Molecular phylogeny of the gobioid fishes

MOLECULAR
PHYLOGENETICS
AND
EVOLUTION
Molecular Phylogenetics and Evolution 26 (2003) 354–368
www.elsevier.com/locate/ympev
Molecular phylogeny of the gobioid fishes
(Teleostei: Perciformes: Gobioidei)
Christine E. Thacker*
Vertebrates-Ichthyology, Natural History Museum of Los Angeles County, 900 Exposition Blvd., Los Angeles, CA 90007, USA
Received 2 July 2001; revised 29 January 2002
Abstract
The phylogeny of groups within Gobioidei is examined with molecular sequence data. Gobioidei is a speciose, morphologically
diverse group of teleost fishes, most of which are small, benthic, and marine. Efforts to hypothesize relationships among the gobioid
groups have been hampered by the prevalence of reductive evolution among goby species; such reduction can make identification of
informative morphological characters particularly difficult. Gobies have been variously grouped into two to nine families, several
with included subfamilies, but most existing taxonomies are not phylogenetic and few cladistic hypotheses of relationships among
goby groups have been advanced. In this study, representatives of eight of the nine gobioid familes (Eleotridae, Odontobutidae,
Xenisthmidae, Gobiidae, Kraemeriidae, Schindleriidae, Microdesmidae, and Ptereleotridae), selected to sample broadly from the
range of goby diversity, were examined. Complete sequence from the mitochondrial ND1, ND2, and COI genes (3573 bp) was used
in a cladistic parsimony analysis to hypothesize relationships among the gobioid groups. A single most parsimonious topology was
obtained, with decay indices indicating strong support for most nodes. Major phylogenetic conclusions include that Xenisthmidae is
part of Eleotridae, and Eleotridae is paraphyletic with respect to a clade composed of Gobiidae, Microdesmidae, Ptereleotridae,
Kraemeriidae, and Schindleriidae. Within this five-family clade, two clades are recovered. One includes Gobionellinae, which is
paraphyletic with respect to Kraemeriidae, Sicydiinae, Oxudercinae, and Amblyopinae. The other contains Gobiinae, also paraphyletic, and including Microdesmidae, Ptereleotridae, and Schindleriidae. Previous morphological evidence for goby groupings is
discussed; the phylogenetic hypothesis indicates that the morphological reduction observed in many goby species has been derived
several times independently.
Ó 2002 Elsevier Science (USA). All rights reserved.
Keywords: Gobioidei; Odontobutidae; Eleotridae; Eleotrinae; Xenisthmidae; Gobiidae; Gobiinae; Gobionellinae; Sicydiinae; Oxudercinae;
Amblyopinae; Kraemeriidae; Microdesmidae; Ptereleotridae; Schindleriidae; Molecular phylogeny; Miniaturization; Reduction
1. Introduction
Gobioidei includes an estimated 2121 species in 268
genera or 23% of perciforms (Nelson, 1994). Gobies are
widely distributed throughout the tropical, subtropical,
and temperate regions of the world, in freshwater and
nearshore marine habitats. They are a prominent component of many fish faunas, but because goby species
are generally cryptic and difficult to sample, the biology
of the group is understudied. The majority of gobies are
benthic, often living in burrows, but the group also includes nektonic reef-dwellers, planktonic species, and
*
Fax: 1-213-748-4432.
E-mail address: [email protected].
estuarine representatives with the ability to breathe air.
Most gobies attain a small adult size; the largest species
may reach a length of 100 cm or more but the majority
are 10 cm or less. Compared to other perciforms, gobies
are not only small but also often morphologically reduced, with many species possessing simplifications and
losses in various aspects of morphology. Gobioidei includes the most extreme case of vertebrate paedomorphosis, the genus Schindleria (Johnson and Brothers,
1993), and many other gobies exhibit lesser degrees of
morphological reduction (Iwata et al., 2001; Matsubara
and Iwai, 1959; Springer, 1983). These factors have all
hindered studies of goby phylogeny, and relationships
both within and among goby groups are mostly unresolved.
1055-7903/02/$ - see front matter Ó 2002 Elsevier Science (USA). All rights reserved.
doi:10.1016/S1055-7903(02)00361-5
C.E. Thacker / Molecular Phylogenetics and Evolution 26 (2003) 354–368
The current classification of gobies reflects the uncertain knowledge of goby relationships. As with many
large vertebrate groups, the trend in gobioid classification has been to identify groups of genera or species
which share some distinct morphological characters and
elevate them to family rank. This approach has resulted
in a classification in which many small families have
been subdivided from the largest groups; often morphological character evidence is presented to support
monophyly of the defined groups and sometimes trees
are presented (Gill and Hoese, 1993; Harrison, 1989;
Hoese and Gill, 1993; Rennis and Hoese, 1987; Springer,
1973, 1983), but cladistic analyses of goby taxa are rare
(Larson, 2001; Murdy, 1989; Parenti and Thomas, 1998;
Thacker, 2000). The group is diagnosed by more than 20
apomorphic characters, but its sister group is unknown
(Winterbottom, 1993). Several schemes for gobioid
higher classification have been proposed, including two
(Miller, 1973), six (Hoese, 1984; Hoese and Gill, 1993;
Pezold, 1993), eight (Nelson, 1994), or nine (Thacker,
2000) families, many with included subfamilies (taxonomic history is reviewed in Harrison, 1989 and Akihito
et al., 2000). The classification given in Table 1 is a
composite of recent classifications, with the approximate
number of genera and species in each named taxon given
after the taxon name.
All of the named taxa in Table 1 except Odontobutidae, Butinae, and Gobionellinae may be diagnosed by
at least one character (Hoese, 1984; Hoese and Gill,
1993; Pezold, 1993). Additionally, several studies have
described variation in characters that are potentially
useful for elucidating phylogeny among the larger
gobioid groups. Gosline (1955) described a variety of
osteological characters for representatives of Eleotridae,
Gobiidae, Kraemeriidae, and Microdesmidae, and recommended that Microdesmidae be included in Gobioidei. Takagi (1989) surveyed the sensory canal system of
355
55 genera of Japanese gobioids, and Akihito (1986) examined the morphology of the sensory canals as well as
the suspensorium, branchial apparatus and pectoral
girdle. Birdsong et al. (1988) identified patterns in the
spinous dorsal fin pterygiophore formula and select
other characters of the axial skeleton for over 200
gobioid genera that they used to delineate groups of
genera within the described families and subfamilies.
Harrison (1989) used characters of the palatopteroquadrate complex in the suspensorium to hypothesize relationships among groups of genera in the gobiid
subfamilies.
In spite of all the morphological character data that
has been identified, no cladistic analysis of the largescale relationships, among the gobioid families and
subfamilies, has been presented. There is general agreement that the more reduced and simplified gobies are the
most derived. Characters such as the reduction of the
epurals and lateral line and the loss of the anterior
branchiostegal ray, infraorbital bones, endopterygoid,
basibranchials 2–4, and various sensory canals have all
been used to define goby groups (Hoese, 1984). The
most extreme example of morphological reduction
among gobies, and among vertebrates generally, is seen
in the genus Schindleria. As adults, the two Schindleria
species resemble larval gobiids, possessing larval characters such as a transparent body, functional pronephric
kidney, tubular heart and many losses and reductions in
the skeletal system. Schindleria has been placed in Gobioidei based on otolith morphology, egg morphology,
presence of a sperm duct gland and skeletal characters
including similarities between the caudal skeleton of
Schindleria and that of larval gobioids (Johnson and
Brothers, 1993), but the sister taxon to Schindleria
within Gobioidei has not been determined.
Schindleria is an extreme example of a trend towards
reduction often described in studies of gobioid rela-
Table 1
Classification of groups within Gobioidei, with number of genera and species given following each taxon name
Family
Subfamily
Rhyacicthyidae
Odontobutidae
Eleotridae
Butinae
Eleotridinae
Xenisthmidae
Gobiidae
Oxudercinae
Amblyopinae
Sicydiinae
Gobionellinae
Gobiinae
Kraemeriidae
Microdesmidae
Ptereleotridae
Schindleriidae
Species
Reference
(1 genus; 1 species)
(3 genera; 4–5 species)
(35 genera; est. 150 species)
(13 genera)
(21–22 genera)
(5 genera; 19 species)
(212 genera; est. 1875 species)
(10 genera; 34 species)
(12–13 genera; est. 30 species)
(5–6 genera; est. 100 species)
(56 genera)
(109 genera)
(2 genera; 8 species)
(5 genera; 30 species)
(5 genera; 30 species)
(1 genus; 2 species)
Miller (1973)
Hoese and Gill (1993)
Hoese and Gill (1993)
Hoese and Gill (1993)
Hoese and Gill (1993)
Springer (1983)
Pezold (1993)
Murdy (1989)
Murdy and Shibukawa (2001)
Parenti and Thomas (1998)
Pezold (1993)
Pezold (1993)
Gosline (1955)
Thacker (2000)
Thacker (2000)
Johnson and Brothers (1993)
356
C.E. Thacker / Molecular Phylogenetics and Evolution 26 (2003) 354–368
tionships. Xenisthmidae, Kraemeriidae, Microdesmidae,
and some Gobiidae also exhibit reduction but the affected structures are not always the same. Therefore, one
question that may be asked concerning gobioid interrelationships is whether or not reduction has occurred as a
single gradual trend or several times independently in
different goby groups. In this study, DNA sequence data
are used as a character source to investigate relationships among gobioid families, subfamilies and genera.
Sequence data are attractive for resolving gobioid relationships because they are independent of the reduction
that can confound morphological character analyses.
The aims of this study were to provide a new view of
goby phylogeny on a broad scale, to allow reinterpretation of previously described morphological character
data and to clarify relationships among groups where
morphological character data have proved insufficient.
This study will also serve as a step towards assembling
large scale total evidence phylogeny for the group, providing a framework for future studies using both molecular and morphological data. Representatives of all
the named goby taxa listed in Table 1 were included,
with the exception of the monotypic Rhyacichthyidae.
Emphasis was placed on the families and subfamilies
that have been postulated to be more derived (Kraemeriidae, Schindleriidae, Microdesmidae, Ptereleotridae, Gobiinae, Gobionellinae, Sicydiinae, Oxudercinae,
and Amblyopinae), based on a character of the branchial skeleton, loss of the anterior branchiostegal ray
(Hoese, 1984). Additionally, most members of these
putatively more derived taxa are reduced in size compared to eleotrids, odontobutids, and rhyacichthids and
possess various other reductions in morphology.
