From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
Epstein-Barr Virus in Benign Lymph Node Biopsies From Individuals Infected
With the Human Immunodeficiency Virus Is Associated With Concurrent or
Subsequent Development of Non-Hodgkin’s Lymphoma
By Darryl Shibata, Lawrence M. Weiss, Bharat N. Nathwani, Russell K. Brynes, and Alexandra M. Levine
Individuals infected with the human immunodeficiency virus
(HIV) have an increased incidence of high-grade B-cell lymphoma. In many instances, these lymphomas contain EpsteinBarr viral (EBV) genomes. To investigate the role of EBV in
development of HIV-related lymphoma, benign fixed lymph
node biopsies from normal individuals and HIV-infected
individuals with persistent generalized lymphadenopathy
(PGL) were analyzed for EBV sequences by polymerase chain
reaction and in situ DNA hybridization techniques. EBV DNA
was not detected in any of 16 benign lymph node biopsies
from normal individuals, but could be detected from 13 of 35
PGL biopsies. The EBV-infected cells were present in both
follicular and interfollicular areas and in both small and large
lymphoid cells. The presence of detectable amounts of EBV
M
OST ADULTS have been infected by Epstein-Barr
virus (EBV). The initial infection may be asymptomatic or may produce the clinical syndrome of infectious
mononucleosis. During the acute infection, large numbers
of EBV-infected lymphocytes are present in the peripheral
blood (PB)’ and lymph nodes.* Subsequently, the number of
infected lymphocytes decreases as the host mounts an
immune response.’ EBV then remains latent in B lymphocytes or nasopharyngeal epithelium, with periodic shedding
of virus into saliva.‘
The mechanisms of EBV latency are complex and host
dependent. In immunocompromised patients, EBV-related
lymphoproliferative disorders have been well described.’~~
Furthermore, patients immunocompromised owing to infection by human immunodeficiency virus (HIV) have an
increase in circulating EBV-infected lymphocytes’ and have
also been shown to be at increased risk of developing
high-grade B-cell lymph~ma.~.’
Approximately one half of
these lymphomas have been shown to contain EBV DNA
sequenCes.8.’’ The AIDS-related lymphomas behave aggressively and respond poorly to ~hemotherapy.~.’
HIV-infected patients are also at increased risk for
developing reactive lymphadenopathy, designated as persistent generalized lymphadenopathy (PGL), which is considered an AIDS-related condition (ARC). The histology of
these enlarged PGL lymph nodes consists of a benign but
florid follicular and interfollicular B-cell hyperplasia or
follicular involution.”.” The presence of monoclonal or
oligoclonal immunoglobulin gene rearrangements in approximately 20% of these reactive lymph nodes suggests that
this lymphoid hyperplasia may be a risk factor or prodrome
for subsequent development of lymphoma,8 but because
most HIV-infected individuals with PGL do not progress to
lymph~ma,’’.’~
other cofactors may be necessary. Because
EBV may be associated with HIV-related lymphoma, the
current study was performed to investigate the presence of
EBV in PGL lymph node biopsies and to determine the
possible relationship between EBV-related lymphoproliferations and the risk of malignant lymphoma.
Blood, Vol77, No 7 (April 1). 1991: pp 1527-1533
DNA in the 13 PGL biopsies was associated with an increased
incidence of concurrent lymphoma at another site (n = 3) or
development of lymphoma in time (n = 2). In contrast, only 1
of 22 individuals with EBV-negative PGL biopsies developed
lymphoma in time (P < .05). EBV was detected in all five
lymphomas in which tissue was available for subsequent
analysis, including the lymphoma that developed in the
individual without EBV in his previous PGL biopsy. These
findings support the hypothesis that EBV plays a role in
development of some HIV-related lymphomas. Detectable
EBV lymphoproliferations occur in a few PGL biopsies and
are associated with a significant risk of EBV DNA-positive
non-Hodgkin’s lymphoma.
o 1991by The American Society of Hematology.
