the single,
parietally located, spherical, closed chloroplast. (m–p) M. pyrum ACOI 2338. (m) Fragment of the folded surface of a chloroplast with a
few small perforations. (n, o) Numerous, but small perforations of a chloroplast. (p) Optical cross-section of a cell showing the single,
parietally located, spherical chloroplast; two shieldlike paramylon grains are visible between the chloroplast and the pellicle (arrows). (r–
t) Surface of the M. pyrum ACOI 2801 chloroplast with visible perforations. (u–x) M. pyrum ACOI 2266. (u) Disintegration of a chloroplast
into lobes (ch) connected to one another by means of narrow bridges (arrowhead). (w) Disintegrated chloroplast appears as numerous,
separate entities (x) Optical cross-section of a cell showing the single, parietally located, spherical chloroplast (arrow). (y–z) Chloroplast
disintegrating inside cells of M. pyrum ACOI 2819. C, chloroplast; ch, lobes. Scale bars, 10 mm.
178
S. KOSMALA ET AL.
FIG. 3. Confocal electron microscope photographs showing the chloroplast organization of some representatives of the genus Monomorphina. (a–c) Folded and perforated chloroplast in cells of M. pyrum ACOI 2669. (d–f) M. pyrum AICB 277. (d) A surface fragment of a
single disintegrating chloroplast—numerous lobes (ch) connected to one another by means of narrow bridges (arrowheads). (e) Chloroplast with numerous, small perforations. (f) Optical cross-section of a cell showing the single, parietally located chloroplast (arrow). (g–
j) M. pyrum AICB 511. (g) Fragment of a folded chloroplast surface with a few small perforations. (h) Progressing chloroplast disintegration; abundant, yet tiny openings are visible. (i–j) Beside the small openings, large openings appear (arrowheads). (k–l) Progressing
chloroplast disintegration in cells of M. pyrum ACOI 2566. Scale bars, 10 mm.
Geography at Warsaw University, Al. Ujazdowskie 4
PL-00478 Warszawa, Poland. The culture from which
the epitype was described has been deposited in the
Algae Culture Collection of the Department of Botany,
University of Coimbra, Portugal, as number ACOI
2778; and in the Culture Collection of Algae at the
TABLE 3. Cell parameters for Monomorphina pyrum strains.
Cell parameters
Taxon
Strain
Flatness
Shape
Length (mm)
Width (mm)
Tail (mm)
Monomorphina pyrum
CCAP 1261/4b
ACOI 2581
ACOI 2583
ACOI 2778
ACOI 2266
AICB 277
AICB 511
ACOI 2544
ACOI 2566
ACOI 2669
CCAC 0095
ACOI 2338
ACOI 2801
ACOI 2819
CCAC 0093
(as M. reeuwykiana)
Ovoid
Ovoid
Ovoid
Ovoid
Ovoid
Slightly
Slightly
Slightly
Slightly
Slightly
Slightly
Oblate
Oblate
Oblate
Slightly
Pear-shaped
Pear-shaped
Pear-shaped
Pear-shaped
Lengthy/pear-shaped
Pear/spindle-shaped
Pear/spindle-shaped
Pear/spindle-shaped
Pear/spindle-shaped
Pear/spindle-shaped
Pear/spindle-shaped
Pear/spindle-shaped
Pear/spindle-shaped
Pear/spindle-shaped
Pear/spindle-shaped
27.01 1.62
30.51 1.95
29.79 2.40
30.32 2.94
42.22 2.15
30.31 2.22
34.66 2.74
33.65 1.47
34.47 1.68
26.06 1.63
36.42 2.15
44.01 1.68
41.00 1.99
41.00 2.15
37.11 1.70
14.37 1.65
13.37 1.27
13.21 1.16
14.16 1.72
16.90 1.77
14.90 1.38
15.32 1.99
13.96 1.73
13.99 1.81
9.90 1.11
15.99 2.25
16.44 1.36
14.31 1.73
14.77 1.71
15.37 2.13
7.63 1.06
9.81 1.06
8.25 1.34
9.85 1.59
15.75 1.70
7.41 1.16
10.93 1.71
10.28 0.89
9.89 1.16
6.55 0.93
9.96 1.21
11.14 1.18
11.96 1.87
11.80 1.32
10.09 0.96
M. pseudopyrum
oblate
oblate
oblate
oblate
oblate
oblate
oblate
Average values (mean SD) are given for the three numerical parameters.
179
PHYLOGENY AND SYSTEMATICS OF MONOMORPHINA
FIG. 4. Phylogenetic tree of the 18S rDNA sequence obtained
by Bayesian inference (model TrNef þ G; with parameters: shape
G 5 0.20; substitution rates A–C 5 A–T 5 C–G 5 G–T 5 1.00, A–
G 5 2.61, C–T 5 4.40). Numbers at the essential nodes show
posterior probabilities of the tree bipartitions as well as the bootstrap values/decay indices obtained for the main clades by MP
analysis and bootstrap values obtained by NJ and ML analysis
(model GTR þ I þ G; with parameters: frequencies A 5 0.24,
C 5 0.25, G 5 0.28, T 5 0.22; unchangeable fraction I 5 0.53,
shape G 5 1.07; substitution rates A–C 5 2.44, A–G 5 4.54, A–
T 5 3.20, C–G 5 1.08, C–T 5 8.81, G–T 5 1.00). Branches leading to nodes with a support of <50% are collapsed; ‘‘-’’ indicates
that clade does not exist in NJ or MP analysis. For strains of M.
pyrum, respective symbols from culture collections are given.
University of Cologne (CCAC), Germany. Figures 1,
a–d and 2, j–l are illustrations of the epitype.
Synonyms: Phacus pyrum var. ovatus Playfair, Proc.
Linn. Soc. New South Wales 46: 125, pl. 5, fig. 15.
1921. Lepocinclis ovata (Playfair) Conrad, Arch. Protistenk. 82:245. 1934. Monomorphina ovata (Playfair)
Marin et Melkonian in Marin et al., Protist 154:102.
2003. P. pyrum var. rudicula Playfair, op. cit. 125, 126, pl.
5, fig. 17. 1921. P. rudicula (Playfair) Pochmann, Arch.
Protistenk. 95:227, 228. 1942. M. rudicula (Playfair)
Marin et Melkonian in Marin et al., op. cit. 103. 2003.
P. inconspicuus Deflandre, Rev. Algol. 3:215, figs. 27–31.
1928. P. pyrum f. pulcherrimus Conrad, Bull. Mus. Roy.
Hist. Nat. Belgique 14(36): 6, figs. 7, 8. 1938. P. pulcherrimus (Conrad) Pochmann, op. cit. 244, fig. 170.