The complete sequence of three mitochondrial genes
(ND1, ND2, and COI) was used as the character source
for this analysis. Mitochondrial DNA sequence is useful
for resolving phylogenetic relationships due to its pattern of inheritance (maternally inherited, without recombination) and rapid rate of change compared to
nuclear genes. Several previous studies have used mitochondrial sequence data to resolve relationships among
actinopterygian and chondrichthyian species (Block et
al., 1993; Chow and Kishino, 1995; Finnerty and Block,
1995; Kocher et al., 1995; Kocher and Stepien, 1997;
Tang et al., 1999; Wiley et al., 1998, 2000). Most of these
studies have involved freshwater fishes, and many use
ribosomal DNA sequence as a data source. The ND1,
ND2, and COI genes were chosen because unlike the
ribosomal DNAs, these genes are protein-coding genes.
In ribosomal DNAs, the translated RNA is the final
functional product and insertions and deletions which
affect the stem and loop structure of the RNA are
common, rendering alignment of sequences for phylogenetic analysis particularly difficult. In protein coding
genes, insertions and deletions are much rarer and when
they do occur, they generally involve addition or loss of
a codon; knowledge of this constraint and the ability to
perform alignments based on translated amino acid sequence makes alignment much less ambiguous. The
entire sequence of three genes (3573 bp total) was used
to provide a large enough amount of sequence data to
provide adequate resolution of relationships at this
broad scale. Mitochondrial genes are also appropriate
choices for resolution of relationships within Gobioidei
based on saturation patterns; saturation is not acute in
mitochondrial genes for divergences less than approximately 100 million years ago (Mindell and Thacker,
1996). Goby fossils are scarce, but are not known from
earlier than the Eocene (Miller, 1973; Patterson, 1993).
Perciforms, the larger group of which Gobioidei is a
part, are not present prior to the upper Cretaceous
(80 million years ago; Patterson, 1993).
2. Materials and methods
Fresh and ethanol-preserved tissues for DNA sequencing were obtained from several sources (Table 2).
In most cases, only one individual of each species was
sequenced, largely due to the scarcity of available tissues. In ten cases two individuals were sequenced: Eleotris sandwicensis, Gnatholepis cauerensis, Amblygobius
phalaena, Microdesmus longipinnis, Risor ruber, Nemateleotris magnifica, Ptereleotris zebra, Pandaka lidwilli,
Ctenogobius saepepallens, and Kraemeria cunicularia.
Three individuals of Gnatholepis thompsoni were sequenced. When more than one individual was examined,
the sequences were very similar but not identical, and in
the phylogenetic hypothesis they were recovered together. Individuals of 67 species representing 51 genera
were sequenced; eight eleotridid and one xenisthmid
species were included, and the odontobutid Odontobutis
obscura was designated as the outgroup in the analysis.
A previous study of relationships of eleotrids (Hoese
and Gill, 1993) included morphological character data
that indicated that rhyacichthids and odontobutids are
the primitive sister taxa to other gobies, and that both
eleotridid subfamilies form an unresolved trichotomy
with the rest of Gobioidei.
Total genomic DNA was extracted from tissues using
the QIAquick Tissue Kit (Qiagen, Chatsworth, CA) and
quantified by running 5 ll of each extraction with 1 ll of
loading dye on a 1.5% low melting point agarose gel
stained with ethidium bromide. In some cases, for amplification of the ND1 and ND2 genes, hotstart XL
PCR was performed using primers L3827 and H6313
(Sorenson et al., 1999) and Taq rTth XL polymerase
with AmpliWax PCR Gems (Perkin–Elmer, Foster City,
CA). The PCR was performed with a profile of 94 °C for
5 min, followed by 16 cycles of 94 °C/30 s denaturation,
50–53 °C/20 s annealing and 70 °C/4 min extension, then
21 cycles of the same profile but with 30 additional
C.E. Thacker / Molecular Phylogenetics and Evolution 26 (2003) 354–368
Table 2
Species sequenced for this study
Species
Source
GenBank Accession Nos.
Odontobutidae
Odontobutis obscura
Akihisa Iwata, Japan
AF391330, AF391402, AF391474
Eleotridae: Eleotrinae
Eleotris sandwicensis
Erotelis smaragdus
Hypseleotris aurea
Hypseleotris compressa
Hypseleotris klunzingeri
Mogurnda adspersa
Ophieleotris aporos
Philypnodon grandiceps
Small bottom trap, stream, North Oahu, Hawaii
Bottom tow, Twin Cays, Belize
Peter Unmack, Gascoyne River, WA, Australia
Peter Unmack, Ross River, Qld., Australia
Peter Unmack, Barcoo River, Qld., Australia
Peter Unmack, Ross River, Qld., Australia
Peter Unmack, Ross River, Qld., Australia
Peter Unmack, Glenelg River, Vic., Australia
AF391333-4, AF391405-6, AF391477-8
AF391355, AF391427, AF391499
AF391392, AF391464, AF391536
AF391366, AF391438, AF391510
AF391393, AF391465. AF391537
AF391367, AF391439, AF391511
AF391368, AF391440, AF391512
AF391386, AF391458, AF391530
Xenisthmidae
Xenisthmus sp.
Mark Westneat, Santa Cruz Island, Solomon Islands
AF391372, AF391444, AF391516
Gobiidae: Gobionellinae
Acanthogobius flavimanus
Awaous guamensis
Chaenogobius annularis
Ctenogobius saepepallens
Eucyclogobius newberryi
Evorthodus minutus
Gillichthys mirabilis
Gnatholepis cauerensis
Scott Matern, Sacramento River Delta
Brent Tibbats, Guam
Ho Young Suk, Korea
Plankton tow, Carrie Bow Cay, Belize
CAS 86280; San Gregorio Creek, California
Jim Van Tassell, Mazatlan, Mexico
Nancy Aguilar, California
Quinaldine, Moorea, Society Islands
Gnatholepis scapulostigma
Gnatholepis thompsoni
Quinaldine, Moorea, Society Islands
Quinaldine, Carrie Bow Cay, Belize
Gobiopterus semivestita
Mugilogobius sp.
Mugilogobius rivulus
Pandaka lidwilli
Stenogobius hawaiiensis
Typhlogobius californiensis
Peter Unmack, Milingandi Creek, NSW, Australia
Brent Tibbats, Guam
Peter Unmack, Leaders Creek, NT, Australia
Tony Gill, Innes Park Creek, Qld., Australia
Brent Tibbats, Guam
Nancy Aguilar, California
AF391381, AF391453, AF391525
AF391338, AF391410, AF391482
AF391365, AF391437, AF391509
AY077595-6, AY077602-3, AY077609-10
AF391361, AF391433, AF391505
AY077593, AY077600, AY077607
AF391340, AF391412, AF391484
AF391364 & 75, AF391436 & 47,
AF391508 & 19
AF391376, AF391448, AF391520
AF391343-4, AF391415-6, AF391487-8,
AY077594, AY077601, AY077608
AF391387, AF391459, AF391531
AF391356, AF391428, AF391500
AY077592, AY077599, AY077606
AY077590-1, AY077597-8, AY077604-5
AF391349, AF391421, AF391493
AF391345, AF391417, AF391489
Gobiidae: Gobiinae
Amblyeleotris wheeleri
Amblygobius nocturnus
Amblygobius phalaena
Quinaldine, Moorea, Society Islands
Quinaldine, Moorea, Society Islands
Quinaldine, Moorea, Society Islands
Asterropteryx semipunctatus
Barbulifer ceuthoecus
Bathygobius cocosensis
Bathygobius curacao
Cabillus tongarevae
Callogobius sclateri
Coryphopterus dicrus
Coryphopterus hyalinus
Coryphopterus personatus
Coryphopterus punctipectophorus
Ctenogobiops feroculus
Eviota afelei
Fusigobius neophytus
Fusigobius signipinnis
Gobiodon histrio
Gobiosoma macrodon
Lophogobius cyprinoides
Priolepis cincta
Priolepis eugenius
Risor ruber
Valenciennea strigata
Quinaldine, Moorea, Society Islands
Quinaldine, Carrie Bow Cay, Belize
Quinaldine, Rangiroa, Tuamotu Atolls
Quinaldine, Pelican Cays, Belize
Quinaldine, Moorea, Society Islands
Quinaldine, Moorea, Society Islands
Kathleen Cole, Carrie Bow Cay, Belize
Kathleen Cole, Carrie Bow Cay, Belize
Kathleen Cole, Carrie Bow Cay, Belize
Kathleen Cole, Carrie Bow Cay, Belize
Quinaldine, Moorea, Society Islands
Quinaldine, Moorea, Society Islands
Quinaldine, Moorea, Society Islands
Mark Westneat, Santa Cruz Island,
Solomon Islands
Rob Reavis, Captive stock
Colette St. Mary, Florida
Kathleen Cole, Florida
Quinaldine, Moorea, Society Islands
David Greenfield, Hawaii
Colette St. Mary, Florida
Quinaldine, Moorea, Society Islands
AF391383, AF391455, AF391527
AF391379, AF391451, AF391523
AF391369 & 78, AF391441 & 50,
AF391513 & 22
AF391377, AF391449, AF391521
AF391353, AF391425, AF391497
AF391388, AF391460, AF391532
AF391354, AF391426, AF391498
AF391382, AF391454, AF391526
AF391390, AF391462, AF391534
AF391395, AF391467, AF391539
AF391326, AF391398, AF391470
AF391325, AF391397, AF391469
AF391396, AF391468, AF391540
AF391363, AF391435, AF391507
AF391391, AF391463, AF391535
AF391374, AF391446, AF391518
AF391370, AF391442, AF391514
AF391360, AF391432, AF391504
AF391348, AF391420, AF391492
AF391362, AF391434, AF391506
AF391385, AF391457, AF391529
AF391329, AF391401, AF391473
AF391351-2, AF391423-4, AF391495-6
AF391384, AF391456, AF391528
357
358
C.E. Thacker / Molecular Phylogenetics and Evolution 26 (2003) 354–368
Table 2 (continued)
Species
Source
GenBank Accession Nos.