MATERIALS AND METHODS
The slides and paraffin-embedded benign lymph node biopsies
from 35 HIV-infected and 16 non-HIV-infected patients from the
Los Angeles County-University of Southern California (LACUSC) Medical Center were analyzed. None of the 35 HIV-infected
patients had histories of opportunistic infection or Kaposi’s sarcoma, but three HIV-infected patients subsequently developed
lymphoma and three HIV-infected patients had lymphoma (“concurrent lymphoma”) at another site at the time the initial benign
lymph node biopsy was performed. Morphologic lymphoma classification, performed by three of the authors (D.S., R.K.B., B.N.N.),
was based on the Working Form~lation.’~
The benign lymph node
biopsies were classified either as normal or as reactive with
follicular hyperplasia, follicular involution, or dermatopathic
lymph ad en it is."^"
DNA was extracted from single 10-pm slices of the fixed tissues
into a 50-pL extraction ~olution.’~.~’
Approximately 0.5 to 2.0 pL
extraction solution was used for each reaction.
The polymerase chain reaction (PCR)17-’Y
was performed with
primers (SL15‘ GGACCTCAAAGAAGAGGGGG and SL3 GCTCCTGGTC’ITCCGCCTCC) and a probe (SL2 GGACGAGGACGGGGAAGAGG) specific for the EBNA 1 gene of EBV.
The primers amplify and detect an 80-base pair (bp) region of the
EBNA 1 gene (starting at position 8037’”) which appears to be
conserved between EBV strains with no reported sequence differences between the B95-8, JY, and FF41 strains.’@’’ As expected,
From the Departments of Pathology and Hematology, Los Angeles
County-University of Southem California Medical Center, Los Angeles; and the Department of Pathology, City of Hope National Medical
Center, Duarte, CA.
Submitted July 27 1990; accepted November 30, 1990.
Supported in part by a Grant No. CA50850 from the National
Cancer Institute, Bethesda, MD. D.S. is a recipient of the College of
American Pathology Fellowship Award.
Address reprint requests to Danyl Shibata, MD, at the LAC-USC
Medical Center, 1200 N State St 736, Los Angeles, CA 90033.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
“advertisement” in accordance with 18 U.S.C.section 1734 solely to
indicate this fact.
0 1991 by The American Society of Hematology.
0006-4971l91/7707-0025$3.0010
1527
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
1528
SHIBATA ET AL
SL1-3 detected the EBNA 1gene from the Raji, Jijoye, EB1, EB2,
EB3, and Daudi cell lines (American Type Culture Collection,
Rockville, MD) and also detected EBV from more than YO% of all
fixed biopsies of nasopharyngeal carcinoma (data not shown). The
reaction volumes were 50 p,L, and the primers were used at 40
pmol/L. Temperatures during the 42 amplification cycles were
95°C for 45 seconds, 50°C for 45 seconds, and 72°C for 60 seconds.
As a positive amplification control, primers for a genomic sequence
(low-density lipoprotein receptor”) were also simultaneously
present during the amplification. All EBV’ and EBV- samples
with the exception of the B-5 fixed biopsies demonstrated amplification of this normal genomic sequence. Fixation with B-5 greatly
reduces PCR amplification (D. Shibata, unpublished observations), and only EBV was detected from the B-5-fixed tissues. The
remainder of the PGL biopsies and all biopsies from the non-HIVinfected patients were fixed in formalin, and dilution studies
demonstrated that most of the DNA was suitable for amplification
(described below). Positive controls consisting of Raji DNA and
negative controls consisting of human genomic DNA as well as an
assay with no added sample were performed with each experiment.
The sensitivity of the EBV EBNA PCR reaction on fixed tissue
was determined by amplifying formalin-fured, paraffin-embedded
mixtures of Raji cells (50 EBV copies per cell24)and a non-EBVinfected T-cell line (Molt 3). Deparaffinized slices containing
approximately 50,000 cells were boiled and directly amplified as
above. The assay can detect at least 0.01% infected cells or an
average of 0.005 EBV copies per cell (data not shown).
Amplifications were performed in a blinded fashion without
knowledge of the HIV or lymphoma status. The EBNA PCR assay
was performed at least twice for each biopsy. In some cases, a
sample was positive on one run but negative on the second. For
these samples, five PCR assays were performed. A sample was
considered positive for EBV if most of the amplifications were
positive. If two of the five amplifications were positive, the sample
was considered weakly positive (l+),as indicated in Table 1. EBV
DNA was not detected from any of the negative biopsies except for
one specimen (case 15), which was considered negative because
only one of the five assays was positive. The relative amounts of
EBV DNA were further characterized by subjecting serial dilutions
of the DNA extracted from the formalin-fixed specimens to 50
PCR cycles.