1942. M. pulcherrima (Conrad) Marin et Melkonian in
Marin et al., op. cit. 103. 2003. P. atraktoides Pochmann,
op. cit. 219, fig. 133. 1942. M. atraktoides (Pochmann)
Marin et Melkonian in Marin et al., op. cit. 103. 2003.
P. cochleatus Pochmann op. cit. 232, fig. 151. 1942. M.
cochleata (Pochmann) Marin et Melkonian in Marin
et al., op. cit. 103. 2003. P. megalopsis Pochmann op. cit.
229, fig. 148. 1942. M. megalopsis (Pochmann) Safonova
in Popova and Safonova, Fl. Spor. Rast. SSSR. 9(2): 38,
pl. 7, figs. 8, 11. 1976. P. mirabilis Pochmann op. cit.
229, fig. 147. 1942. M. mirabilis (Pochmann) Safonova
in Povova and Safonova op. cit. 38, pl. 7, figs. 4, 7.
1976. P. pseudonordstedtii Pochmann op. cit. 219, figs.
134, 135. 1942. M. pyrum var. pseudonordstedtii (Pochmann) Popova, Trudy Bot. Inst. Akad. Nauk SSSR,
Ser. 2, 7:287. 1951. M. pseudonordstedtii (Pochmann)
Marin et Melkonian in Marin et al., op. cit. 102. 2003.
P. splendens Pochmann, op. cit. 224–225, fig. 141. 1942.
M. splendens (Pochmann) Popova, Izv Zapadno—Sibirsk. Fil. Akad. Nauk SSSR Ser. Biol. 2:56, 1947. P.
strongylus Pochmann op. cit. 231, fig. 149. 1942. M.
strongyla (Pochmann) Marin et Melkonian in Marin
et al., op. cit. 103. 2003.
Commentary for taxonomic revision: We did not consider P. minusculus (Conrad) Pochmann 1942 [ 5 P. pyrum (Ehrenb.) Stein var. nordstedtii Lemm. f. minuscula
Conrad 1938], distinguished on the basis of the cell size
(12–14 8–10 mm) and P. globosus Pochmann 1942
(cells almost spherical 23–23.8 21.2–23 mm) because
TABLE 4. 18S rDNA sequence similarity of Monomorphina and Cryptoglena strains.
Strain
(1) M. pyrum ACOI 2354
(2) M. pyrum ASW 08010
(3) M pyrum ACOI 2338
(4) M. pyrum ACOI 2669
(5) M. pyrum ACOI 2778
(6) M. pyrum ACOI 2583
(7) M. pyrum SAG 1224-5
(8) M. pyrum ACOI 2566
(9) M. pyrum AICB 511
(10) M. pyrum ACOI 2266
(11) M. pyrum CCAC 0095
(12) M. pseudopyrum CCAC 0093
(13) M. aenigmatica CCAP 1261/9
(14) Cryptoglena pigra CCAP 1212/1
(15) Cryptoglena skujae SAG 10.88
1
2
3
4
5
6
7
8
9
10
11
12
13
14
–
99.8
99.8
97.2
95.6
95.6
94.2
95.9
95.4
96.2
95.3
89.5
87.3
83.8
83.9
–
100.0
97.4
95.9
95.8
94.4
96.1
95.7
96.5
95.6
89.6
87.3
84.0
84.0
–
97.4
95.9
95.8
94.4
96.1
95.7
96.5
95.6
89.6
87.3
84.1
84.1
–
95.7
95.6
94.2
96.4
96.1
96.4
95.8
89.6
87.3
84.3
84.5
–
100.0
93.4
95.1
95.0
95.6
94.9
89.0
87.0
82.9
83.3
–
93.4
95.1
95.0
95.6
94.8
89.0
86.9
82.8
83.2
–
96.3
96.2
96.5
96.2
89.4
86.2
83.5
83.4
–
98.8
99.2
98.7
90.0
87.1
84.1
84.3
–
98.9
99.7
90.0
87.3
84.4
84.5
–
98.8
90.0
86.9
84.0
84.2
–
89.9
87.1
84.2
84.3
–
88.6
84.6
84.6
–
86.9
86.9
–
98.0
180
S. KOSMALA ET AL.
we have not observed such small cells in the populations studied. We also did not consider the taxa with
ringlike paramylon grains such as M. costata (Conrad)
Marin et Melkonian ( 5 P. costatus Conrad 5 P. pyrum
var. costatus (Conrad) Popova); M. turgidula (Pochm.)
Marin et Melkonian ( 5 P. turgidulus Pochm.); M. lepocincloides (Pochm.) Marin et Melkonian ( 5 P. lepocincloides Pochm.); and P. ulula Pochm. We have never
observed the detachment of the pellicle from the cytoplasm described in M. nordstedtii (Lemm.) Popova, nor
the dual pellicle ribs described in M. trypanon (Pochm.)
Marin et Melkonian ( 5 P. trypanon Pochm.), so these
characteristics were not verified.
Monomorphina aenigmatica (Dre(epolski) Nudelman
et Triemer in Nudelman et al., J. Phycol. 42: 200, 2005.
Emend. Kosmala et Zakrys´. Emended diagnosis: cells pearshaped (13.5–40 5.2–15 mm), widely frontally rounded, with a hyaline spine at the posterior end; pellicle
with numerous spiral stripes; one parietal, spherical,
perforated chloroplast with at least one haplopyrenoid
present on the inner side of the chloroplast; and two to
four conspicuous lateral paramylon plates located between the pellicle and the chloroplast.
Basionym: Phacus aenigmaticus Dre(epolski, Rozpr.
Wiadom. Muz. Dzieduszyckich, 7/8:14, figs. 4, 4a.
1922.
Lectotype (see Nudelman et al., J. Phycol. 42:200, 2006):
Dre(epolski, op. cit. figs. 4, 4a. 1922.
Epitype (see Nudelman et al., loc. cit. 2006): Lyophilized sample deposited at the Michigan State University
Herbarium (MSC) with the number ASW08039. The
culture from which the type is described is deposited in
the Culture Collection of Algae at the University of
Algae at the University of Cologne (CCAC), Germany,
with the number ASW08039.
Synonyms (see Nudelman et al., loc. cit. 2006): Phacus
striatus Francé, Result. Wiss. Erforsch. des Balatonsees
2, figs. 21, 22, 24, pp. 29–32. 1897. Monomorphina
striata (Francé) Marin et Melkonian in Marin et al.,
Protist 154:102. 2003.
