Insect. Soc.
DOI 10.1007/s00040-007-0962-5
Birkhuser Verlag, Basel, 2007
Insectes Sociaux
Research article
Sequence and RFLP analysis of the ITS2 ribosomal DNA in two Neotropical
social bees, Melipona beecheii and Melipona yucatanica (Apidae, Meliponini)
P. De la Rffla1, W. de J. May-Itz1,2, J. Serrano1 and J.J.G. Quezada-Eun2
1
2
rea de Biologa Animal, Facultad Veterinaria, Universidad de Murcia, 30100 Murcia, Spain, e-mail: [email protected], [email protected]
Facultad de Medicina Veterinaria y Zootecnia, Universidad Autnoma de Yucatn, Apdo. Postal 4 – 116, Mrida, 97100 Yucatn, Mxico,
e-mail: [email protected], [email protected]
Received 20 June 2007; revised 31 August 2007; accepted 12 September 2007.
Abstract. Two stingless bees species of the genus Melipona, M. beecheii and M. yucatanica, are the only ones
reported for the Yucatan Peninsula. The natural distribution of M. beecheii ranges from southern Mexico to
Costa Rica, that of M. yucatanica from south Mexico to
Guatemala. Colonies of both species occur in a variety of
habitats and show adaptations to local conditions denoting the occurrence of ecotypes. The ITS2 of ribosomal
DNA has been characterized in both species and its utility
to discriminate among colonies has been investigated
through RFLP experiments. The ITS2 region is unusually
long, 1788 bp in M. beecheii and 1845 bp in M. yucatanica
(including the 3’ end of the 5.8S gene and partial 5’ of the
28S gene). Mean nucleotide divergence between both
ITS2 sequences is 16 % (excluding sites with insertions/
deletions) and 20 % when the insertions/deletions are
taken into account. The G+C content in both sequences is
close to 53 %. The PCR-RFLP assay was performed with
12 restriction enzymes on colonies of M. beecheii from
Mexico (Yucatan, Campeche and Chiapas) Costa Rica,
El Salvador and Guatemala, and of M. yucatanica from
Mexico (Yucatan) and Guatemala. The restriction patterns obtained allow to discriminating colonies of both
species with different origins. Both kinds of data are thus
useful for assessing intra and interspecific genetic variability and for developing appropriate conservation strategies for these species.
Keywords: Melipona, stingless bees, ITS2 region, conservation, Yucatn.
Introduction
Population and evolutionary analyses in the stingless bees
of the tribe Meliponini have increased during the last
years (Arias et al., 2006). These bees are among the most
diverse in terms of morphology and behaviour of the
eusocial Hymenopteran bees (Michener, 2000). Among
them, the genus Melipona Illiger, 1806 has a Neotropical
distribution and comprises about 40 described species
(Michener, 2000). The natural distribution of Melipona
beecheii Bennett, 1831 ranges from south Mexico, where
it can be found from the Yucatan Peninsula to the tropical
Pacific coast and the Gulf of Mexico, to Costa Rica
(Biesmeijer, 1997; Ayala, 1999). The other Melipona
species found in the Yucatan Peninsula, M. yucatanica
Camargo, Moure and Roubik, 1988 has been also found in
Guatemala, what suggests a more reduced geographic
range (Yurrita and Enrquez, 2005).
Due to the diversity of environments and habitats
found in the natural distribution range of these two
Melipona species it seems likely that particular populations have developed adaptations to local conditions
(Camargo et al., 1988), thus they can be consider as
ecotypes. This was found in populations of M. beecheii
from the Yucatan Peninsula and Costa Rica (QuezadaEun et al., 2007), after the analysis of mitochondrial
cox1 and six microsatellite loci, in which substantial
phenotypic and molecular differentiation was detected.
Other molecular markers also show a good potential
for assessing population variability within and between
related species. The ribosomal internal transcriber spacer
regions (ITS 1 and 2) are noncoding and therefore evolve
rapidly, usually showing concerted evolution (Dover,
1982). The length of the ITS regions in insects is usually
short, ranging from 190 – 633 bp (Honda et al., 1998;
2
P. De la Rffla et al.
ITS2 variation in Melipona species
Table 1. Sampling localities of the study species. The restriction patterns with the enzymes NcoI (M. beecheii) and BsmI (M. yucatanica) are also
indicated.