Gobiidae: Oxudercinae
Periophthalmus barbarus
Pseudapocryptes elongatus
Scartelaos histophorus
Nancy Aguilar, Nigeria
CAS 90433, Yangon Fish Market, Myanmar
Nancy Aguilar, Australia
AF391339, AF391411, AF391483
AF391394, AF391466, AF391538
AF391346, AF391418, AF391490
Gobiidae: Amblyopinae
Odontamblyopus rubicundus
CAS 90432, Yangon Fish Market, Myanmar
AF391371, AF391443, AF391515
Gobiidae: Sicydiinae
Sicyopterus lagocephalus
Stiphodon elegans
Quinaldine, stream, Moorea, Society Islands
Brent Tibbats, Guam
AF391389, AF391461, AF391533
AF391350, AF391422, AF391494
Microdesmidae
Cerdale floridana
Gunnellichthys monostigma
Microdesmus bahianus
Microdesmus longipinnis
Plankton tow, Carrie Bow Cay, Belize
Yuji Ikeda, Japan
Plankton tow, Carrie Bow Cay, Belize
Richard Heard, Gulf Coast of Mississippi
AF391337, AF391409, AF391481
AF391373, AF391445, AF391517
AF391347, AF391419, AF391491
AF391341-2, AF391413-4, AF391485-6
Ptereleotridae
Nemateleotris magnifica
Ptereleotris microlepis
Ptereleotris monoptera
Ptereleotris zebra
Aquarium supplier
Quinaldine, Moorea, Society Islands
Aquarium supplier
Aquarium supplier
AF391327-8, AF391399-1400, AF391471-2
AF391380, AF391452, AF391524
AF391357, AF391429, AF391501
AF391358-9, AF391430-1, AF391502-3
Kraemeriidae
Kraemeria cunicularia
Akihisa Iwata, Japan
AF391331-2, AF391403-4, AF391475-6
Schindleriidae
Schindleria pietschmanni
Schindleria praematura
Plankton tow, Kaneohe Bay, Oahu
Plankton tow, Palmyra Atoll, Line Islands
AF391335, AF391407, AF391479
AF391336, AF391408, AF391480
Unless otherwise indicated, tissues were collected by the author and where known the collection method is indicated. CAS indicates the specimen
was from the tissue collection of the California Academy of Sciences, San Francisco; other species are uncataloged holdings of the Natural History
Museum of Los Angeles County. Species are grouped by family and subfamily, and separate GenBank accession numbers are given for each gene.
seconds of extension added at each step. These long
( 2500 bp) fragments were quantified on a 1.5% low
melting point agarose gel stained with ethidium bromide, bands were visualized and photographed under
UV light, cut from the gel and DNA purified from the
bands using the QIAquick gel extraction kit (Qiagen,
Chatsworth, CA). The long PCR fragments were used as
template for four shorter PCR reactions using the primer pairs: L3827/H4644; L4500/H5191; L5219/H5766;
and L5758/H6313 (Sorenson et al., 1999). These amplifications were performed with AmpliTaq or AmpliTaq
Gold DNA polymerase (Perkin–Elmer, Foster City,
CA). PCR was performed with a profile of 94 °C for
3 min, followed by 35 cycles of 94 °C/15 s denaturation,
50–55 °C/20 s annealing and 70 °C/1 min extension.
In other cases, particularly amplifications of the COI
gene, PCR reactions were performed directly from genomic DNA with the goby-specific primers listed in
Table 3, using the enzymes and PCR profile given
above. PCR products were run out on a low melting
point agarose gel, visualized and photographed, then cut
out and purified with the QIAquick kit. Using the same
primers (1 lM rather than 10 lM solution) the short
PCR fragments were cycle sequenced using rhodamine
dye terminator/Taq FS or Big Dye terminator ready
reaction kits (Perkin–Elmer, Foster City, CA) and run
on an ABI 377XL automated sequencer. Both the heavy
and light strands were sequenced separately for each
short PCR fragment. The resultant chromatograms for
the heavy and light strands were reconciled in Sequence
Navigator (Perkin–Elmer, Foster City, CA), or Sequencher (Gene Codes, Ann Arbor, MI) to check
basecalling, translated to amino acid sequence using the
universal mtDNA code, and aligned by eye. There were
no ambiguities or gaps in the alignment; all the gaps
present in the final matrix were due to missing data and
Table 3
Goby-specific primers used for amplification of ND1, ND2, and COI
genes
Primer
Sequence
GOBYL3543
GOBYH4389
GOBYL4201
GOBYH4937
GOBYL4919
GOBYH5513
GOBYL5464
GOBYH6064
GOBYL6468
GOBYH7127
GOBYL7059
GOBYH7696
GOBYL7558
GOBYH8197
GCAATCCAGGTCAGTTTCTATC
AAGGGGGCYCGGTTTGTTTC
GTTGCMCAAACMATTTCHTATGAAG
GGGGTATGGGCCCGAAAGC
CCCATACCCCGAAAATGATG
GAGTAGGCTAGGATTTTWCGAAGYTG
GGTTGAGGRGGCCTMAACCARAC
CTCCTACTTAGAGCTTTGAAGGC
GCTCAGCCATTTTACCTGTG
ACYTCTGGGTGACCAAAGAATC
CCCTGCMGGTGGAGGAGACCC
AGGCCTAGGAAGTGTTGAGGGAAG
TTTGCWATTATGGCWGGATTTG
ATTATTAGGGCGTGGTCGTGG
All primers are given in the 50 –30 direction.
C.E. Thacker / Molecular Phylogenetics and Evolution 26 (2003) 354–368
359
Fig. 1. Molecular phylogeny of Gobioidei. This hypothesis is based on the complete sequence of three mitochondrial genes (ND1, ND2, and COI), a
total of 3573 bp, of which 2012 were parsimony-informative. The length is 30,268 steps, with a CI of 0.159, a RI of 0.416 and a RC of 0.066. Numbers
on nodes indicate decay index values, and roman numerals indicate clades mentioned in the text. Brackets on the right side indicate familial and
subfamilial classification: species are classified into the top grouping unless otherwise indicated with boldface or asterisks to the right of the name.
Note that in many cases, these bracketed groups are not monophyletic, they serve merely to identify the current classification of included species.
360
C.E. Thacker / Molecular Phylogenetics and Evolution 26 (2003) 354–368
treated as such (as ? rather than a new character state) in
the analysis. A three base pair indel (AAC) was present
just prior to the stop codon at the end of the ND1 gene
in O. obscura; because this indel was present in none of
the other taxa (autapomorphic), it was removed from
the matrix for analysis rather than introducing gaps in
all other species. Aligned nucleotide sequences were
exported from Sequencher as NEXUS files.
All parsimony analyses were performed using
PAUP*, version 4.0b4a (Swofford, 1998). One thousand
replications of a heuristic search were run, using TBR
branch swapping. The data were designated as equally
weighted, following K€
allersj€
o et al. (1999) and Broughton et al., 2000). Decay indices (Bremer, 1988) were
calculated with PAUP* and TreeRot v.2 (Sorenson,
1999). O. obscura was designated the outgroup taxon
and used to root the tree. As described above, morphological evidence indicates that this is the most
primitive of the taxa considered. The molecular data
were not partitioned into separate genes for analysis; all
data were combined in a total evidence analysis, such
that the resultant hypothesis best explains all the data
(Barrett et al., 1991; Brower, 1996; Eernisse and Kluge,
1993; Kluge, 1998; Nixon and Carpenter, 1996) and
because it has been shown that homoplasy or misleading
signal takes a more complicated pattern than can be
represented in process partitions such as separate genes
(DeSalle and Brower, 1997; Siddall, 1997).
3. Results
Of the 3573 bp that make up the ND1, ND2, and
COI genes, most were successfully sequenced for most
taxa. Small gaps in the sequence, due to uncertainties in
reading or reconciling the chromatograms, are present
in the sequences for Acanthogobius flavimanus, Asterropteryx semipunctatus, Bathygobius curacao, Cerdale
floridana, Erotelis smaragdus, Eucyclogobius newberryi,
Eviota afelei, Evorthodus minutus, Gobiosoma macrodon,
Mugilogobius sp., Priolepis eugenius, Stenogobius hawaiiensis, Stiphodon elongatus, and Valenciennea strigata, one of the three G. thompsoni, one of the two N.
magnifica, and both of the two C. saepepallens. Larger
gaps, caused by failure to amplify one of the seven short
PCR fragments, are present in sequences for A. flavimanus, Amblygobius nocturnus, A. semipunctatus, Awaous
guamensis, Bathygobius cocosensis, B. curacao, Barbulifer ceuthoecus, Cabillus tongarevae, Callogobius sclateri, Chaenogobius annularis, E. smaragdus, E. afelei,
Fusigobius neophytus, F. signipinnis, Gobiopterus semivestita, G. macrodon, Gunnellichthys monostigma, Lophogobius cyprinoides, Odontamblyopus rubicundus, O.
obscura, Ophieleotris aporos, Priolepis cincta, P. eugenius, Pseudapocryptes elongatus, Ptereleotris microlepis,
P. monoptera, Schindleria praematura, S. hawaiiensis,
and V. strigata, both specimens of C. saepepallens, K.
cunicularia, P. lidwilli, and P. zebra and one of the two
specimens sequenced for A. phalaena, E. sandwicensis,
M. longipinnis, N. magnifica, and R. ruber. In no case did
a sequence have more than 40% missing data, and all
but five had less than 30% missing data. Missing data
were indicated by gaps in the data matrix and coded as
missing data (?) rather than new states.
A single most parsimonious cladogram was obtained
from parsimony analysis of the aligned nucleotide sequences (Fig. 1). This phylogeny has a length of 30,268
steps (2012 of 3573 characters were informative), consistency index of 0.159, retention index of 0.416 and
rescaled consistency index of 0.066. Decay indices indicate strong support for most nodes, ranging from one
for the clade containing Ptereleotridae, Schindleriidae,
G. monostigma, and Fusigobius signipinnis, to 292 between species of Schindleria. Most decay index values
ranged from 4 to 53.
4. Discussion
4.1. Odontobutidae, Eleotridae, and Xenisthmidae
The molecular phylogenetic hypothesis supports the
monophyly of a large group consisting of the gobioid
families Microdesmidae, Ptereleotridae, Kraemeriidae,
Gobiidae, and Schindleriidae to the exclusion of Eleotridae, Xenisthmidae and Odontobutidae (clade I in Fig.