Monomorphina pseudopyrum sp. nova. Diagnosis:
Cellulae longitudo 26–37 mm, latitudo 10–16 mm, ambitus pyriformi-fusiformis, in sectione transversali ellipticus. Processus longus hyalinus acutusque cellulae
affixus. Periplastus striis distinctis hyalinis sparsim ornatus. Grana paramyli duo, inter periplastum et
chloroplastum disposita. Sequentia SSU rDNA peculiaris:
PSD1: CACCCAGTCTTAAAGCTGGGAGGAAC
CCCA
PSD2: TTTCACTGGGGAAAGAGAAGCTTCAA
GCTATTGGCACCCAGCTG
PSD3: TGGCCCCTCCATGCTGTTGGTTGTCC
CTATGGGCCTCCTGGCTGTGATGCTGCCAA
TCCCCCGAGAGTGCTGGGTTCCCTTAAGA
Description: Cells pear/spindle-shaped (26–37 10–
16 mm); slightly oblate (widely elliptical in crosssection); with a sharp, hyaline, posterior tail; pellicle
with numerous conspicuous hyaline keels; and two
conspicuous lateral paramylon plates located between
the pellicle and the chloroplast. With the three SSU
rDNA signature sequences:
PSD1: CACCCAGTCTTAAAGCTGGGAGGAAC
CCCA
PSD2: TTTCACTGGGGAAAGAGAAGCTTCAA
GCTATTGGCACCCAGCTG
PSD3: TGGCCCCTCCATGCTGTTGGTTGTCC
CTATGGGCCTCCTGGCTGTGATGCTGCCAA
TCCCCCGAGAGTGCTGGGTTCCCTTAAGA
Type: Permanently preserved material of strain
CCAC 0093 (cells in resin, for EM), deposited at the
herbarium of the Department of Plant Systematics and
Geography at Warsaw University, Al. Ujazdowskie 4
PL-00478 Warszawa, Poland. The culture from which
the type described originated has been deposited in
the Culture Collection of Algae at the University of
Cologne (CCAC), Germany. Fig. 1l shows an illustration of the type.
Cryptoglena Ehrenberg, Abh. Ko¨nigl. Akad. Wiss. Berlin Phys. Kl. 1831:150. Emend. Kosmala et Zakrys´. Emended diagnosis: Cells rigid, ovoid in lateral broad view,
laterally compressed with a median longitudinal furrow on one broad side (resembling a coffee bean),
without a conspicuous, hyaline, posterior tail; pellicle
distinctly striated; single parietal chloroplast forms an
open cylinder (in the shape of the letter C) without
pyrenoids; two lateral, shield-shaped paramylon grains
(located between the chloroplast and the pellicle).
Cryptoglena pigra Ehrenberg, Abh. Ko¨nigl. Akad.
Wiss. Berlin Phys. Kl. 1831:150. 1832; Abh. Ko¨nigl.
Akad. Wiss. Berlin, Phys. Kl. 1833:290, pl. VII, fig. 2.
1835.
Cryptoglena skujae Marin et Melkonian in Marin
et al. Protist 154:102 (‘‘skujai’’), 2003. Homotypic synonym:
Phacus agilis Skuja, Acta Hort. Bot. Univ. Latv. 1:39–40,
fig. 2:4. 1926 (priority for Cryptoglena agilis Ehrenberg,
Abh. Königl. Akad. Wiss. Berlin, Phys. Kl. 1831:150.
1832).
DISCUSSION
Taxonomy of Monomorphina Mereschkowsky. The genus Monomorphina was established in 1877 by Mereschkowsky for euglenoid species with rigid, but not flat,
or even slightly flattened cells: E. pyrum Ehrenberg
1832, E. rostrata Ehrenberg 1838, E. acus Ehrenberg
1838 [ 5 L. acus (Ehrenb.) Marin et Melkonian 2003]
and P. tripteris Dujardin 1841 [ 5 E. tripteris (Dujardin)
Klebs 1883, 5 L. tripteris (Dujardin) Marin et Melkonian 2003], distinct from the genera Euglena (with ovoid
cells capable of metaboly) and Phacus (with rigid and
flat, leaf-shaped cells).
In descriptions of the taxa included in Monomorphina Mereschk. [M. pyrum, M. pyrum var. pseudonordstedtii,
M. pyrum var. costatus, M. nordstedtii, M. globosus, M. mirabilis, M. megalopsis], the chloroplasts were characterized as ‘‘numerous, discoid, without pyrenoids’’
PHYLOGENY AND SYSTEMATICS OF MONOMORPHINA
(Mereschkowsky 1877, p. 296). The only exception was
M. splendens, with two large, lobed chloroplasts, each
having a pyrenoid located on its centripetal side (Popova 1951, 1955, Asaul 1975, Popova and Safonova,
1976).
In their emended diagnosis, Marin et al. (2003)
state: ‘‘one to few large, parietal chloroplasts, not
lens-shaped; pyrenoids typically absent’’ (p. 102).
They included one species with a single chloroplast—
M. monochloron (Pochmann) Marin et Melkonian ( 5 P.
aenigmaticus var. monochloron Pochm.) into Monomorphina. However, the majority of the taxa transferred by
them from Phacus [P. arnoldii Svirenko, P. minusculus, P.
atractoides, P. turgidulus, P. trypanon, P. strongylus, P. rudicula, P. pulcherrimus, P. cochleata, P. lepocincloides] and
Lepocinclis [L. capito Wehrle, L. pyriformis Kufferath, L.
reeuwykiana Conrad] are described in the literature as
having multiple discoid chloroplasts (Pochmann 1942,
Huber-Pestalozzi 1955, Bourrelly 1970, Asaul 1975,
Popova and Safonova 1976).
With respect to the large paramylon grains, Marin
et al. (2003, p. 102) wrote: ‘‘two (rarely 3–4) conspicuous lateral paramylon plates,’’ without extending the
Monomorphina description to take into account the species with ringlike paramylon grains that they themselves had moved from Lepocinclis and Phacus into
Monomorphina [P. arnoldi, P. costatus, P. turgidulus, P.
lepocincloides, L. pyriformis, and L. reeuwykiana Conrad].
As our studies show (Fig. 1l; Table 3), strain CCAC
0093 has a single chloroplast and platelike paramylon
grains. Therefore, it clearly fits the description of
M. pyrum–like strains, but not that of L. reeuwykiana,
which was described by Conrad as having ringlike paramylon grains. Furthermore, the reclassification by
Marin et Melkonian (2003) of all L. reeuwykiana–like
strains (those having ringlike paramylon grains) seems
unjustified because it was based on similarity with a
misidentified strain (CCAC 0093). Our findings also
reveal the need for extensive analysis, both molecular
and morphological, before another reclassification can
be undertaken.