Species
Country
State
Locality
NcoI
M. beecheii
Mxico
Yucatn
Chiapas
Campeche
Petn
Retalhuleu
Alta Verapaz
Mrida
Chiapas
Tankunch
Santa Elena
Salam
Caquiqual
Carch
Pajapita
El Jocotal
Esquipulas
Pueblo Nuevo ViÇas
San Ignacio
Heredia
Juntas de Abangares
CaÇas
Sbana Larga
Barrio Jesffls
Atenas
Miramar
Nco-1
Nco-1
Nco-1
Nco-1
Nco-2
Nco-2
Nco-2
Nco-3
Nco-2
Nco-2
Nco-2
Nco-2
Nco-2
Nco-2
Nco-2
Nco-2
Nco-2
Nco-2
Nco-2
Guatemala
San Marcos
Chiquimula
El Salvador
Costa Rica
Santa Rosa
Chalatenango
Heredia
Guanacaste
Alajuela
Puntarenas
M. yucatanica
Mxico
Yucatn
Guatemala
Jutiapa
Santa Rosa
Kuperus and Chapco, 1994; Gmez-Zurita et al., 2000;
Weekers et al., 2001), although sizes from 1700 to 600 bp
has been also observed (Gallego and Galin, 2001).
Within the Apidae these regions show an extreme length
variation: in subspecies of Apis mellifera the ITS1 is 132
bp (De la Rffla et al., 2007) and in Bombus lapidarius is
289 bp (Ji et al., 2003) whereas it varies from 1387 – 1417
bp in species of Melipona (Fernandes-Salom¼o et al.,
2005). This sequence variation in the ITS1 region was
found useful for inferring relationships among eight
Melipona species (Fernandes-Salom¼o et al., 2005) and
also for assessing the intraspecific variation in populations of M. subnitida from Brazil (Cruz et al., 2006).
On the other hand, little is known about the ITS2
region of the Apidae and, particularly, of Melipona. Only
the sequence length (ranging from 2050 to 1995 bp) of M.
subnitida has been reported (Cruz et al., 2006). Given the
application of the ITS2 region in the systematics of genera
and species (Schultz et al., 2006), we aim to explore its
usefulness to characterize both species and putative
ecotypes of the two stingless bees of the genus Melipona
native to the Yucatan Peninsula, by determining its full
sequence and by means of fragment restriction length
polymorphism assays performed on this region.
Lpez Portillo
Huntochac
Jutiapa
Barberena
BsmI
Bsm-1
Bsm-1
Bsm-2
Bsm-2
20 8C. Specimens of both species were identified and several individuals
of each location have been preserved in the laboratory of Zoology of
the Veterinary Faculty (University of Murcia, Spain).
Total genomic DNA was extracted from legs dissected from each
individual with the DNeasy tissue kit (QIAGEN) following manufacturer instructions. The total dilution volume was 100 ml. Four ml were
taken for the PCR amplification.
ITS2 amplification
Primers used for the amplification of the complete ITS2 region were
CAS5p8sFt and CAS28sB1d from Ji et al. (2003). The PCR was carried
out in 25 ml volume with PureTaqTM Ready-To-GoTM PCR beads (GE
Healthcare) in a PTC-200 Thermal Cycler (Biorad). PCR conditions
involved an initial denaturation at 958C for 5 min then 35 cycles of 958C
for 30 sec, 508C for 1 min, 728C for 1 min 30 sec and a final extension of
728C for 10 min. The amplified PCR products were electrophoresed in
1.5 % agarose gels and then isopropanol purified.
Sequencing of the ITS2 region
Material and methods
The complete sequence of the ITS2 region was obtained from two
individuals of M. beecheii and two of M. yucatanica from the Yucatan
Peninsula. Initial sequencing reactions were performed in both
directions with the two primers used to amplify the complete ITS2
region. Due to the long size and complexity of the region, two
additional primers ITS2 – 249 (5’ GTCCGCGTCCCCGACGTCGTC
3’) and ITS2 – 856 (5’GACGGAGCGAGATCGTAGAAG 3’) were
designed and used as internal primers in the sequencing reactions
(Figure 1). All the sequencing reactions were performed at the
SECUGEN sequencing company (S. L. Madrid, Spain).