1). Morphological character evidence concurs with this
grouping; Microdesmidae, Ptereleotridae, Kraemeriidae, Gobiidae, and Schindleriidae all have five branchiostegal rays, rather than six as seen in
Rhyacichthyidae, Eleotridae, Odontobutidae, and Xenisthmidae. The five families lacking the anterior branchiostegal ray are also hypothesized to be more derived
than the remaining families based on characters including loss of the endopterygoid and dorsal postcleithrum, absence of infraorbitals, lack of ossification in
the scapula (in most species) and separation of the
oculoscapular sensory canal into anterior and posterior
portions (Akihito, 1986; Hoese, 1984). All of these
characters have some variation in their distribution but
are mostly restricted to the five most derived families
and exemplify the typical pattern in gobies: losses and
reductions are generally found in derived taxa.
The phylogenetic hypothesis is rooted with a single
odontobutid, O. obscura, so the monophyly of Odontobutidae could not be assessed. Hoese and Gill (1993)
provide characters diagnosing a group consisting of all
gobioids except Odontobutidae and Rhyacichthyidae:
expansion of the procurrent cartilages anteriad to support the anterior procurrent caudal rays; scapula reduced, such that dorsalmost pectoral radial extends past
scapula and often extends to cleithrum; two radials
C.E. Thacker / Molecular Phylogenetics and Evolution 26 (2003) 354–368
(rather than three) in the pterygiophore of the first element of the second dorsal fin; and absence of transforming cteni on the scales. Within the clade of gobioids
exclusive of Odontobutidae and Rhyacichthyidae, the
family Eleotridae (subfamily Eleotridinae; no members
of Butinae were included) is paraphyletic with respect
not only to Xenisthmidae but also to the rest of the
gobioid families examined. Hoese and Gill (1993) named
the family Odontobutidae, delineated the subfamilies
Eleotridinae and Butinae within Eleotridae and diagnosed Eleotridinae based on attachment of the adductor
mandibulae tendon on the shaft of the maxilla rather
than to a process at the anterior end, and posterior expansion of the procurrent cartilages over the tips of the
epurals. Of the eleotridines examined, not all of the
groups delineated by Birdsong et al. (1988) are monophyletic. Members of the Eleotris (Eleotris and Erotelis)
and Gobiomorphus (Mogurnda and Philypnodon) groups
(neither diagnosed by a synapomorphy) do not group
together. Miller (1998) synonomized Eleotris and Erotelis, based on several morphological characters the two
share; they differ morphologically only in scale size, but
in the molecular hypothesis a group containing both
genera would be paraphyletic. O. aporos is the only
member of the Dormitator group examined; this group
diagnosed by a strongly recurved first hemal spine that
almost touches the second, and in the molecular hypothesis, is the sister taxon to the Gobiomorphus group
member Mogurnda. There is especially strong support
(decay index value of 101) for a monophyletic genus
Hypseleotris. The Hypseleotris group, containing Hypseleotris and Hemieleotris, is distinguished by possessing
a cyprinid-like body shape with an elongate body cavity
and a high number (8–11) of anal pterygiophores preceding the first hemal spine (Birdsong et al., 1988); in the
molecular hypothesis this group is sister to the other
Gobiomorphus group member, Philypnodon.
The only included member of the family Xenisthmidae examined, Xenisthmus sp., is nested within the paraphyletic Eleotridinae, sister to the pair of species
Mogurnda adspersa and O. aporos. The family Xenisthmidae comprises one of Birdsong et al.Õs (1988)
groups, the Xenisthmus group, diagnosed by several
characters: an ossified rostral cartilage; ventral lip with
free ventral margin extending across dentary symphysis;
ascending process of premaxilla greatly reduced or absent; and basibranchial two absent (Springer, 1983,
1988). All but the first two characters are reductive
features for xenisthmids; in addition, some xenisthmids
have also lost the pterosphenoids and basibranchials 3
and 4, and in the miniature Tyson (20 mm standard
length or less) the spinous dorsal fin, extrascapulars,
lacrimal, exoccipital condyles, infrapharyngobranchials
2 and 4, gill rakers and scales are also absent (Gill and
Hoese, 1993; Springer, 1983, 1988). Xenisthmidae is one
example of reduction among gobioids, exhibiting a
361
mosaic of reductive and non-reductive morphological
characters.
Akihito et al. (2000) performed a molecular phylogenetic analysis, in which sampling was concentrated in
Eleotridae (including both Eleotridinae and Butinae of
Hoese and Gill, 1993), but which also included representatives of Xenisthmidae, Odontobutidae, Gobiidae,
Kraemeriidae, Microdesmidae, and Ptereleotridae.
Their analysis included the 1140 bp of the mitochondrial
cytochrome b gene, and was not cladistic; instead, they
produced unrooted networks using both neighbor-joining and maximum likelihood methods. They did not
consider the relationships of each species as revealed in
their analysis, rather subdividing their sampled taxa into
six ‘‘clusters,’’ each containing two to eight species, plus
the pair O. obscura and Xenisthmus sp. The results
presented in their trees agree with the current analysis in
some respects, including that Eleotridae is paraphyletic
and Mogurnda and Ophieleotris are closely related. Their
hypotheses disagree with this one in the placement of
Xenisthmus: it is sister taxon to Odontobutis in their
hypothesis, within Eleotridae here. Wang et al.Õs (2001)
molecular hypothesis, based on cladistic analysis of
1078 bp of the mitochondrial 12S and tRNAVAL genes,
shows a monophyletic Eleotridinae. Within it, their
hypothesis agrees with this one in some respects, including a monophyletic Hypseleotris, and a sister taxon
relationship between Mogurnda and Ophieleotris. However, Wang et al.Õs (2001) hypothesis differs from this
one in the relationships among the genera Hypseleotris,
Eleotris, and Philypnodon. In their hypothesis, Hypseleotris is sister to the pair Eleotris + Philypnodon, unlike
this hypothesis which indicates that Hypseleotris and
Philypnodon are sisters, to the exclusion of Eleotris.
4.2. Gobionellinae, Kraemeriidae, Sicydiinae, Oxudercinae, and Amblyopinae
The molecular phylogeny includes a clade consisting
of Gobionellinae, Kraemeriidae, Sicydiinae, Oxudercinae, and Amblyopinae (clade II in Fig. 1; here this clade
is referred to as the ‘‘expanded monophyletic gobionelline clade’’ or ‘‘expanded monophyletic Gobionellinae’’;
when the term Gobionellinae is used alone it is sensu
Pezold, 1993). Within the expanded monophyletic
gobionelline clade, two smaller clades are present: one
containing both Mugilogobius species, Gillichthys mirabilis, Typhlogobius californiensis, C. annularis, E. newberryi, A. flavimanus, G. semivestita, P. lidwilli, and the
kraemeriid K. cunicularia (clade IIA in Fig. 1). In LarsonÕs (2001) revision of Mugiligobius and evaluation of
relationships among selected gobionelline genera, all of
these species are placed in her ‘‘Mugilogobius clade’’
except Acanthogobius (incertae sedis within Gobionellinae) and Kraemeria (not examined) Sister to this clade is
one (clade IIB in Fig. 1) containing three smaller clades,
362
C.E. Thacker / Molecular Phylogenetics and Evolution 26 (2003) 354–368
one including A. guamensis, S. hawaiiensis, and the sicydiines Stiphodon elegans and Sicyopterus lagocephalus,
and sister to that group a clade containing the three
Gnatholepis species examined, G. thompsoni, G. scapulostigma, and G. cauerensis, as well as C. saepepallens
and E. minutus. A close relationship between the sicydiines, Awaous and Stenogobius has been postulated
previously; they have been included together in HarrisonÕs (1989) ‘‘Ctenogobius lineage,’’ and in the ‘‘Stenogobius clade’’ of Larson (2001). Awaous and
Stenogobius were also shown to be closely related to
Sicydiinae by Parenti and Thomas (1998). Sister to both
these clades is a clade including the amblyopine O. rubicundus, and the oxudercines Scartelaos histophorus, P.
elongatus, and Periophthalmus barbarus. These genera
are all included in HarrisonÕs (1989) ‘‘Oxyurichthys
lineage’’; Murdy (1989) and Murdy and Shibukawa
(2001) also indicated that Oxudercinae and Amblyopinae are probably closely related.
Within clade IIA, the Gobionellus group member
Mugilogobius is basal to representatives of a mix of
Birdsong et al.Õs (1988) Chasmichthys, Gobiopterus,
Astrabe, and Acanthogobius groups and Krameriidae
(Kraemeria group). Three of the species (G. mirabilis, C.
annularis, and E. newberryi) are members of the Chasmichthys group, a group diagnosed by insertion of the
first dorsal spine into interneural space 4 or 5, and
whose members also feature high vertebral counts
ð13 17 þ 18 22 ¼ 32 38Þ and a temperate northern Pacific distribution. In this hypothesis the Chasmichthys group is paraphyletic with respect to the
Astrabe (T. californiensis) group; Astrabe group genera
share reduced eyes and posterior displacement or loss of
the spinous dorsal fin, and are distributed in the same
regions as the Chasmichthys group. The Acanthogobius
group (A. flavimanus), is sister to the Gobiopterus group
(P. lidwilli and G. semivestita), which is itself paraphyletic with respect to Kraemeriidae. Acanthogobius group
genera share a unique dorsal fin pterygiophore pattern:
3-1221110, and are found in the temperate western Pacific. The Gobiopterus group is not diagnosed but
members share a 10 þ 15 ¼ 25 vertebral count and are
restricted to the Indian Ocean and Indo-Pacific regions
(the species sequenced, G. semivestita, is a temperate
Australian estuarine goby). Thus, the four groups are all
distributed in the temperate margins of the Pacific and
Indian Oceans. Kraemeriidae is also distributed
throughout the western Pacific. Kraemeriids attain a
maximum length of 40 mm and exhibit reduced characters such as three pectoral radials (rather than four), a
single epural, fusion of all the hypurals into a single
plate and all skeletal elements slender and weakly ossified (Matsubara and Iwai, 1959). With the exception of
the reduction in pectoral radials, all of these reductive
characters are present in other gobioids. Akihito et al.Õs
(2000) molecular analysis placed Kraemeria in a cluster
with the microdesmid Gunnellichthys and the ptereleotrid Ptereleotris. The disagreement between Akihito et
al.Õs (2000) hypothesis and this one is probably due to
sampling: they did not include any gobiine gobiids in
their hypothesis.