Taxonomy of Monomorphina pyrum (Ehrenb.) Mereschk. Ehrenberg (1832), in describing a pear-shaped
Euglena pyrum with a ribbed pellicle, did not take into
account the number or the morphology of chloroplasts—‘‘Längendurchm. bis 1/72 0 0 0 ( 5 30.27 mm).
Körper birnförmig, fast kuglich, mit spitzem dünnen
Schwanze beinahe von der Körperlänge. Vorn dick,
kuglich abgerundet, ohne Lippen. Körper mit erhabenen spiralförmigen Linien besetzt, grün, Auge roth’’
(p. 72).
Mereschkowsky (1877), while moving this species to
Monomorphina, described its chloroplasts as small and
numerous. Schmitz (1884) observed two lateral chloroplasts in the cells of E. pyrum, each having a large paramylon cap. Dangeard (1910) expressed his doubts
regarding the accuracy of Schmitz’s observations and,
not aware of Mereschkowsky’s diagnosis, described P.
pyrum as having small, numerous, and discoid chloroplasts. This description was subsequently corroborated
181
by Goor (1925) and Krichenbauer (1937) and later followed by authors of numerous monographs, such as
Pochmann (1942), Huber-Pestalozzi (1955), Bourrelly
(1970), Popova (1947, 1951, 1955), Popova and Safonova (1976), and floristic studies. On the other hand,
Dre(epolski (1925) and Chadefaud (1937) confirmed
Schmitz’s observation that the form with two chloroplasts does exist. In Africa, Bourrelly (1961) also found
forms with two chloroplasts, but with the paramylon
grains substantially reduced. Thus, how many chloroplasts does M. pyrum have, and do they have pyrenoids?
In light of the findings presented here, it becomes
clear why different authors described the chloroplasts
in M. pyrum in so many different ways. The technical
limitations present in those days also mattered. Only
observations under modern light and confocal electron
microscopes have made it possible to determine unequivocally that in the cells of Monomorphina species,
there is a single, parietal chloroplast, which, under unfavorable conditions or aging populations, may disintegrate or become exceedingly perforated. Such a
highly perforated or disintegrated chloroplast appears
as two or more separate chloroplasts. The presence of
two chloroplasts may also be a normal stage of ontogenesis, as a result of chloroplast duplication before the
splitting of the cell.
Other features, such as stiffness and flatness of the
cell, were also perceived differently by different authors. In the description of Ehrenberg (1832), the cells
were described as ‘‘pyriform, almost spherical’’ (p. 72).
In 1852, Perty moved Euglena pyrum to Lepocinclis, the
genus he had described previously (Perty 1849), because of its rigid and ovoid cells that were circular in
cross-section. For the same reasons, Mereschkowsky
(1877) included it in the genus Monomorphina. In 1878,
Stein moved E. pyrum to the genus Phacus Duj.—characterized by very flat (leaflike) cells—and it was his, not
the opinions of Mereschkowsky or Perty, which gained
acceptance by the majority of authors of monographic
treatments (Lemmermann 1901, Pochmann 1942, Huber-Pestalozzi 1955). Bourrelly (1970) meanwhile perceived the morphological distinction between P. pyrum
and similar species and recognized Monomorphina as a
section of Phacus. The description of P. pyrum has always caused much confusion, as illustrated by contradictory information and drawings enclosed in
monographic and floristic treatments. In the judgment
of Ehrenberg (1832), the shape was pearlike, meaning
the cell was thick, rounded from the front, with a sharp
appendix at the rear—see the citation above and drawings by Ehrenberg (1832, Pl. 1, Fig. 5 and 1838, Pl. 7,
Fig. 11). At the same time, the terms oval, wide-oval,
egg-shaped, inversely egg-shaped, inversely pearshaped, spindle/pear-shaped, long pear-shaped, and
wide spindle-shaped could be found in the literature
(Pochmann 1942, Popova 1947, 1951, 1955, HuberPestalozzi 1955, Bourrelly 1970, Popova and Safonova
1976, and floristic studies). Most likely, not only the
subjective judgment and semantic tendencies of particular authors, but also the state of the observed cell,
182
S. KOSMALA ET AL.
such as its mobility, age, ontogeny phase, and physiological condition had contributed to such diverse descriptions.
Ehrenberg’s imprecise description (Ehrenberg
1832, 1838) allows for different interpretations, as attested by the large number of species and intraspecific
taxa that have been described to accommodate forms
morphologically similar to M. pyrum. Consequently,
several diagnostic characteristics were used to describe
these species, such as (1) the presence of two chloroplasts (M. splendens); (2) the absence of large paramylon
grains (M. atraktoides, M. cochleata, M. nordstedtii, M.
strongyla, P. megalopsis); (3) the degree of cell flatness: (a)
ovoid, not flattened (M. mirabilis, M. globosa, M. splendens, M. ovata), (b) slightly flattened (M. pyrum, P. inconspicuus, M. minuscula, M. atraktoides), and (c)
considerably flattened (M. pseudonordstedtii, M. pulcherrima, M. rudicula); (4) cell dimensions (P. minusculus,
with noticeably smaller cells [12–14 8–10 mm] and
nearly spherical cells; P. globosus [cells 23–23.8 21.2–
23 mm]); (5) pellicle detached from the cytoplasm (M.
cochleata, M. nordstedtii); and (6) pellicle ornamentation:
(a) sharp, significantly protruding ribs with the socalled loop at the top of the cell (M. mirabilis, M. rudicula), (b) dual ribs (M. trypanon), or (c) only the pellicle
striped (P. inconspicuus).
Our studies presented here have allowed for the
delineation of the range of changes in morphological
diagnostic characters and suggest the following: (1) the
disintegrated chloroplast in aging cells may appear as
two large chloroplasts or numerous small ones (the
presence of two chloroplasts may also be ontogenic,
resulting from division of a chloroplast just before the
division of the cell); (2) large, parietal, and platelike
paramylon grains are always present, but in young,
vigorously dividing populations have a small diameter,
are flat, lie adjacent to a relatively thick, ribbed pellicle,
and are hardly detectable under the light microscope;
and (3) features such as the shape of the cell, and the
degree of flatness or sharpness of the ribs are subjective measures, depending additionally on the population age. Old, nondividing cells are subject to
deformations when building large-sized, platelike paramylon grains and accumulating small, numerous paramylon grains in the cytoplasm. We never observed
the detachment of the pellicle from the cytoplasm, so
this characteristic was not verified.