Bee samples and DNA extraction
Sequence analyses
Workers bees of the two Melipona species were collected from one
colony per location (Table 1). Each sample consisted on 10 – 20 worker
bees collected from each colony and preserved in absolute ethanol at -
DNA sequences of the ITS2 region in the two Melipona species were
initially aligned with the MEGA 4 program (Tamura et al., 2007),
followed by manual editing. The partial 5.8S sequences from Bombus
Insect. Soc.
Research article
3
Figure 1. Sequence of the ITS2 regions of M. beecheii (EU003824, pattern Nco-1) and M. yucatanica (EU003823, pattern Bsm-1). The primers
designed for sequencing are underlined. Microsatellite loci appear in bold letters. Dots indicate identity in this position whereas dashes denote
deletions.
lapidarius (AJ577252, Ji et al., 2003) and Colletes acutus (DQ085611,
Quicke et al., unp. results), and partial 28S sequences from Ageniaspis
fuscicollis (AF291458, Alvarez and Hoy, 2002) and Meloboris sp
(AJ888025, Wagener et al., 2006) retrieved from the GenBank were
used to establish the boundaries of the ITS2 region of the individuals
analyzed. The same program was used for sequence analysis (polymorphic sites, G+C content).
1.5 – 2 % agarose gels, ethidium bromide stained and documented
under UV light.
Results
Sequence characteristics
RFLP analyses
Amplified ITS2 region of one worker bee of each sampled location was
digested with the following restriction enzymes: BsmI, DraI, EcoRI,
EcoRV, FokI, HincII, NciI, NcoI, NruI, HpaI, TseI and TspRI.
Reactions were kept at 37 8C or 65 8C in a PTC-200 Thermal Cycler
(Biorad) for 12 hours. The digested products were electrophoresed in
The sequence of the ITS2 region of the two individuals of
each species showed no variation. The complete sequences have been submitted to the GenBank under the
accession numbers EU003824 (M. beecheii) and
EU003823 (M. yucatanica). Excluding the 5.8S (37 bp)
and 28S (25 bp) boundaries, the ITS2 region of the two
4
P. De la Rffla et al.
Melipona species has a very long sequence, 1728 bp in M.
beecheii and 1789 bp in M. yucatanica. This size difference
is mainly due to the presence of insertions and deletions
(indels) with different sizes. A total of 48 indels has been
detected in the two Melipona species, 28 of them were of
1, 2, 3 and 4 bp̧ and ten were of 5 or more bp. Deletions of
5, 6, 7, 8, 10 and 13 bp appeared in the ITS2 region of M.
beecheii with respect to M. yucatanica, whereas in M.
yucatanica only three deletions of 9, 8 and 6 bp were
observed. One of these indels in the position 468 of M.
yucatanica was composed of a short unit (ACT) repeated
three times forming a microsatellite locus. Another
microsatellite locus detected in the position 1403 in M.
yucatanica was composed of three repetitions of the core
sequence TGAGAG. Other microsatellite loci identified
in M. beecheii were also three repetitions of GA (position
308), TCGG (position 1653) and TCGA (position 1665)
(Fig. 1). The presence of these microsatellite loci resulted
in the long length and polymorphism of the ITS2 region of
M. beecheii and M. yucatanica. In total 242 variable
positions have been found within the ITS2 regions of the
two Melipona species. The mean nucleotide divergence
between the ITS2 sequences is 16 % (excluding sites with
insertions/deletions) and 20 % when the insertions/deletions are taken into account. The G+C content of the
ITS2 regions was very similar: 53.1 in M beecheii and 52.9
in M. yucatanica.
ITS2 variation in Melipona species
Figure 2. RFLP patterns with the enzymes NcoI (A) and BsmI (B).
Samples in figure A are M. beecheii from Guatemala showing the three
different restriction patterns: Nco-1 (2 from Petn), Nco-2 (3 from
Retalhuleu) and Nco-3 (1 from San Marcos). This enzyme did not cut
the ITS2 of M. yucatanica. Samples in figure B are M. beecheii from
Campeche (1), M. yucatanica from Yucatn (2, pattern Bsm-1) and
Guatemala (3, pattern Bsm-2). M is the GeneRuler 100bp DNA ladder
plus (Fermentas).
Guatemala (Bsm-2 with two restriction sites producing
three fragments of 1050, 417 and 384 bp) (Fig. 2B).
Discussion
PCR-RFLP differences among colonies
Due to the difficulties found when sequencing the ITS2
region, RFLP experiments were designed based on
species-specific differences in nucleotide substitutions.