The other clade within the expanded monophyletic
Gobionellinae, clade IIB, includes the gobioid subfamilies Sicydiinae, Oxudercinae and Amblyopinae. Within
clade IIB is a clade containing the Gobionellus group
members Gnatholepis and Ctenogobius in addition to
Evorthodus, a genus not classified by Birdsong et al.
(1988), but there indicated to possibly be related to
Gobionellus group genera. Awaous, Stenogobius, and the
sicydiines S. elegans and S. lagocephalus are also included in this clade; Stenogobius is in the Gobionellus
group, and the remaining three genera are included in
Birdsong et al.Õs (1988) Sicydium group. The Gobionellus
group contains ten genera, phenetically united by a
combination of dorsal fin, vertebral and caudal fin
characters, and is distributed broadly through the tropics and subtropics. Birdsong et al. (1988) indicate that
although the group contains marine representatives,
most members are found in estuarine or freshwater.
Morphological evidence for the close relationship of
Sicydiinae and Gobionellus group genera is found in the
palatopterygoquadrate complex in the suspensorium, as
described by Harrison (1989). Harrison describes several
apomorphic conditions of the palatine, ectopterygoid
and quadrate; Awaous, Stiphodon, Sicyopterus, Stenogobius, Gnatholepis, Evorthodus, and Ctenogobius are
all part of a group characterized by a long palatine,
which extends towards or meets the quadrate. Awaous,
Stiphodon, and Sicyopterus additionally share similarities in external morphology and skeletal characters including a spatulate posterior process on the pelvis.
Sicydiinae is diagnosed by several morphological characters: palatine bone with long dorsal process that articulates with the lateral ethmoid, no differentiation
between articular and ascending processes on the premaxilla, tongue fused to floor of mouth, thick, branched
pelvic rays; pads at the tips of the pelvic spines, and the
proximal ends of the pelvic spine and first pelvic ray
close together, and separated by a gap from the other
pelvic rays; in all genera except Sicyopus the upper jaw
teeth are tricuspid and found in several rows (Harrison,
1989; Hoese, 1984; Parenti and Maciolek, 1993). The
two sicydiines considered in this analysis are sister taxa,
and Sicydiinae is sister to the pair S. hawaiiensis and A.
guamensis. The relationship of Awaous to the sicydiines
has been debated: Harrison (1989) considers Awaous to
be the sister taxon to Sicydiinae based on the presence of
the spatulate posterior pelvic process, the lack of an
ossified scapula, a long palatine, a dorsal fin pterygiophore pattern of 3-12210, a single epural, and similar
head neuromast patterns. All but the spatulate pelvic
process are found in other goby groups; the spatulate
C.E. Thacker / Molecular Phylogenetics and Evolution 26 (2003) 354–368
pelvic process is also seen in the gobionelline Tukugobius, and although Birdsong et al., 1988) place Awaous
in the Sicydium group, they mention that one author
believes Awaous to be closely related to the Gobionellus
group (including Mugilogobius, Stenogobius, Gnatholepis, and Ctenogobius). LarsonÕs (2001) hypothesis concurs with this one in that Awaous and Stenogobius are
sister taxa, as well as Evorthodus and Gnatholepis (she
did not consider Ctenogobius or the sicydiines). Parenti
and Thomas (1998)Õs cladistic analysis of morphology
indicates the the sister taxa to Sicydiinae are Tukugobius
and Rhinogobius, and the next most proximal sister taxa
are a trichotomy of Awaous, Gnatholepis, and Stenogobius, followed by Evorthodus and the oxudercine
Pseudapocryptes. Tukugobius and Rhinogobius were not
included in this molecular analysis, but overall, the results accord well with Parenti and Thomas (1998), and
in broad respects with Harrison (1989). Unlike Harrison
(1989), the molecular phylogeny indicates that Stenogobius is included in the clade with Awaous and the
sicydiines, and there are also differences between interpretations of the placement of HarrisonÕs (1989) ÔCtenogobius lineage.Õ This molecular analysis concurs with
previous morphological studies (Harrison, 1989; Parenti
and Thomas, 1998) in the conclusion that Gobionellinae
is paraphyletic with respect to Sicydiinae.
Gnatholepis and Ctenogobius are part of the ÔCtenogobius lineageÕ of Harrison (1989), and additionally
share anteroposteriorly elongate quadrate lamina as well
as the elongate palatine; the molecular hypothesis indicates that these genera are closely related, specifically
that Gnatholepis is sister to Ctenogobius plus Evorthodus.
Harrison (1989) also indicates that Gnatholepis, Ctenogobius, Evorthodus, and Stenogobius share a similar
arrangement of suborbital neuromasts. The molecular
hypothesis differs from the hypothesis presented by
Harrison (1989), in which Stenogobius is the primitive
sister taxon to a clade containing the ÔCtenogobius lineageÕ and his ÔOxyurichthys lineage,Õ and Awaous and the
Sicydiinae are sister to that clade. Instead, the molecular
data indicate that the ÔCtenogobius lineageÕ genera are
sister to a Stenogobius/Awaous/Sicydiine clade. The
disagreement may be due in large part to rooting. If
HarrisonÕs (1989) hypothesis is rooted in the same way
as the expanded monophyletic gobionelline clade (clade
II in Fig. 1), between the ÔCtenogobius lineageÕ and
ÔOxyurichthys lineage,Õ the results are in agreement with
the molecular phylogeny, with one small exception:
Stenogobius would be sister to Awaous + Sicydiinae in
HarrisonÕs (1989) hypothesis, but Stenogobius + Awaous
is sister to Sicydiinae in the molecular hypothesis.
HarrisonÕs (1989) ÔOxyurichthys lineageÕ includes the
gobionelline genus Oxyurichthys, and the subfamilies
Oxudercinae and Amblyopinae; this group shares the
presence of a very short, stubby palatine, and he hypothesizes that it is the sister to the ÔCtenogobius lineage.Õ
363
His hypothesis requires that the long palatine is reversed
in the ÔOxyurichthys lineageÕ; in the molecular hypothesis, the taxa with long palatines are closely related, to the
exclusion of the ÔOxyurichthys lineageÕ taxa, implying
that the short palatine was derived independently and
not secondarily lost. In the molecular hypothesis, Oxudercinae is paraphyletic with respect to Amblyopinae.
In addition to the short palatine configuration described by Harrison (1989), Amblyopinae and Oxudercinae share a tongue fused to the floor of the mouth
(also seen in Sicydiinae but considered a homoplasy by
Parenti and Maciolek (1993)) and elongation of the
frontal bones (Hoese, 1984; Murdy, 1989). Amblyopines
are elongate, burrowing fishes found in estuaries and
river mouths with extremely reduced, dorsally placed
eyes. Oxudercines are commonly known as mudskippers; they inhabit soft bottomed and mangrove swamp
habitat in the Indo-Pacific and West Africa and many
species are capable of aerial respiration and terrestrial
locomotion. A cladistic hypothesis of relationships has
been presented for Oxudercinae (Murdy, 1989). In
MurdyÕs hypothesis Oxudercinae is diagnosed by five
characters including a complex arrangement of the
dorsal neurocranial bones and eyes (including the large
lateral sphenotic process and anterodorsally placed eyes,
characters used to diagnose Oxudercinae by Hoese,
1984), extension of the anterior nostril into a flap that
overlaps the upper jaw, venteroposterior process of
palatine greatly reduced (this describes the same condition that Harrison (1989) calls a short, stubby, palatine),
reduced and vertically oriented ascending processes of
the premaxilla, and a single (or rarely two) anal-fin
pterygiophore anterior to the first hemal spine (this
character is not unique to Oxudercinae). Part of the
complex neurocranial character is the elongation of the
frontal bones that is observed to a lesser extent in Amblyopinae, and two amblyopine genera (Brachamblyopus
and Trypauchen) share another of the diagnostic oxudercine characers, the reduction of a venteroposteriorly
directed process on the palatine that overlaps or joins
the ectopterygoid, as well as a similar dorsal fin pterygiophore formula. However, Murdy did not propose a
close relationship between Oxudercinae and Amblyopinae; instead, he noted similarities between Oxudercinae,
Sicydiinae and several gobionelline genera including
Ctenogobius, Gnatholepis, Mugilogobius, Oxyurichthys,
and Evorthodus. In contrast to MurdyÕs analysis, the
molecular hypothesis indicates that Oxudercinae is paraphyletic with respect to Amblyopinae.
The molecular hypothesis also disagrees with MurdyÕs
placement of genera within Oxudercinae. Murdy gives
the following relationship: (Pseudapocryptes (Scartelaos
and Periophthalmus)), an arrangement which is not
congruent with the molecular hypothesis placement of
Periophthalmus plus Pseudapocryptes as sister to the pair
Scartelaos plus the amblyopine Odontamblyopus. As
364
C.E. Thacker / Molecular Phylogenetics and Evolution 26 (2003) 354–368
with the differences between the Harrison (1989) hypothesis and this one, the disagreement may partially be
attributed to a different rooting of the oxudercine clade.
Murdy (1989) postulated that Evorthodus was most closely related to Oxudercinae based on three characters of
the teeth, branchial apparatus and the retractor dorsalis
muscle; Evorthodus was used as the proximal outgroup,
along with the sicydiines Sicydium and Stiphodon, the
Gobionellus group gobionellines Gnatholepis, Ctenogobius, Mugilogobius, and Oxyurichthys, and the amblyopines Trypauchen, Brachamblyopus, and Gobioides.