More than 170 years have passed since the description of E. pyrum by Ehrenberg, and the question of
what morphological form he had in hand remains unresolved. Beacause it seems impossible to answer this
question definitively, we propose an epitype—permanently preserved material from strain ACOI 2778,
whose morphology and 18S rDNA sequence we have
studied. Its pearlike form, about 30 mm long, with a
rounded frontal part (Fig. 1, a–d) is most reminiscent
of that of the cells eternized by Ehrenberg (1832, Pl. 1
Fig. 5 and 1838, Pl. 7 Fig. 11; see also the Web page of
the Ehrenberg Collection—Institut für Paläontologie,
Museum für Naturkunde, Humboldtät Universität zu
Berlin, Germany [link provided in supplementary materials]).
Taxonomy of Monomorphina aenigmatica (Dre(ep.)
Nudelman et Triemer (2006) [Phacus aenigmaticus
Dre(epolski 1922, 5 Phacus striatus France` 1897,
5 Monomorphina striata (France`) Marin et Melkonian
2003]. One of the species included by Marin et al.
(2003) in the genus Monomorphina is Phacus aenigmaticus Dre(epolski 1922, which they considered a heterotypic synonym of P. striatus Francè 1897. This species is
relatively easy to identify because it has three (rarely
two or four) conspicuous, lateral paramylon plates.
Popova (1951, 1955) observed numerous small, discoid chloroplasts in this species. However, in material
from Siberia, she encountered cells with one chloroplast not divided, and therefore a question mark was
placed in the description of the species with regard to
chloroplasts [‘‘chloroplasts small (?)’’; Popova and Safonova 1976]. Similar observations were made by Pochmann (1942), who, in his laboratory cultures of P.
aenigmaticus, had cells with single chloroplasts. Consequently, he described the variety P. aenigmaticus var.
monochloron Pochm., which Bourrelly (1963) elevated
to the rank of species [P. monochloron (Pochm.) Bourrelly, currently classified as Monomorphina (Marin et al.
2003, Nudelman et al. 2006)].
In their recent investigation involving the use of
light and transmission microscopes, Nudelman et al.
(2006) reported the presence of a single, large,
parietal-lobed chloroplast, opened from one side (in
the shape of the letter C), having ‘‘at least one haplopyrenoid’’ (p. 196). Unfortunately, the authors submitted only one picture of this pyrenoid from under the
TEM (Nudelman et al. 2006) and were unable to precisely establish the total number of pyrenoids in the
chloroplast. Under the light microscope, in some cells
they observed one or two paramylon caps situated at
the outer side of the chloroplast, indicating the presence of pyrenoids. Our study under the confocal
microscope does not reveal the presence of pyrenoids
in M. aenigmatica or in any other strain presently assigned to Monomorphina. On the other hand, the studies under the light microscope do reveal in a small
number of cells of three strains [M. aenigmatica
(Fig. 1p), M. pyrum—ACOI 2669 (Fig. 1m) and AICB
511 (Fig. 1, n and o)] the presence of spherical structures similar to those visible in pictures of M. aenigmatica presented by Nudelman et al. (2006).
The reason for the failure to observe pyrenoids under the confocal microscope may lie in the fact that
there is no accumulation of paramylon caps around
the location where the pyrenoids are situated, and thus
the optical density of this area is similar to that of the
rest of the chloroplast. The presence of haplopyrenoids is also dependent on the stage of ontogenesis;
haplopyrenoids are absent in dividing chloroplasts and
are reconstituted after the division of the cell, as shown
in the representatives of Trachelomonas, Strombomonas,
and Colacium (Brown et al. 2003). In our studies under
the electron confocal microscope, we have observed
PHYLOGENY AND SYSTEMATICS OF MONOMORPHINA
hundreds of cells at different stages of development
and have never encountered a single pyrenoid. Perhaps the light conditions in our growth chamber did
not favor the creation of paramylon caps or even the
reconstitution of pyrenoids after the division of the
cell. This consideration may be extended to the remaining strains of M. pyrum, and therefore, the definite
resolution of number and presence of pyrenoids in
Monomorphina requires further study. Our results supplement the observation made by Nudelman et al.
(2006), by precisely describing the chloroplast and
changes in its morphology as a consequence of changes in environmental conditions and stages of development, and explain the existence of earlier, apparently
contradictory reports regarding this matter (Dre(epolski 1921–1922, 1925, Pochmann 1942, Popova and
Safonova 1976).
Taxonomy of Lepocinclis reeuwykiana Conrad (1935)
[ 5 M. reeuwykiana (Conrad) Marin et Melkonian 2003].
According to the original description, this species has
two large, ringlike, parietal paramylon grains and cells
that are not flattened [‘‘Coupe transversale parfaitement circulaire,’’ ‘‘Deux anneaux de paramylon dans la
portion renlée de la cellule’’ (p. 30), and Fig. 20 (p. 29)
in Conrad’s monograph].
On the phylogenetic trees of 18S rDNA, the strain
CCAC 0093 (supposedly L. reeuwykiana) is found
among strains belonging to Monomorphina, according
to Marin et al. (2003). Consequently, those authors
moved it to that genus, together with many other
strains of Lepocinclis and Phacus of similar morphology
(i.e., having ringlike paramylon grains). However, in
light of our studies, such reclassification seems unjustified because it was made on the basis of their incorrect identification of the strain in question as M.
reeuwykiana. The strain CCAC 0093 studied by Marin
et al. (2003) has flattened cells and paramylon grains
in the form of plates, which are visible on the drawing
provided, made under a light microscope (Marin et al.
2003, p. 126). The described morphology was confirmed by our studies under a light microscope (Table
3; Fig. 1l). However, the amount of molecular (18S
rDNA) divergence of the strain from the rest of the M.
pyrum–like strains (Table 4; Fig. 4) justifies designation
of a separate species, M. pseudopyrum. Seven short SSU
rDNA signature sequences (Ekelund et al. 2004) were
chosen in order to distinguish M. pyrum from M.
pseudopyrum. Four of them (P1–P4), shared by all investigated strains of M. pyrum, are in the conserved region of rDNA and can be easily compared with
homologous sequences from M. pseudopyrum as well
as from other taxa. The sequence of P1 corresponds to
helix 10 in the SSU rRNA secondary structure; P2 to
helix 17; P3 to E23_7; and P4 to E23_8, E23_13, and
E23_14. Three other signature sequences were selected (PSD1–PSD3) to facilitate the distinction of M.
pseudopyrum. They are located in hypervariable rDNA
regions and are not comparable with sequences from
other taxa (PSD1: helix E23_2; PSD2: E23_16; PSD3:
43).