Twelve restriction enzymes were identified as potential
diagnostic tools. EcoRI and NcoI showed restriction sites
only in M. beecheii whereas DraI, EcoRV and HincII cut
only the ITS2 region of M. yucatanica. Ten out of the
twelve restriction enzymes used did not show diagnostic
patterns in either M. beecheii or M. yucatanica colonies.
The restriction enzyme NcoI yielded three different
RFLP patterns among M. beecheii colonies clearly
associated to the geographic origin of the colonies. The
Mexican colonies (Yucatn, Campeche and Chiapas) and
the neighbouring northern Guatemalan colony located in
Petn, shared the Nco-1 pattern (fragments of 1238 and
550 bp). The other Guatemalan colonies (except San
Marcos) and those from El Salvador and Costa Rica
showed the Nco-2 pattern, with two fragments of similar
size (around 950 bp). A third NcoI pattern (Nco-3) was
detected in the Guatemalan colony from San Marcos
close to the Mexican state of Chiapas (Fig. 2A), showing
three fragments of 950, 550 and 400 bp.
In M. yucatanica the PCR-RFLP of the ITS2 region
performed with BsmI yielded two different patterns that
allow to discriminate between samples from Yucatn
(Bsm-1 with three restriction sites that produced four
fragments of 1050, 417, 372 and 12 bp) and those from
The ITS2 of the two Melipona species herein studied are
among the longest described in insects. Although in other
Hymenoptera this sequence can reach 900 bp in some ant
species of the genus Strumigenys (Hung et al., 2004), or
700 bp in parasitoid wasp of the genus Diadegma
(Wagener et al., 2006), the normal range in insects is
typically 200 – 400 bp in length (data from http://its2 –
2.bioapps.biozentrum.uni-wuerzburg.de/cgi-bin/index.pl?about). Nucleotide composition of the two ITS2
sequenced regions is GC rich (53 %), in coincidence
with the value observed in Diadegma species but lower
than the G+C content found in the ant species of the
genus Strumigenys (ranging from 59.1 to 62.6 %). The
ITS2 region of Drosophila melanogaster (Tautz et al.,
1988) is however more AT rich (80 %) than any other
insect species.
Within Melipona beecheii the molecular test has
allowed to separate three groups of colonies characterized with different ITS2-RFLP patterns and geographic
distribution. Pattern Nco-1 was found in Mxico and
north Guatemala, whereas pattern Nco-2 was found from
southern Guatemala to Costa Rica. Further analyses on
samples from Belize, Honduras and Nicaragua are
needed to assess its precise distribution. The presence of
these two RFLP patterns Nco-1 and Nco-2, agree with the
findings of Quezada-Eun et al. (2007) on colonies from
the Yucatn Peninsula and Costa Rica. These colonies
differed in morphological (integument colour and body
Insect. Soc.
size) and molecular characters (microsatellite and mitochondrial markers). These authors could not clarify
whether these differences where due to selection or
drift or both factors, but they argued that a reduced gene
flow between populations might have favoured such
differentiation. Although Carrillo et al. (2001) found
differences between M. beecheii colonies from Chiapas
and Yucatan in the head coloration (yellow marks on the
clypeus and malar area), colonies from both regions have
shown the same molecular pattern in our study. A third
RFLP pattern (Nco-3) was detected in one colony from
San Marcos. This location is close to Chiapas and
Retalhuleu where patterns Nco-1 and Nco-2 have been
found respectively. These findings suggest the occurrence
of parapatric boundaries between different populations
along the Pacific coast close to San Marcos that are worth
to be investigated in detail; also that geographic differentiation may be associated to the occurrence of ecotypes
adapted to local environmental conditions.
The finding of two different RFLP patterns in M.
yucatanica suggests that Yucatecan and Guatemalan
colonies are more differentiated than previously thought.
This species was recorded as endemic to the Yucatan
peninsula (Camargo et al., 1988) but other observations
suggest a wider distribution in southern Mexican states
where the wet forests are better conserved (Ayala, 1999).