The EBNA’ formalin-fixed specimens were amplified with a
second set of primers that immediately flank the portion of the
EBV lymphocyte-determined membrane antigen (LYDMA) gene
composed of variable numbers of tandem 33 bp repeats.z”6 The
primers (SL18, GGCGCACCTGGAGGTGGTCC, and SLlY, TTTCCAGCAGAGTCGCTAGG) were used at 2.5 p,mol/L with 40
amplification cycles at 95°C for 45 seconds, 50°C for 30 seconds,
and 72°C for 2 minutes with a final extension for 10 minutes at
72°C. The PCR products were Southern-blotted after electrophoresis through a 3% NuSieve (FMC, Rockland, ME), 0.5% agarose
gel, using a ”P-labeled probe (SL20, TGACAATGGCCCACAGGACCCTG) homologous to the tandem repeats.
In situ DNA hybridization was performed using an 3SS-labeled
BumHI-W fragment of the EBV genome.’ Negative controls
consisting of normal lymph nodes from individuals not in this study
were also analyzed.
HIV infection was determined by HIV enzyme-linked immunosorbent assay (ELISA) testing (Abbott Laboratories, Chicago,
IL) and by PCR analysis of the lymph node biopsies. The HIV gag
gene was amplified using the primers SK 38 and SK 39.27The HIV
PCR results for seven of the non-HIV-infected and 16 of the
HIV-infected patients were reported previously.”
Clinical follow-up, subsequent to the time of initial PGL biopsy,
was obtained by review of the medical records. Statistical analysis
was performed with the chi-square test.
Table 1. Summary of Resultsof PGL and Lymphoma Biopsies
Lymphoma Biopsy
Benign Lymph Node Biopsy
EBV
Case
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15-17
18-32
33-34
35
Type
FH
FH
Flt
FH
FH
FH
FH
FH
FH
FH
FH
FI
FI
FI
FH
FH
FI
DM
HIV PCR
PCR
+
+
-
-
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
I+
1+
3+
4+
3+
3+
2+
2+
2+
2+
1+
2+
2+
-
In Situ
Negative
Rare +
Atypical cells
Atypical cells +
ND
Rare
Germinal centers
Negative
Rare
Rare +
Germinal centers
Negative
Rare
Rare
Negative
Not done
Not done
Not done
+
+
+
+
+
+
+
Type
Months From
PGL BX
SNC
SNC
IBL
IBL
SNC
SNCt
1
22
5
0
0
0
EBV
PCR
5+
ND*
1+
1+
5+
-
In Situ
SNC cells
ND*
IBL cells
IBL cells
SNC cells
SNC cells
+
+
+
+
+
NA
NA
NA
NA
NA
NA
NA
NA
NA
NA
NA
NA
Negative (-); positive (+I; weak amplification (1+) (described in the Results section and legend t o Fig 2); amplification to the 10-fold dilution (2+);
amplification t o the 100-fold dilution (3+);amplification to the 1,000-fold dilution (4+); and amplification t o the 10,000-fold dilution (5+).
Abbreviations: PGL, persistent generalized lymphadenopathy; EBV, Epstein-Barr virus; HIV, human immunodeficiency virus; FH, follicular
hyperplasia; FI, follicular involution; DM, dermatopathic lymphadenitis; SNC, small non-cleaved lymphoma; IBL, immunoblastic lymphoma; NA, not
applicable.
*Lymphoma cells were obtained by fine-needle aspiration; insufficient material was available for EBV studies.
tB5-Fixed tissue; amplification of genomic sequences was not possible (described in the Results section).
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
1529
EBV IN PGL
RESULTS
The EBV EBNA PCR was performed on histologically
benign lymph node biopsies from 16 non-HIV-infected
patients and 35 HIV-infected patients. The results are
shown in Fig 1and Tables 1 and 2. EBV could be detected
in biopsies from 13 of the 35 HIV-infected patients and
from none of those from the 16 non-HIV-infected patients
(P < .01). The lymph node biopsies from the non-HIVinfected patients were classified either as normal (n = 1) or
as reactive with follicular hyperplasia (n = 9) or dermatopathic lymphadenitis (n = 6).
The EBNA PCR' formalin-fixed specimens were also
amplified for the portion of the EBV LYDMA gene
composed of variable numbers of tandem 33 bp repeats.