183
The differences at the molecular level, especially
with respect to 18S rDNA, are not unexpected and do
occur in euglenoids, as shown by recent findings of
morphological and molecular diversification of E. agilis
Carter (Zakryś 1997, Zakryś et al. 2004), E. geniculata
Duj. (Zakryś et al. 2002), E. stellata Mainx and E. viridis
Ehrenb. (Shin and Triemer 2004), and L. spirogyroides
(Ehrenb.) Marin et Melkonian (Kosmala et al. 2005).
Taxonomy of the genus Cryptoglena Ehrenberg. The
description of Cryptoglena by Ehrenberg (1832) is short
and vague, like those of his new species—C. caerulescens
and C. pigra (Ehrenberg 1835, p. 290), which do not
mention chloroplasts. However, in Ehrenberg’s illustrations (1835, pl. VII., figs. I, II), chloroplasts seem to
be visible as two green structures in the cells of both
species.
The Cryptoglena diagnosis was emended by Stein
(1878) and then by Klebs (1883), who pointed out the
presence of the furrow and two parietal chloroplasts in
the small, oblate cells of C. pigra. Descriptions of subsequent taxa from Australia—C. phacoidea Playfair, C.
australis Playfair (Playfair 1921)—and China—C. tumida
Skv., C. longicauda Skv., C. cornuta Skv. (Skvortzov
1958)—were concerned mostly with the differences
between these taxa and C. pigra with respect to cell
shape. The chloroplasts are rarely mentioned and
always in the plural (e.g., in C. australis, ‘‘chloroplasts
laminar’’), which suggests that there are two of
them, as in C. pigra. Later, studies under TEM revealed that C. pigra has a single, parietal, U-shaped
chloroplast without pyrenoids, which, under a light
microscope, looks like two chloroplasts (Rosowski and
Lee 1978).
Taxonomy of Cryptoglena skujae Marin et Melkonian.
In 2003, Marin et al. moved P. agilis Skuja (1926) to the
genus Cryptoglena on the basis of 18S rDNA analysis
and named it C. skujae, thus concurring with earlier
suggestions of some authors that P. agilis is closely related to Cryptoglena as shown by their apparent similarities, including the lateral location of shieldlike
paramylon grains (Bourrelly 1970) and the size and
shape of the cells (Popova and Safonowa 1976). As for
the number of chloroplasts, according to the prevailing
opinion, there were two in a P. agilis cell (Skuja 1926,
Pochmann 1942, Huber-Pestalozzi 1955, Popova and
Safonova 1976, Németh, 1997, Shi et al. 1999, and
numerous floristic works) in spite of some references
to populations with many small chloroplasts (Bourrelly
and Manguin 1946, Behre 1961).
In their emended description of Cryptoglena, Marin
et al. (2003) stated that there are ‘‘two large lateral
chloroplasts or, if a thin posterior connection is present, a single U-shaped chloroplast.’’ Our studies under
an electron confocal microscope showed that C. skujae
has only one chloroplast, similar to C. pigra (Rosowski
and Lee 1978) and representatives of Monomorphina
(Nudelman et al. 2006, this study). There is, however,
a substantial difference in the chloroplasts of these two
genera. In Cryptoglena, the chloroplast forms an open
cylinder (in the shape of the letter C or U), while in
184
S. KOSMALA ET AL.
Monomorphina, it is closed and assumes a shape of a
sphere with a hollow center.
The presence of a single, parietal chloroplast in
Cryptoglena and Monomorphina, taken together with
other common traits—such as rigid cells; the absence
of strip reduction in the pellicle (Leander and Farmer
2000, 2001, Leander et al. 2001); and the presence of
shieldlike, conspicuous, lateral paramylon grains
underneath the pellicle—are consistent with the relationship between these two genera, which form sister
groups on 18S and 16S rDNA trees (Marin et al. 2003,
Milanowski et al. 2006).
Financial support was provided by the State Committee for
Scientific Research (KBN) grant no. 3PO4C08225. We thank
Dr. Maria Santos from the University of Coimbra, Portugal,
for providing euglenoid strains; Dr. David Lazarus from Institut für Paläontologie, Museum für Naturkunde, Humboldt
Universität in Berlin, Germany, for providing Ehrenberg’s
drawings of M. pyrum from the Ehrenberg Collection; and
Professor Tomasz Majewski, Warsaw, Poland, for providing
the Latin diagnosis for M. pseudopyrum sp. nova. We are also
very grateful to two anonymous reviewers and Paul C. Silva
for a thorough critique, which helped in improving the
manuscript.
Asaul, Z. I. 1975. Viznacnik evglenovikh vodorostej Ukrainskoy R.S.R.
[Survey of the euglenophytes of the Ukrainian SSR]. Naukova Dumka, Kiev 407 pp. (in Ukrainian).
Behre, K. 1961. Die Algenbesiedlung der Unterweser unter
Berücksichtigung ihrer Zuflüsse (ohne die Kieselalgen). Veröff.
Inst. Meeresf. Bremerhaven 7:71–263.
Bourrelly, P. 1961. Algues d’eau douce de la République de Côte
d’Ivoire. Bull. Inst. Franç. Afrique noire. 2:283–374.
Bourrelly, P. 1963. Remarques sur quelques eugléniens. Rev. Algol.
Se´r. 2 7:100–4.
Bourrelly, P. 1970. Les Algues d’Eau Douce. III: Les Algues Bleues et
Rouges. Les Eugle´niens, Peridiniens et Cryptomonadines. N. Boubée
et Cie. Paris, 512 pp.
Bourrelly, P. & Manguin, E. 1946. Contribution à la flore algal
d’eau douce des Açores. Me`m. Soc. Biogeogr. 8:447–509.
Bremer, K. 1994. Branch support and tree stability. Cladistics
10:295–304.
Brosnan, S., Shin, W., Kjer, K. M. & Triemer, R. E. 2003. Phylogeny
of the photosynthetic euglenophytes inferred from the nuclear
SSU and partial LSU rDNA. Int. J. Syst. Evol. Microbiol.
53:1175–86.
Brown, P. J. P., Zakryś, B. & Farmer, M. A. 2003. Plastid morphology, ultrastructure, and development in Colacium and the
loricate euglenoids (Euglenophyceae). J. Phycol. 39:115–21.
Chadefaud, M. 1937. Recherches sur l’ anatomie comparée des
Eugléniens. Le Botaniste 28:86–185.
Conrad, W. 1934. Matériaux pour une Monographie du genre
Lepocinclis Perty. Arch. Protistenk. 82:204–49.
Conrad, W. 1935. Étude systématique du genre Lepocinclis Perty.
Me´m. Mus. Roy. Hist. Nat. Belgique. Se´r. 2 1:1–84.