Oxyurichthys was not examined in this study, and the
sampling within Sicydiinae and Amblyopinae differs, but
the molecular phylogenetic hypothesis supports a sister
taxon relationship between Oxudercinae + Amblyopinae
and a clade containing Gnatholepis, Ctenogobius, Evorthodus, Awaous, Stenogobius and the sicydiines Sicyopterus and Stiphodon. The different relationships within
Oxudercinae obtained in the molecular hypothesis do
not substantially change interpretation of the evolution
of some of MurdyÕs (1989) characters. Murdy interpreted
the reduction in the ascending process of the premaxilla
(his character 4) as being primitively absent (process not
reduced), then present (reduced) in Pseudapocryptes and
Scartelaos, then secondarily lost (process regained) in
Periophthalmus. The molecular hypothesis supports
similar interpretation: the process is primitively present,
then reduced in Pseudapocryptes and Scartelaos, and
retained or regained in Periophthalmus. Similarly, Murdy
(1989) discussed characters of the branchial apparatus
and jaws (large, lattice-like fifth ceratobranchials, dorsal
rather than lateral articulation of the epibranchials to the
infrapharyngobranchials and large, recurved canine
teeth internal to the symphysis of the lower jaw) that are
not coded in his phylogenetic analysis but are shared by
Evorthodus and all Oxudercinae except Periophthalmus
and Periophthalmodon. He interpreted retention of the
more generalized state in Periophthalmus and Periophthalmodon as a reversal to the primitive condition; in the
molecular hypothesis the optimization of these characters is more ambiguous and difficult to assess without
denser sampling within Oxudercinae, but suggests that
the conditions in Evorthodus and most oxudercines are
independently derived. Thus, the molecular hypothesis
supports MurdyÕs (1989) conjecture that the similarities
in branchial structure and dentition between Evorthodus
and most Oxudercines may be due to convergence; both
occupy soft bottomed habitats and may use the teeth for
burrowing and the complex branchial structures for
straining out ingested substrate.
Some of MurdyÕs characters obtain a less parsimonious interpretation on the molecular phylogeny. Periophthalmus and Scartelaos are both amphibious and
also share a character of the metapterygoid, a dermal
cup that functions as a moisture reservoir for the eyes,
and separate dorsal fins (his characters 24–27). The
molecular hypotheses indicates that these characters
were either derived independently in Periophthalmus and
Scartelaos, or primitively present and lost in Pseudapocryptes and the amblyopine Odontamblyopus. Murdy
(1989) also pointed out that Oxudercinae shares with
both the Gobionellus group and the Sicydium group the
same vertebral number ð10 þ 16 ¼ 26Þ and dorsal fin
formula (3-12210). In the molecular hypothesis these
characters diagnose the expanded monophyletic gobionelline clade, and are altered in clade IIA exclusive of
Mugilogobius. The Acanthogobius, Astrabe, and Chasmichthys group genera in clade IIA (Acanthogobius,
Eucyclogobius, Chaenogobius, Gillichthys, and Typhlogobius) are somewhat to very elongate, with elevated
vertebral counts and often with posterior displacement
of the dorsal fin. The Gobiopterus group genera (Gobiopterus and Pandaka) and Kraemeria have similar, but
not identical, dorsal fin and vertebral characters as
compared to Oxudercinae, Sicydiinae, and the Gobionellus group. The major conclusion to be drawn from
the analysis of Oxudercinae and Amblyopinae in this
analysis is that Amblyopinae is nested within Oxudercinae and both are within a paraphyletic Gobionellinae. Akihito et al.Õs (2000) molecular analysis also
supported a close relationship between Oxudercinae,
Amblyopinae, within a paraphyletic Gobionellinae, but
their sampling in these groups (single representatives of
both Oxudercinae and Amblyopinae) is not dense enough to address the question of Oxudercine paraphyly.
Wang et al.Õs (2001) molecular hypothesis agrees well
with this one: they hypothesize that the Gobiopterus
group genera are sister to Oxudercinae, which is sister to
the pair Sicydiinae plus Stenogobius.
4.3. Gobiinae,
Schindleriidae
Microdesmidae,
Ptereleotridae,
and
The molecular phylogeny indicates an expanded
monophyletic Gobiinae, including Microdesmidae,
Ptereleotridae, and Schindleriidae (clade III in Fig. 1;
here this clade is referred to as the ‘‘expanded monophyletic gobiine clade’’ or ‘‘expanded monophyletic
Gobiinae’’; when the term Gobiinae is used alone it is
sensu Pezold, 1993). Monophyly of Gobiinae is supported by the presence of a single anterior interorbital
pore (rather than a pair of pores) and a single epural;
most gobiines also share a dorsal fin pterygiophore
pattern of 3-22110 or 3-221100 (Pezold, 1993). Two
epurals are found in most gobionellines, oxudercines
and amblyopines, but kraemeriids and most sicydiines
have only one. Members of Microdesmidae and Ptereleotridae have single epurals; in Schindleriidae epurals
are absent. Dorsal fin pterygiophore patterns vary
among these three families, and only in some Ptereleotridae (Parioglossus group) is the gobiine pattern of 322110 found (Birdsong et al., 1988). The single anterior
C.E. Thacker / Molecular Phylogenetics and Evolution 26 (2003) 354–368
interorbital pore characteristic of gobiines is found only
in some ptereleotrine genera; other ptereleotrines have a
pair of pores (Klausewitz and Conde, 1981; Randall and
Allen, 1973; Randall and Hoese, 1985; Rennis and
Hoese, 1985, 1987). Microdesmidae and Schindleriidae
lack head sensory pores entirely.
Most of the gobiine genera sampled for the molecular
phylogeny are part of Birdsong et al.Õs (1988) Priolepis
group. The Priolepis group is a large assemblage (54
genera) of reef-dwelling gobies that primarily inhabit the
Indo-Pacific but are also found in the eastern Pacific,
Caribbean, and Atlantic. This group is diverse and
phenetically united by the dorsal fin formula of 3-22110,
one epural, two anal-fin pterygophores preceding the
first hemal spine, and vertebral counts of 10 þ 16 ¼ 26.
Priolepis group genera included in this hypothesis are
Amblyeleotris, Amblygobius, Asterropteryx, Cabillus,
Callogobius, Coryphopterus, Ctenogobiops, Eviota, Fusigobius, Gobiodon, Lophogobius, Priolepis, and Valenciennea. Other gobiid groups included in the molecular
phylogeny are Bathygobius (genus Bathygobius) and
Gobiosoma (genera Barbulifer, Gobiosoma, and Risor);
along with the Priolepis group, these groups include
most gobiine genera (the Gobius, Kellogella, Microgobius, and Pomatoschistus groups are not considered;
these four groups include eleven genera). Four Coryphopterus species and two species each of the genera
Amblygobius, Bathygobius, Fusigobius, and Priolepis are
included, and in all cases except Fusigobius the genera
are monophyletic. The molecular phylogeny indicates
that the Priolepis group is paraphyletic with respect to
Bathygobius group, Gobiosoma group, and the families
Microdesmidae, Ptereleotridae, and Schindleriidae.
The most basal clade in the expanded Gobiinae (clade
IIIA of Fig. 1) includes Priolepis, Cabillus, and Bathygobius. The Bathygobius group differs from the Priolepis
group in vertebral number (Bathygobius group genera
usually have one more caudal vertebra, for a count of
10 þ 17 ¼ 27). Bathygobius is widely distributed in
tropical waters; one old world (B. cocosensis) and one
new world (B. curacao) species are included in the molecular hypothesis. A close relationship between Bathygobius and Cabillus is additionally supported by the
hypothesis of Gill (1994); both genera share a morphological character, presence of paired lateral protuberances near the anterior nostrils.
Two large clades comprise the rest of the expanded
monophyletic Gobiinae: one containing several Priolepis
group genera as well as Ptereleotridae, Schindleriidae
and some Microdesmidae (clade IIIB of Fig. 1), and a
second including the remainder of Microdesmidae, the
Gobiosoma group genera and two Priolepis group genera, Coryphopterus and Lophogobius (clade IIIC of Fig.
1). Interestingly, these clades differ in the geographical
distribution of their members: clade IIIB includes genera
found in the old world, and clade IIIC genera are all new
365
world (except Priolepis, which is also found in the Atlantic; the only other new world representative in the
expanded monophyletic Gobiinae is one of the Bathygobius species, found in clade IIIA).
Within the expanded monophyletic gobiine clade,
Ptereleotridae is nested within clade IIIB and Microdesmidae is split between clade IIIB and IIIC. These
groups have been previously placed as subfamilies in the
same family (Hoese, 1984), a grouping which neither
this molecular analysis nor morphological phylogeny
(Thacker, 2000) supports. The character previously used
to unite these groups is the presence of an elongate,
posterior process on the pelvis; such a process is present
in Ptereleotridae but not Microdesmidae. Other characters used to diagnose a Ptereleotridae + Microdesmidae clade, including unfused pelvic fins, lateral
compression of the head and body, a single epural and
reduction of the articulation between the palatine and
lateral ethmoid, are widely distributed and plesiomorphic among gobioids (Thacker, 2000). The molecular
phylogeny indicates not only that Microdesmidae and
Ptereleotridae are not sister taxa, but also that neither
family is monophyletic. A nonmonophyletic Ptereleotridae is a result that conflicts with previous morphological analyses. Rennis and Hoese (1987) provided
several diagnostic characters for the family: the elongate
pelvic process, a single pterygiophore preceding the first
hemal spine, fused premaxillary processes and separate
dorsal fins (the latter two are not unique to Ptereleotridae). Morphological characters suggest that Nemateleotris is the most primitive ptereleotrid genus and
Ptereleotris the most derived (Rennis and Hoese, 1987).
The molecular hypothesis does indicate a monophyletic
Ptereleotris. Nemateleotris and Ptereleotris are included
in two different groups (Parioglossus and Ptereleotris,
respectively) by Birdsong et al. (1988). These groups
differ in dorsal-fin pterygiophore formula: Parioglossus
group genera have the common gobiid condition of 322110, while Ptereleotris features the unique 3-32010.
The hypothesis of a nonmonophyletic Microdesmidae
also conflicts with a previous morphological phylogenetic analysis (Thacker, 2000), and, unlike the disagreements between the molecular phylogeny and
morphology-based hypotheses of relationships for Oxudercinae, Sicydiinae, and Gobionellinae, this disagreement cannot be explained by a change in rooting. Three
of the five microdesmid genera were included in this
study. One, the Indo-Pacific Gunnellichthys, is included
in clade IIIB; the other two, the new world Cerdale and
Microdesmus, are placed in clade IIIC. Two species of
Microdesmus are included and they are recovered
together, sister to Cerdale, but only distantly related to
Gunnellichthys. The morphological characters used to
diagnose Microdesmidae are: the presence of an anterior
projection on the maxilla, overlapping the premaxillary
processes; loss of the medial process of the palatine that
366
C.E. Thacker / Molecular Phylogenetics and Evolution 26 (2003) 354–368
articulates with the lateral ethmoid; presence of a tiny,
slender pelvis, with pelvic intercleithral cartilage deeply
cleft; presence of a continuous dorsal fin, rather than
separate spined and rayed portions; an elevated vertebral
number and an elongate body. Of these characters, two
are unique novelties (maxilla projection and pelvis
morphology), one is a loss (loss of palatine process), and
three are not unique to Microdesmidae (single dorsal fin,
body elongation and elevated vertebral number). It is
possible that these characters are all functionally associated with the burrowing and feeding (egg predation)
habits of these fishes and thus the result of convergence.