The size of this heterogeneous region is characteristic for a
given EBV isolate and can vary between EBV
Each EBNA PCR' formalin-fixed specimen was also LYDMA PCR+,and the LYDMA PCR products were variable
in size (Fig 2). An exception was the lymphoma of case 1,
which was EBNA PCR' but LYDMA PCR-. In situ
hybridization (described below) confirmed the presence of
EBV DNA in this lymphoma. Under the conditions used, a
single major PCR product band was produced from each
EBV-infected cell line, although multiple minor bands
could be detected after prolonged exposure. Mixtures of
A B
A B
1
Table 2. EBV in Benign Lymph Node Biopsies From HIV-Infected and
Non-HIV-Infected Patients
EBV PCR
HIV Status
~
+
-
+
-
EBV+ (%)
13
0
22
16
37
0
( P < .01)
Doslnea
Abbreviations as in Table 1.
the EBV-infected cell lines produced multiple predominant
bands. A single predominant LYDMA PCR band was
produced from the specimens in this study except for cases
12 and 14, which produced multiple predominant bands,
indicating the presence of at least two EBV species. In case
5, the only instance in which formalin-fixed material was
available for both the lymphoma and the PGL biopsy, a
single identical LYDMA band was produced.
Of the 13 HIV-infected patients with EBV PCR' PGL
biopsies, 3 had lymphoma diagnosed by biopsy at another
site (concurrent lymphoma) and 2 subsequently developed
lymphoma. In contrast, only 1 of 22 HIV-infected patients
(median follow-up 12 months) with EBV- PGL biopsies
developed lymphoma (Table 3, P < .05).
To characterize further the relative amounts of EBV
DNA present, we amplified serial dilutions of 14 EBV
PCR' formalin-fixed samples (Table 1and Fig 3). The EBV
PCR' formalin-fixed lymphomas and the Raji cell line
could be diluted at least 10,000-fold, with persistence of
PCR positivity for both EBV and the genomic sequence. In
contrast, the benign biopsies became negative for EBV at
lesser dilutions.
A B C D E
2
3
394-
4
5
298-
6
220154-
EBV
GENOMIC BP
Fig 1. Representative autoradiograph of the PCR products. Specimens A1-7 and 81-3 are PGL biopsies from HIV-infected patients.
Positive specimens are Al, 2,5, and 6 and B2.3. Controls are 84 (SiHa
cells, EBV-), 85, 6 (Raji cells, EBV'), and 87 (blank with no added
sample). As expected, all of the samples except 87 (blank) were
positivefor the genomic sequence.
Fig 2. Representative Southern blot analysis of the PCR products
amplified from a region of the LYDMA gene composed of variable
numbers of tandem repeats. Single bands of different sizes were
producedfrom the specimens (A, case 8; B, case 13; D, case 9) except
for C (case 12) and E (case 14), from which multiple predominant
bands were detected.
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
SHIBATA ET AL
1530
Table 3. EBV as a Risk Factor for Lymphoma in HIV-Infected Patients
EBV PCR in
PGL Biopsy
+
-
Lymphoma'
Present
Absent
5
1
21
a
( P < .05)
DISCUSSION
*Patients with concurrent lymphoma or patients subsequently developed lymphoma.
Abbreviations as in Table 1.
To identify the cells infected with EBV, in situ DNA
hybridization was performed (Fig 4). EBV DNA was
identified in the lymphoma cells of all five cases examined.
The diagnosis of lymphoma was made by fine-needle
aspiration in case 2, and lymphoma tissue was not available
for further analysis. Cells containing EBV DNA could also
be identified in most of the EBV PCR' PGL biopsies,
although the PCR was more sensitive. The in situ DNA
hybridization technique, however, could analyze the B-5fixed tissues unsuitable for the PCR. In PGL cases 3 and 4,
small clusters of large atypical cells present in interfollicular and pericapsular adipose tissue were positive. In the
remaining positive PGL cases, scattered large to small cells
constituting less than 1% of the cells were positive in focal
follicular as well as interfollicular areas. Presence of EBV
DNA was limited to the cells in several germinal centers
alone in cases 7 and 11.