In brief, analyses based on the ITS2 allowed finding
differences between and within M. beecheii and M.
yucatanica. Furthermore, the ITS2 results agreed with
the population differentiation estimated using morphological and molecular (mitochondrial and microsatellite)
criteria. These molecular markers could thus be used for
conservation studies of the stingless bees from the
Yucatecan Peninsula. The two Melipona species here
studied are becoming affected by deforestation of native
vegetation (Gmez-Pompa and Kaus, 1999; Kerr, 2002)
and management (Quezada-Eun et al., 2001), what is
leading to habitat fragmentation and a reduced gene flow
among feral populations (i.e., they are becoming metapopulations). This threat is partly due to the particular
reproduction system of these stingless bees, because they
need primary forests for nesting and the reproductive
females do not migrate very far during swarming (Engels
and Imperatriz-Fonseca, 1990). These geographically
distinct colonies could be well considered as ecotypes
that are prone to be conserved.
Acknowledgments
We thank the stingless beekeepers for providing samples and Ma
ngeles Snchez for excellent technical assistance. This research has
been financed by the Fundacin BBVA and CONACYT CO1-1556.
P. De la Rffla is supported by the program Ramn y Cajal of the Spanish
Ministry of Education and Science.
Research article
5
References
Alvarez J.M. and Hoy M.A. 2002. Evaluation of the ribosomal ITS2
DNA sequences in separating closely related populations of the
parasitoid Ageniaspis (Hymenoptera: Encyrtidae). An. Entomol.
Soc. Am. 95: 250 – 256
Arias M.C., Brito R.M., Francisco F.O., Moretto G., Oliveira F.F.,
Silvestre D. and Sheppard W.S. 2006. Molecular markers as a tool
for population and evolutionary studies of stingless bees. Apidologie 37: 259 – 274
Ayala R. 1999. Revisin de las abejas sin aguijn de Mxico
(Hymenoptera: Apidae: Meliponini). Folia Entomol. Mex. 106:
1 – 123
Bennett E.T. 1831. Some accounts of the habits of a Mexican bee. In:
Narrative of a voyage to the Pacific and Bering’s Strait, to Cooperate with the Polar Expeditions, vol. 2 (F.W. Beechey, Ed),
London, pp 357 – 365
Biesmeijer J.C. 1997. The organisation of foraging in stingless bees of
the genus Melipona, Ph.D. Thesis, Utrecht University
Camargo J.M.F, Moure J.S and Roubik D.W. 1988. Melipona yucatanica
New Species (Hymenoptera: Apidae: Meliponinae); stingless bee
dispersal across the Caribbean Arc and Post-Eucene Vicariance.
Pan-Pacific Entomol. 64: 147 – 157
Carrillo A., Quezada-Eun J.J.G. and Moo-Valle J.H. 2001. Estudio
preliminar sobre la variabilidad morfolgica de Melipona beecheii
(Apidae: Meliponini) en su rango de distribucin de Mxico,
Amrica Central y el Caribe. In: II Seminario Mexicano sobre
abejas sin aguijn (Quezada-Eun J.J.G., May-Itz W. de J., MooValle H. and Chab-Medina J.C., Eds), Mrida, Yucatn, pp 73–78
Cruz D.O., Jorge D.M.M., Pereira J.O.P., Torres D.C., Soares A.E.A.,
Freitas B.M. and Grangeiro T.B. 2006. Intraspecific variation in the
first internal transcribed spacer (ITS1) of the nuclear ribosomal
DNA in Melipona subnitida (Hymenoptera, Apidae), an endemic
stingless bee from northeastern Brazil. Apidologie 37: 376 – 386
De la Rffla P., Fuchs S. and Serrano J. 2007. A scientific note on the ITS-1
region of Apis mellifera subspecies. Apidologie 38 (DOI: 10.1051/
apido:2007015)
Dover G. 1982. Molecular drive: a cohesive mode of species evolution.
Nature 299: 111 – 117
Engels W. and Imperatriz-Fonseca V.L. 1990. Caste development,
reproductive strategies and control of fertility in honeybees and
stingless bees. In: Social Insects: an Evolutionary Approach to
Castes and Reproduction (Engels W., Ed.), Springer-Verlag, Berlin,
pp 166 – 230
Fernandes-Salom¼o T.M., Rocha R.B., Campos L.A.O. and Araffljo
E.F. 2005. The first internal transcribed spacer (ITS-1) of Melipona
species (Hymenoptera, Apidae, Meliponini): characterization and
phylogenetic analysis. Insect. Soc. 52: 11 – 18
Gallego D. and Galin J. 2001. The internal transcribed spacers (ITS1
and ITS2) of the rDNA diferentiate the bark beetle forest pests
Tomicus destruens and T. piniperda. Insect Mol. Biol. 10: 415 – 420
Gmez-Pompa A. and Kaus A. 1999. From pre-Hispanic to future
conservation alternatives: lessons from Mexico. Proc. Natl. Acad.