The sister taxon to Microdesmidae is not known.
Most previous hypotheses have been based on a Microdesmidae + Ptereleotridae clade, with Ptereleotridae
being primitive. Based on several characters of the palatopterygoquadrate complex, Harrison (1989) proposed
that Microdesmidae is distinct from Ptereleotridae and
is the sister taxon to a clade containing the Sicydiinae
and some Gobionellinae. In this hypothesis, Microdesmidae, Sicydiinae, and Gobionellinae are not closely
related. Rather, the new world microdesmids (Cerdale
and Microdesmus) are sister to the Gobiosoma group
gobiines and the new world Priolepis group gobiines.
The old world Gunnellichthys is found in a clade containing Ptereleotridae, old world Priolepis group gobiines and Schindleriidae.
The molecular topology indicates that Schindleria is
sister to Gunnellichthys. This grouping is particularly
interesting, since the schindleriids have only recently
been classified within Gobioidei (Johnson and Brothers,
1993) and present a particularly difficult problem for
traditional morphological systematic studies because of
their extreme paedomorphic reduction. Schindleriidae
contains two species, S. praematura and Schindleria
pietschmanni, both of which were sequenced for this
study. Schindleria adults resemble larvae in all respects
except for gonad maturation, which occurs at 11–15 mm
standard length. Johnson and Brothers (1993) were able
to find morphological characters that indicated Schindleria was related to the Gobioidei, including similarities
between Schindleria and gobioid larvae, but were not
able to determine its sister group. Several characters
indicated that Schindleria was related to the more derived gobies, but the majority of these characters were
reductions or losses that could be independantly derived
as a result of ontogenetic truncation. One character is
shared by Schindleria and Microdesmidae: a configuration of the pharyngobranchials in which the second lies
fully anterior to the third and articulates with it only at
the tip (Johnson and Brothers, 1993). This articulation
condition is also found in Xenisthmus, a taxon distantly
related to these taxa according to the molecular topology, which has a very elongate and modified second
pharyngobranchial. The molecular phylogeny supports
the morphological character evidence of Johnson and
Brothers (1993); further evidence for the placement of
Schindleria with Microdesmidae is the observation that
the larvae of Gunnellichthys are superficially very similar
to Schindleria. Both are elongate, with a continuous
dorsal fin, a pointed snout, large eyes and a similar
overall morphology (Thacker, pers. obs.).
In addition to the new world microdesmid genera, the
new world gobiine clade (clade IIIC in Fig. 1) includes
three Gobiosoma group genera (Barbulifer, Risor, and
Gobiosoma) and two Priolepis group genera (Coryphopterus and Lophogobius). Together, the Gobiosoma
group, Microgobius group, and the genus Ophiogobius
comprise the tribe Gobiosomini: the American sevenspined gobies (Birdsong, 1975). As originally proposed,
Gobiosomini includes the genera Aruma, Barbulifer,
Bollmannia, Chriolepis, Eleotrica, Enypnias, Evermannichthys, Ginsburgellus, Gobiosoma, Gobulus, Gymneleotris, Microgobius, Nes, Palatogobius, Pariah, Parrella,
Psilotris, Pycnomma, Risor, and Varicus. These genera
share a vertebral formula of 11 þ 16 17 ¼ 27 28 and
a dorsal fin pterygiophore pattern of 3-221110, (there is
some variation within the genus Evermannichthys) and
comprise most of the gobioid fauna of the tropical
eastern Pacific, western Atlantic and Caribbean. All the
genera except Microgobius, Parrella, Bollmannia, and
Palatogobius share a specialization of the caudal fin in
which the two hypural elements (composing fused hypurals 1–2 and 3–4) are fused to each other and to the
terminal vertebral element. On the basis of this caudal
character, Birdsong et al. (1988) delineated those genera
as the Gobiosoma group and placed Microgobius, Parrella, Bollmannia, and Palatogobius in another group, the
Microgobius group. Members of the Gobiosoma group
present in this study are B. ceuthoecus, R. ruber, and G.
macrodon. These genera form a clade, sister to the genera
Coryphopterus and Lophogobius. Thacker and Cole
(2002) examined the phylogeny of Coryphopterus and
outgroups based on both molecular and morphological
data. Their analysis agrees with the results seen in this
molecular hypothesis: the four Coryphopterus species
examined have the same relationships as seen in Thacker
and Cole (2002), Lophogobius is sister to Coryphopterus,
and a nonmonophyletic Fusigobius is more distantly related. In addition to molecular characters, morphological characters congruent with the sister taxon
relationship of Coryphopterus and Lophogobius include
the presence of a fleshy ridge or crest on the dorsal surface of the head (also seen in Rhinogobiops nicholsii), and
a similar gonad structure, related to their protogynous
hermaphroditism (also seen in Fusigobius [Cole, 1988]).
5. Conclusions
This analysis provides a broad view of gobioid interrelationships that has been impossible to reconstruct
C.E. Thacker / Molecular Phylogenetics and Evolution 26 (2003) 354–368
with morphological data. The molecular hypothesis
provides broad taxonomic sampling, using a character
set that may be examined in all the taxa. It accords
generally well with many disparate previous phylogenetic studies, both those based on morphological characters and those based on smaller molecular data sets.
Overall, the molecular phylogeny reveals not only that
the larger gobioid groups (Eleotridae, Gobiinae, and
Gobionellinae) are paraphyletic with respect to the
smaller ones (Xenisthmidae, Oxudercinae, Amblyopinae, Sicydiinae, Ptereleotridae, Microdesmidae, Kraemeriidae, and Schindleriidae), but also provides a
framework for an interpretation of morphological
character evolution, and in particular reductive evolution, in this group. The pattern of reduction and simplification observed in gobies is confirmed as a general
trend: more derived taxa exhibit greater morphological
reduction. However, specific instances of drastic reduction such as those seen in Xenisthmidae, Schindleriidae,
Kraemeriidae and some Gobiidae such as Pandaka
(subfamily Gobionellinae) and Priolepis (subfamily
Gobiinae) are manifested differently and are independently derived, indicating that reduction is a recurrent
phenomenon among gobies.
Acknowledgments
This study would not have been possible without the
generosity of those who supplied goby tissues for DNA
sequencing: Nancy Aguilar, Kathleen Cole, Tony Gill,
David Greenfield, Richard Heard, Yuki Ikeda, Akihisa
Iwata, Scott Matern, Rob Reavis, Colette St. Mary Ho
Young Suk, Brent Tibbatts, Jim Van Tassell, and Peter
Unmack. I also thank Dave Catania and Ramona
Swenson for collecting and curating ethanol-preserved
gobies in the collection of the California Academy of
Sciences. Field collections in Hawaii and the Line Islands
were assisted by Bret Danilowicz, Shawn Doan, Sharon
Kobayashi, Theresa Martinelli, and Bruce Mundy. Field
collections in French Polynesia were assisted by Andrew
Thompson and Daniel Geiger. Field collections in Belize
were assisted by David Smith, Carole Baldwin, and
Kathleen Cole. I thank Michael D. Sorenson, David P.
Mindell, Jennifer Ast, David Kizirian, Derek Dimcheff,
Stacie Novakovic, Alec Lindsay, and Tamaki Yuri for
expert instruction in and assistance with amplification,
sequencing, and molecular data analysis techniques. Part
of the work for this project was performed at the University of Michigan Museum of Zoology, in the lab of
David Mindell. This work was supported in part by the
Carl L. and Laura Hubbs Fellowship. This is contribution No. 3 of the W.M. Keck Foundation Program in
Molecular Systematics and Evolution at the Natural
History Museum of Los Angeles County.
367
References
Akihito, P., 1986. Some morphological characters considered to be
important in gobiid phylogeny. In: Uyeno, T., Arai, R., Taniuchi,
T., Matsuura, K. (Eds.), Proceedings of the Second International
Conference on Indo-Pacific Fishes. The Ichthyological Society of
Japan, Tokyo, pp. 629–639.
Akihito, Iwata, A., Kobayashi, T., Ikeo, K., Imanishi, T., Ono, H.,
Umehara, Y., Hamamatsu, C., Sugiyama, K., Ikeda, Y., Sakamoto, K., Fumihito, A., Ohno, S., Gojobori, T., 2000. Evolutionary
aspects of gobioid fishes based upon a phylogenetic analysis of
mitochondrial cytochrome b genes. Gene 259, 5–15.
Barrett, M., Donoghue, M.J., Sober, E., 1991. Against consensus. Syst.
Biol. 40 (4), 486–493.
Birdsong, R.S., 1975. The osteology of Microgobius signatus Poey
(Pisces: Gobiidae), with comments on other gobioid fishes. Bull.
Florida State Mus., Biol. Sci. 19 (3), 135–187.
Birdsong, R.S., Murdy, E.O., Pezold, F.L., 1988. A study of the
vertebral column and median fin osteology in gobioid fishes with
comments on gobioid relationships. Bull. Mar. Sci. 42 (2), 174–214.
Block, B.A., Finnerty, J.R., Stewart, A.F.R., Kidd, J., 1993. Evolution
of endothermy in fish: mapping physiological traits on a molecular
phylogeny. Science 260, 210–214.
Bremer, K., 1988. The limits of amino acid sequence data in
angiosperm phylogenetic reconstruction. Evolution 42, 795–803.
Broughton, R.E., Stanley, S.E., Durrett, R.T., 2000. Quantification of
homoplasy for nucleotide transitions and transversions and a
reexamination of assumptions in weighted phylogenetic analysis.
Syst. Biol. 49 (4), 617–627.
Brower, A.V.Z., 1996. Combining data in phylogenetic analysis (a
response to Huelsenbeck et al., 1996). Trends Ecol. Evol. 11, 334–
335.