Conrad, W. 1938. Flagellates des ı̂les de la Sonde (Eugle´nace´es). Bull.
Mus. R. Hist. Nat. Belgique 14:1–20.
Dangeard, P. A. 1910. Etudes sur le développement et la structure
des organismes inférieurs. Le Botaniste 11:1–311.
Deflandre, G. 1928. Algues d’eau douce du Vénézuéla. Rev. Algol.
3:212–41.
Dre(epolski, R. 1922. Eugleniny wolno(yjaace ze zbioru glonów
podlaskich i litewskich dr J. Grochmalickiego. [De Eugleninis
se ipsis sustinentibus ex collectione facta a dr. J. Grochmalicki
in Podlachia et Lithuania]. Rozpr. Wiad. Muz. Dzieduszyckich 7/8
(1921/1922):1–19 (in Polish with Latin summary).
Dre(epolski, R. 1925. Przyczynek do znajomości polskich Euglenin
[Suplement á la connaissance des Eugleniens de la Pologne].
Kosmos 50:173–257 (in Polish with French summary).
Ehrenberg, C. G. 1832. Über die Entwickelung und Lebensdauer
der Infusionsthiere; nebst ferneren Beiträgen zu einer Vergleichung ihrer organischen Systeme. Abh. Ko¨nigl. Akad. Wiss.
Berlin, Phys. Kl. 1831 (1832):1–154.
Ehrenberg, C. G. 1835. Dritter Beitrag zur Erkenntnis grosser Organisation in der Richtung des kleinsten Raumes. Abh. Ko¨nigl.
Akad. Wiss. Berlin, Phys. Kl. 1833:145–336.
Ehrenberg, C. G. 1838. Die Infusionsthierchen als Vollkommene Organismen. Berlin und Leipzig, Germany, 547 pp.
Ekelund, F., Daugbjerg, N. & Fredslund, L. 2004. Phylogeny of
Heteromita, Cercomonas and Thaumatomonas based on SSU
rDNA sequences, including the description of Neocercomonas
jutlandica sp. nov., gen. nov. Eur. J. Protistol. 40:119–35.
Elwood, H. J., Olsen, G. J. & Sogin, M. L. 1985. The small-subunit
ribosomal RNA gene sequences from the hypotrichous ciliates
Osytricha nova and Stylonychia pustulata. Mol. Biol. Evol. 2:399–
410.
Eriksson, T. 1998. AutoDecay 4.0.2. A program distributed by the
author. Department of Botany, Stockholm University, Sweden.
Felsenstein, J. 1985. Confidence limits on phylogenies: approach
using the bootstrap. Evolution 39:783–91.
Francé, R. 1897. Protozoen. In Entz, G. [Ed.] Resultate der wissenschaftlichen Erforschung des Balatonsees. 2. Band. Die Biologie des
Balatonsees. Commissionsverlag Von. Ed. Hölzel, Wien, Germany, pp. 29–32.
Goor, A. C. J. 1925. Die Euglenineae des holländischen Brackwassers mit besonderer Berücksichtigung ihrer Chromatophoren.
Rec. Trav. Bot. Ne´erl. 22:292–314.
Huber-Pestalozzi, G. 1955. Das Phytoplankton des Süsswassers IV. Euglenophyceen. E. Schweizerbart’sche Verlagsbuchhandlung,
Stuttgart, Germany, 1135 pp.
Huelsenbeck, J. P. & Ronquist, F. 2001. MRBAYES: bayesian inference of phylogenetic trees. Bioinformatics 17:754–5.
Klebs, G. 1883. Über die Organisation einiger Flagellaten-Gruppen und ihre Beziehungen zu Algen und Infusorien. Unters.
Bot. Inst. Tübingen 1:233–62.
Kosmala, S., Karnkowska, A., Milanowski, R., Kwiatowski, J. &
Zakryś, B. 2005. Phylogenetic and taxonomic position of
Lepocinclis fusca comb. nova ( 5 Euglena fusca) (Euglenaceae):
morphological and molecular justification. J. Phycol. 41:1258–
67.
Krichenbauer, H. 1937. Beitrag zur Kenntnis der Morphologie
und Entwicklungsgeschichte der Gattungen Euglena und Phacus. Arch. Protistenk. 90:88–123.
Leander, B. S. & Farmer, M. A. 2000. Comparative morphology
of the euglenid pellicle. I. Patterns of strips and pores. J.
Eukaryot. Microbiol. 47:469–79.
Leander, B. S. & Farmer, M. A. 2001. Comparative morphology of
the euglenid pellicle. II. Diversity of strip substructure. J. Eukaryot. Microbiol. 48:202–17.
Leander, B. S., Witek, R. P. & Farmer, M. A. 2001. Trends in
the evolution of the euglenid pellicle. Evolution 55:2215–
35.
Lemmermann, E. 1901. Beiträge zur Kenntnis der Planktonalgen,
XII. Notizen über einige Schwebe-algen. Ber. Deutsch. Bot. Ges.
19:85–95.
Linton, E. W., Nudelman, M. A., Conforti, V. & Triemer, R. E.
2000. A molecular analysis of the Euglenophytes using SSU
rDNA. J. Phycol. 36:740–6.
Marin, B., Palm, A., Klingberg, M. & Melkonian, M. 2003. Phylogeny and taxonomic revision of plastid-containing Euglenophytes based on SSU rDNA sequence comparisons and
synapomorphic signatures in the SSU rRNA secondary structure. Protist 154:99–145.
Mereschkowsky, K. S. 1877. Etjudy nad prostejsimi zivotnymi severa Rossii. Trudy S-Peterburgsk. Obshch. Estestvoisp. 8:1–299.
Milanowski, R., Kosmala, S., Zakryś, B. & Kwiatowski, J. 2006.
Phylogeny of photosynthetic euglenophytes based on combined chloroplast and cytoplasmic SSU rDNA sequence analysis. J. Phycol. 42:721–30.
PHYLOGENY AND SYSTEMATICS OF MONOMORPHINA
Moreira, D., López-Garcı́a, P. & Rodriguez-Valera, F. 2001. New
insights into the phylogenetic position of diplonemids: G þ C
content bias, differences of evolutionary rate and a new
environmental sequence. Int. J. Syst. Evol. Microbiol. 51:
2211–9.
Müllner, A. N., Angeler, D. G., Samuel, R., Linton, E. W. & Triemer,
R. E. 2001. Phylogenetic analysis of phagotrophic, phototrophic and osmotrophic euglenoids by using the nuclear
18S rDNA sequence. Int. J. Syst. Evol. Microbiol. 51:783–91.