Sci. (USA) 96: 5982 – 5986
Gmez-Zurita J., Juan C. and Petitpierre E. 2000. Sequence, secondary
structure and phylogenetic analyses of the ribosomal internal
transcribed spacer 2 (ITS2) in the Timarcha leaf beetles (Coleoptera: Chrysomelidae). Insect Mol. Biol. 9: 591 – 604
Honda J.Y., Nakashima Y., Yanase T., Kawarabata T. and Hirose Y.
1998. Use of the internal transcribed spacer (ITS-1) region to infer
Orius (Hemiptera: Anthocoridae) species phylogeny. Appl. Entomol. Zool. 33: 567 – 571
Hung Y.T., Chen C.A., Wu W.J., Lin C.C. and Shih C.J. 2004.
Phylogenetic utility of the ribosomal internal transcribed spacer 2
in Strumigenys spp. (Hymenoptera: Formicidae). Mol. Phylogenet.
Evol. 32: 407 – 415
Illiger J.C. 1806. William Kirbys Familien der bienenartigen Insekten.
Mag. Insektenkunde 5: 28 – 175
Ji Y., Zhang D. and He L. 2003. Evolutionary conservation and
versatility of a new set of primers for amplifying the ribosomal
6
P. De la Rffla et al.
ITS2 variation in Melipona species
internal transcribed spacer regions in insects and other invertebrates. Mol. Ecol. Notes 3: 581 – 585
Kerr W.E. 2002. ExtinÅao de especies: a grande crise biologica do
momento e como afeta os meliponinios. Anais do Vencontro sobre
abelhas, Riberao Preto, SP Brasil, pp 4 – 9
Kuperus W.R. and Chapco W. 1994. Usefulness of Internal Transcribed
Spacer Regions of ribosomal DNA in Melanopline (Orthoptera,
Acrididae) Systematics. Ann. Entomol. Soc. Am. 87: 751 – 754
Michener C.D. 2000. The Bees of the World. John Hopkins University
Press, Baltimore London. 913 pp
Quezada-Eun J.J.G., May-Itza W. de J. and Gonzalez-Acereto J.A.
2001. Meliponiculture in Mxico: problems and perspective for
development. Bee World 82: 160 – 167
Quezada-Eun J.J.G. , Paxton R.J. , Palmer K.A. , May-Itz W. de J. ,
Tay W.T. and Oldroyd B.P. 2007. Morphological and molecular
characters reveal differentation in an Neotropical social bee,
Melipona beecheii (Apidae : Meliponini). Apidologie 38 : 247 –
258
Schultz J., Muller T., Achtziger M., Seibel P.N., Dandekar T. and Wolf
M. 2006. The internal transcribed spacer 2 database–a web server
for (not only) low level phylogenetic analyses. Nucleic Acids Res. 1;
34(Web Server issue): W704 – 7
Tamura K., Dudley J., Nei M. and Kumar S. 2007. MEGA4: Molecular
Evolutionary Genetics Analysis (MEGA) software version 4.0.
Mol. Biol. Evol. 24: 1596 – 1599
Tautz D., Hancock M. and Webb D.A. 1988. Complete sequence of the
rRNA genes of Drosophila melanogaster. Mol. Biol. Evol. 5:
366–376
Wagener B., Reineke A., Loehr B. and Zebitz C.P.W. 2006. Phylogenetic study of Diadegma species (Hymenoptera: Ichneumonidae)
inferred from analysis of mitochondrial and nuclear DNA sequences. Biol. Control 37: 131 – 140
Weekers P.H.H., De Jonckheere J.F. and Dumont H.J. 2001. Phylogenetic relationships inferred from ribosomal ITS sequences and
biogeographic patterns in representatives of the genus Calopteryx
(Insecta: Odonata) of the West Mediterranean and adjacent West
European zone. Mol. Phyl. Evol. 20: 89 – 99
Yurrita C. and Enriquez E. 2005. Distribucin de abejas sin aguijn en
Guatemala. In Memorias del IV Seminario Mesoamericano sobre
Abejas sin Aguijn. pp 130 – 134
To access this journal online:
http://www.birkhauser.ch/IS