Chow, S., Kishino, H., 1995. Phylogenetic relationships between tuna
species of the genus Thunnus (Scombroidei: Teleostei): inconsistent
implications from morphology, nuclear and mitochondrial genomes. J. Mol. Evol. 41, 741–748.
Cole, K.S., 1988. Patterns of gonad structure in hermaphroditic gobies
(Teleostei: Gobiidae). Environ. Biol. Fish. 28, 125–142.
DeSalle, R., Brower, A.V.Z., 1997. Process partitions, congruence, and
the independence of characters: inferring relationships among
closely related Hawaiian Drosophila from multiple gene regions.
Syst. Biol. 46 (4), 751–764.
Eernisse, D.J., Kluge, A.G., 1993. Taxonomic congruence versus total
evidence, and amniote phylogeny inferred from fossils, molecules
and morphology. Mol. Biol. Evol. 10 (6), 1170–1195.
Finnerty, J.R., Block, B.A., 1995. Evolution of cytochrome b in the
Scombroidei (Teleostei): molecular insights into billfish (Istiophoridae and Xiphiidae) relationships. Fish. Bull. 93, 78–96.
Gill, A.C., Hoese, D.F., 1993. Paraxenisthmus springeri, new genus
and species of gobioid fish from the west Pacific, and its
phylogenetic position within the Xenisthmidae. Copeia 1993 (4),
1049–1057.
Gill, H.S., 1994. Phylogenetic relationships of the members of the
Bathygobius and Priolepis groupings (sensu Birdsong et al., 1988)
which possess a longitudinal papillae pattern. In: Proceedings of
the Fourth Indo-Pacific Fish Conference: Systematics and Evolution of Indo-Pacific Fishes, Bangkok, Thailand, pp. 40–59.
Gosline, W.A., 1955. The osteology and relationships of certain
gobioid fishes, with particular reference to the genera Kraemeria
and Microdesmus. Pac. Sci. IX, 158–170.
Harrison, I.J., 1989. Specialization of the gobioid palatopterygoquadrate complex and its relevance to gobioid systematics. J. Nat.
Hist. 23, 325–353.
Hoese, D.F., 1984. Gobioidei: relationships. in: Moser, H.G. (Ed.),
Ontogeny and Systematics of Fishes. Spec. Pub. Am. Soc. Ichthy.
Herp. No. 1. Allen Press, Lawrence, Kansas, pp. 588–591.
368
C.E. Thacker / Molecular Phylogenetics and Evolution 26 (2003) 354–368
Hoese, D.F., Gill, A.C., 1993. Phylogenetic relationships of eleotrid
fishes (Perciformes: Gobioidei). Bull. Mar. Sci. 52 (1), 415–440.
Iwata, A., Hosoya, S., Larson, H.K., 2001. Paedogobius kimurai, a new
genus and species of goby (Teleostei: Gobioidei: Gobiidae) from
the west Pacific. Rec. Aust. Mus. 53, 103–112.
Johnson, G.D., Brothers, E.B., 1993. Schindleria: a paedomorphic
goby (Teleostei: Gobioidei). Bull. Mar. Sci. 52 (1), 441–471.
K€
allersj€
o, M., Albert, V.A., Farris, J.S., 1999. Homoplasy increases
phylogenetic structure. Cladistics 15, 91–93.
Klausewitz, W., Conde, B., 1981. Oxymetopon cyanoctenosus n. sp., un
nouvel Eleotride des Philippines, avec une etude comparee du genre
(Pisces, Perciformes, Gobioidei, Eleotridae). Revue Francaise
dÕAquariol. 8 (3), 67–76.
Kluge, A.G., 1998. Total evidence or taxonomic congruence: cladistics
or consensus classification. Cladistics 14, 151–158.
Kocher, T.D., Conroy, J.A., McKaye, K.R., Stauffer, J.R., Lockwood,
S.F., 1995. Evolution of NADH dehydrogenase subunit 2 in east
African cichlid fish. Mol. Phylogenet. Evol. 4 (4), 420–432.
Kocher, T.D., Stepien, C.A., 1997. Molecular Systematics of Fishes.
Academic Press, New York.
Larson, H.K., 2001. A revision of the gobiid fish genus Mugilogobius
(Teleostei: Gobioidei), and its systematic placement. Rec. West.
Aust. Mus. Suppl. No. 62, 233 pp.
Matsubara, K., Iwai, T., 1959. Description of a new sandfish,
Kraemeria sexradiata, from Japan, with special reference to its
osteology. J. Wash. Acad. Sci. 49 (1), 27–32.
Miller, P.J., 1973. The osteology and adaptive features of Rhyacichthys
aspro (Teleostei: Gobioidei) and the classification of gobioid fishes.
J. Zool. Lond. 171, 397–434.
Miller, P.J., 1998. The west african species of Eleotris and their
systematic affinities (Teleostei: Gobioidei). J. Nat. Hist. 32, 273–
296.
Mindell, D.P., Thacker, C.E., 1996. Rates of molecular evolution:
phylogenetic issues and applications. Ann. Rev. Ecol. Syst. 27,
279–303.
Murdy, E.O., 1989. A taxonomic revision and cladistic analysis of the
oxudercine gobies (Gobiidae: Oxudercinae). Rec. Aust. Mus.
Suppl. 11, 1–93.
Murdy, E.O., Shibukawa, K., 2001. A review of the gobiid fish genus
Odontamblyopus (Gobiidae: Amblyopinae). Ichthyol. Res. 48 (1),
31–43.
Nelson, J.S., 1994. Fishes of the World, third ed. Wiley, New York.
Nixon, K.C., Carpenter, J.M., 1996. On simultaneous analysis.
Cladistics 12, 221–241.
Parenti, L.R., Maciolek, J.A., 1993. New sicydiine gobies from Ponape
and Palau, Micronesia, with comments on systematics of the
subfamily Sicydiinae (Teleostei: Gobiidae). Bull. Mar. Sci. 53 (3),
945–972.
Parenti, L.R., Thomas, K.R., 1998. Pharyngeal jaw morphology and
homology in sicydiine gobies (Teleostei: Gobiidae) and allies. J.
Morph. 237, 257–274.
Patterson, C., 1993. Osteichthyes: Teleostei. In: Benton, M.J. (Ed.),
The Fossil Record 2. Chapman and Hall, London, pp. 622–656.
Pezold, F., 1993. Evidence for a monophyletic Gobiinae. Copeia 1993
(3), 634–643.
Randall, J.E., Allen, G.R., 1973. A revision of the gobiid fish genus
Nemateleotris, with descriptions of two new species. Quart. J.
Taiwan Mus. 26 (3–4), 347–367.
Randall, J.E., Hoese, D.F., 1985. Revision of the dartfishes, genus
Ptereleotris (Perciformes: Gobioidei). Indo-Pacific Fishes 7, 1–36.
Rennis, D.S., Hoese, D.F., 1985. A review of the genus Parioglossus
with descriptions of six new species (Pisces: Gobioidei). Rec. Aust.
Mus. 36, 169–201.
Rennis, D.S., Hoese, D.F., 1987. Aioliops, a new genus of ptereleotrine
fish (Pisces: Gobioidei) from the tropical Indo-Pacific with
descriptions of four new species. Rec. Aust. Mus. 39, 67–84.
Siddall, M.E., 1997. Prior agreement: arbitration or arbitrary? Syst.
Biol. 46 (4), 765–769.
Sorenson, M.D., 1999. TreeRot, Version 2. Boston University, Boston,
MA.
Sorenson, M.D., Ast, J.C., Dimcheff, D.E., Yuri, T., Mindell, D.P.,
1999. Primers for a PCR-based approach to mitochondrial genome
sequencing in birds and other vertebrates. Mol. Phylogenet. Evol.
12 (1), 105–114.
Springer, V.G., 1973. The osteology and adaptive features of Rhyacichthys aspro (Teleostei: Gobioidei) and the classification of
gobioid fishes. J. Zool. Lond. 171, 397–434.
Springer, V.G., 1983. Tyson belos, new genus and species of Western
Pacific Fish (Gobiidae, Xenisthminae), with discussions of Gobioid
osteology and classification. Smithsonian Contributions to Zoology No. 390, 40 pp.
Springer, V.G., 1988. Rotuma lewisi, new genus and species of fish
from the southwest Pacific (Gobioidei, Xenisthmidae). Proc. Biol.
Soc. Wash. 101 (3), 530–539.
Swofford, D.L., 1998. PAUP* vesion 4. Sinauer, Sunderland, MA.
Takagi, K., 1989. Cephalic sensory canal system of the gobioid fishes
of Japan: comparative morphology with special reference to
phylogenetic significance. J. Tokyo Univ. Fish. 75, 499–568.
Tang, K.L., Berendzen, P.B., Wiley, E.O., Morrissey, J.F., Winterbottom, R., Johnson, G.D., 1999. The phylogenetic relationships of the
suborder Acanthuroidei (Teleostei: Perciformes) based on molecular
and morphological evidence. Mol. Phylogenet. Evol. 11 (3), 415–425.
Thacker, C.E., 2000. Phylogeny of the Wormfishes (Teleostei:
Gobioidei: Microdesmidae). Copeia 2000 (4), 940–957.
Thacker, C.E., Cole, K.S., 2002. Phylogeny and evolution of the gobiid
genus Coryphopterus. Bull. Mar. Sci, in press.
Wang, H.-Y., Tsai, M-P., Dean, J., Lee, S.-C., 2001. Molecular
phylogeny of gobioid fishes (Perciformes: Gobioidei) based on
mitochondrial 12S rRNA sequences. Mol. Phylogenet. Evol. 20 (3),
390–408.
Wiley, E.O., Johnson, G.D., Dimmick, W.W., 1998. The phylogenetic
relationships of lampridiform fishes (Teleostei: Acanthomorpha),
based on a total-evidence analysis of morphological and molecular
data. Mol. Phylogenet. Evol. 10 (3), 417–425.
Wiley, E.O., Johnson, G.D., Dimmick, W.W., 2000. The interrelationships of acanthomorph fishes: a total evidence approach using
molecular and morphological data. Biochem. Syst. Ecol. 28, 319–
350.
Winterbottom, R., 1993. Search for the gobioid sister group (Actinopterygii: Percomorpha). Bull. Mar. Sci. 52 (1), 395–414.