Nudelman, M. A., Leonardi, P. I., Conforti, V., Farmer, M. A. &
Triemer, R. E. 2006. Fine structure and taxonomy of Monomorphina aenigmatica comb. nov. (Euglenophyta). J. Phycol.
42:194–202.
Nudelman, M. A., Rossi, M. S., Conforti, V. & Triemer, R. E. 2003.
Phylogeny of Euglenophyceae based on small subunit rDNA
sequences: taxonomic implications. J. Phycol. 39:226–35.
Németh, J. 1997. A Guide for the Identifcation of Euglenophyta Occurring in Hungary, I. Vizi Termeszet-Es Kornyezetvedelem,
319 pp.
Page, R. D. M. 1996. TREEVIEW: an application to display phylogenetic trees on personal computers. Comp. Appl. Biosci.
12:357–8.
Perty, M. 1849. Über vertikale Verbreitung mikroskopischer Lebensformen. Lepocinclis n. gen. Mitth. Naturforsh. Ges. Bern
28:17–45.
Perty, M. 1852. Zur Kenntniss kleinster Lebensformen nach Bau, Funktionen, Systematik mit Specialverzeichniss der in der Schweiz
beobachteten. Verlag von Jent und Reinert, Bern, Germany,
228 pp.
Playfair, G. J. 1921. Australian freshwater flagellates. Proc. Linn.
Soc. New South Wales 46:99–146.
Pochmann, A. 1942. Synopsis der Gattung Phacus. Arch. Protistenk.
95:81–252.
Popova, T. G. 1947. Sistematiceskije zametki po evglenovym.
[Taxonomical note about euglenophytes]. Izv. Zap. Sib. Fil.
AN SSSR Ser. Biol. (Novosibirsk) 2:47–71 (in Russian).
Popova, T. G. 1951. Euglenovyje evropejskogo Severa SSSR. [Euglenineae of the European north of the Soviet Union]. Trudy
Bot. Inst. Akad. Nauk SSSR 2/7:165–414 (in Russian).
Popova, T. G. 1955. Euglenovyje vodorosli. Opredelitel prosnovodnych
vodoroslej SSSR, 7. [Euglenophyta. The Handbook of Freshwater
Algae]. Sov. Nauka, Moskwa, 267 pp. (in Russian).
Popova, T. G. & Safonova, T. A. 1976. Flora Sporovych Rastenij SSSR,
9. [Flora plantarum cryptogamarum URSS]. Euglenophyta. 2. Izd.
Nauka, Leningrad, 286 pp.
Posada, D. & Crandall, K. A. 1998. Modeltest: testing the model of
DNA substitution. Bioinformatics 14:817–8.
Rosowski, J. R. & Lee, K. W. 1978. Cryptoglena pigra a euglenoid
with one chloroplast. J. Phycol. 14:160–6.
Schlösser, U. G. 1994. SAG-Sammlung von Algenkulturen at University of Göttingen. Catalogue of Strains 1994. Bot. Acta
107:111–86.
Schmitz, F. 1884. Beiträge zur Kenntnis der Chromatophoren.
Jahrb. Wiss. Bot. 15:1–175.
Shin, W. & Triemer, R. E. 2004. Phylogenetic analysis of the genus
Euglena (Euglenophyceae) with the particular reference to the
type species Euglena viridis. J. Phycol. 40:759–71.
Shi, Z., Wang, Q., Xie, S., Dai, J. & Chen, L. 1999. Flora algarum
sinicum aquae dulcis. Tomus VI: Euglenophyta. In Shi, Z. [Ed.]
A Major Project of the National Natural Science Foundation of
China. Science Press, Beijing, pp. 297–414 (in Chinese).
Skuja, H. 1926. Vorarbeiten zu iner Algenflora von Lettland. I.
Acta Horti. Bot. Univ. Latv. 1:33–54.
Skvortzov, B. W. 1958. New and rare Flagellatae from Manchuria,
eastern Asia. Philipp. J. Sci. 86:139–202.
Stein, F. R. 1878. Der Organismus der Infusionsthiere. III.
Abt. Der Organismus der Flagellaten. Leipzig, Germany,
154 pp.
185
Swofford, D. L. 1998 PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods). Version 4. Sunderland, MA,
Sinauer Associates.
Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F. &
Higgins, D. G. 1997. The ClustalX windows interface: flexible
strategies for multiple sequence alignment aided by quality
analysis tools. Nucleic Acids Res. 24:4876–82.
Wuyts, J., Van de Peer, Y., Winkelmans, T. & De Wachter, R. 2002.
The European database on small subunit ribosomal RNA. Nucleic Acids Res. 30:183–5.
Zakryś, B. 1997. On the identity and variation of Euglena agilis
Carter ( 5 E. pisciformis Klebs). Arch. Hydrobiol. Suppl. 120
(Algol. Stud.) 86:81–90.
Zakryś, B., Milanowski, R., Empel, J., Borsuk, P., Gromadka, R. &
Kwiatowski, J. 2002. Two different species of Euglena, E. geniculata and E. myxocylindracea (Euglenophyceae), are virtually
genetically and morphologically identical. J. Phycol. 38:1190–9.
Zakryś, B., Milanowski, R., Ke
˛dzior, M., Empel, J., Borsuk, P., Gromadka, R. & Kwiatowski, J. 2004. Genetic variability of Euglena agilis (Euglenaceae). Acta Soc. Bot. Pol. 73:305–9.
Supplementary Material
The following supplementary material is available for this article:
Link to the web page of the Ehrenberg Collection–Institut für Paläontologie, Museum für Naturkunde, Humboldtät Universität zu Berlin, Germany
http://www.museum.hu-berlin.de/home.asp?page=
This material is available as part of the online
article from: http://www.blackwell-synergy.com/doi/
abs/10.1111/j.1529-8817.2006.00298.x
Fig. S1. Light microscope photographs showing
an overview of living cells and chloroplast organization of Monomorphina pyrum.
Fig. S2. Light microscope photographs showing
an overview of living cells and chloroplast organization of Monomorphina pyrum.
Fig. S3. Light microscope photographs showing
an overview of living cells and chloroplast organization of Monomorphina pyrum.
Fig. S4. Light microscope photographs showing
an overview of living cells and chloroplast organization of Monomorphina pyrum, Monomorphina aenigmatica, and Cryptoglena skujai.
Fig. S5. Light microscope photographs showing
an overview of live, swimming cells of Monomorphina
pyrum.
Please note: Blackwell Publishing is not responsible for the content or functionality of any supplementary materials supplied by the authors. Any
queries (other than missing material) should be
directed to the corresponding author for the article.