HIV DNA was detected from 34 of the 35 benign lymph
nodes of the HIV-infected patients (Table 1). Unlike some
DILUTION
>
po
A B C
..-
2 Controls
genomic
0.1
0.01
of the EBV amplifications, the HIV PCR assays were
consistently positive. EBV DNA was detected from the one
HIV PCR- PGL biopsy. HIV sequences were not detected
from any of the 16 lymph node biopsies from uninfected
patients.
blank
w
oo.ool
Fig 3. Dilution analysis of the EBV' specimens. DNA extracted
from the lymph node biopsies was serially diluted before the EBV
EBNA PCR, with 1.0 representing 1 pL of the original extraction. Both
the Raji cell line and specimen A, the lymphoma of case 1, were
strongly positive for EBV even at the 0.001 (4+) dilution. In contrast,
specimen B (PGL biopsy from case 5) was weakly positive for EBV at
the 0.001 (4+) dilution, and specimen C (PGL biopsyfrom Case 9) was
positive for EBV only to the 0.1 (2+) dilution. The genomic sequence
was positive in all the specimens t o the 0.001 dilution. The controls
were a genomic sample (SiHa cell line, EBV-) and a blank (no added
sample).
After an acute EBV infection, a life-long persistent
infection is established, reflecting a balance between viral
replication and host immunity.) EBV can be cultured from
the pharynx of most asymptomatic seropositive individuals?' EBV can also be cultured from a very small proportion
( < 1 in 1,000,000) of PB mononuclear cells.' Direct detection of EBV-infected cells by nucleic acid hybridization
techniques during latent infection has not been possible,
however?29Therefore, we used the PCR'8.'9to enhance the
sensitivity of EBV detection. Despite this increased sensitivity (at least an average of 0.005 EBV genomes per cell),
EBV could not be detected in the lymph node biopsies from
16 normal individuals. Similarly, EBV has not been detected in benign lymph node biopsies from normal individuals by other investigators using the PCR.M83'These results,
analogous to the values obtained by culture assays for EBV,
indicate that the numbers of EBV-infected lymph node
cells is normally extremely small in latent infection.
In contrast, individuals infected with HIV may be immunocompromised, with resultant increased numbers of EBVinfected cells. Serologic data have demonstrated that more
than 90% of HIV-infected individuals are also EBV infected and that reactivation of the EBV infection may be a
common occurrence3233;eg, EBV can be cultured from a
higher but still small proportion (- 1 in 100,000) of PB B
cells: Despite this increase in the numbers of EBV-infected
peripheral blood mononuclear cells, detection of EBV
sequences within PGL tissues has been extremely diffiIn the current study, by using the PCR technique,
EBV DNA was successfully detected in 37% of benign PGL
biopsies.
The EBV-infected cells present in the PGL biopsies were
identified using very sensitive in situ DNA hybridization
techniques. Only a small proportion ( < 1%) of small and
large lymphoid cells located in focal follicular and interfollicular regions were positive. In cases 7 and 11, infected cells
were identified predominantly within isolated germinal
centers. The patterns of EBV infection in the PGL lymph
node biopsies are markedly different from the patterns
present in infectious mononucleosis, in which greater numbers of EBV-infected cells are located almost exclusively in
interfollicular areas and are predominantly immunoEBV-infected cells are otherwise not detectable in
reactive lymph node biopsies from normal individuals.
Because approximately half of all HIV-related lymphomas have been shown to contain EBV sequences,s"' the
presence of detectable EBV-infected cells in the current
PGL biopsies was studied for possible correlations with the
presence of lymphoma. EBV positivity was significantly
associated with the concurrent presence of EBV' nonHodgkin's lymphoma at another site or subsequent development of EBV' lymphoma. These findings demonstrate that
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
1531
EBV IN PGL
!
Fig 4. In situ DNA hybridization for EBV. (A) An
HIV-related non-Hodgkin‘s lymphoma positive for
EBV with autoradiographic signals present in all the
lymphoma cells. (B) A PGL biopsy (case 7) in which
the autoradiographic signals existed predominantly
in a few germinalcenters (GC).
existence of increased numbers of EBV-infected cells
commonly precedes or is associated with development of
lymphoma in HIV-infected individuals and supports the
hypothesis that EBV may play a significant role in its
genesis. None of the 37 HIV-infected individuals with PGL
developed lymphomas negative for EBV. HIV-related lymphomas appear to be a heterogeneous group, and patients
with PGL and detectable EBV sequences apparently have a
greater risk for EBV+ but not EBV- lymphoma, although
the small numbers of patients in this study precludes
definitive analysis.
This association between EBV in the PGL biopsies and
EBV’ lymphoma is not unexpected. As hypothesized by
other inve~tigators,5.”’~~~~~~’
EBV-related lymphoproliferations that occur secondary to immunodeficiency may allow
development of genetic aberrations such as the chromosomal translocation 8;14,activation of c-myc oncogene, and
eventual termination in lymphoma. This study provides
definitive evidence that the hypothesized EBV-related
lymphoproliferations do occur in benign PGL lymph node
biopsies. Amplification of the polymorphic LYDMA gene
sequence can provide some information about the clonal
nature of the EBV-related lymphoproliferation. Although
polyclonal and clonal proliferation cannot be distinguished
if an individual is infected with EBV species homogeneous
for the polymorphic region, multiple bands were detected
in two individuals in this study, indicating that these
individuals were infected with at least two different EBV
species. Unless the same cell was infected by the different
EBV species, these EBV-related lymphoproliferations were
probably oligoclonal or polyclonal.
Increased numbers of EBV-infected cells, however, are
neither necessary nor sufficient for development of lymphoma. In case 1, EBV was not detected in the PGL biopsy
performed 1 month before development of an EBV’
lymphoma. In this case, EBV-related lymphoproliferation
may have been extremely focal and not present in the lymph
node biopsied. In other currently reported PGL cases, EBV
lymphoproliferations were not associated with lymphoma;
whether the EBV reactivation represented a transient
phenomenon in these patients or whether lymphoma will
eventually develop during longer follow-up is unknown.
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
1532
SHIBATA ET AL
HIV-related lymphomas are characterized by the presence of widely disseminated disease. Therefore, in some
instances, detection of EBV in the morphologically benign
PGL biopsies may represent occult involvement with EBVcontaining lymphoma cells. This may have occurred in cases
3 and 4 because the small number of EBV-infected cells
identified by in situ hybridization appeared to have the
abnormal morphology of lymphoma cells. Similar examples
of histologically occult lymphoma detected by molecular
techniques have been well described previ0usly.3~.~~
Although the number of HIV-infected cells in PGL
lymph nodes is
HIV provirus, in contrast to
EBV, was detected in virtually all benign lymph node
biopsies from HIV-seropositive individuals. This difference
may be related to the progressive nature of HIV infection as
compared with the stable latent infection typically established by EBV. HIV can stimulate B cells to proliferate4’
and may promote follicular hyperplasia of the EBV- benign
biopsies. Certain growth factors produced by HIV-infected
monocytes and T lymphocytes, such as interleukin-6 (IL6 ) y may be operative in this regard.
In summary, the detectable presence of EBV DNA in
benign PGL biopsies was a significant risk factor for EBV
DNA‘ lymphoma and suggests the need for close surveillance of these individuals. The presence of EBV in the PGL
lymph node biopsies from AIDS patients with lymphoma
may reflect widely disseminated occult lymphoma or increased immunosuppression leading to EBV reactivation.
The exact biologic mechanisms responsible for the association between EBV reactivation and B-cell lymphoma are
currently unknown.
ACKNOWLEDGMENT
We are indebted to Jackie Bonis for technical assistance and to
Dr John Sninsky of the Cetus Corporation for supplying the Taq
enzyme used in this study.
REFERENCES
1. Rocchi G, de Felici A, Ragona G, Heinz A Quantitative
evaluation of Epstein-Barr-virus-infected mononuclear peripheral
blood leukocytes in infectious mononucleosis. N Engl J Med
296:1332,1977
2. Weiss LM, Movahed LA: In situ demonstration of EpsteinBarr viral genomes in viral-associated B cell lymphoproliferations.
Am J Pathol134651,1989
3. Thorley-Lawson D A Basic virologic aspects of Epstein-Barr
virus infection. Semin Hematol25:247,1988
4. Harrington DS, Weisenburger DD, Purtilo DT: Epstein-Barr
virus-associated lymphoproliferative lesions. Clin Lab Med 8:97,
1988
5. Birx DL, Redfield RR, Tosato G: Defective regulation of
Epstein-Barr virus infection in patients with acquired immunodeficiency syndrome (AIDS) or AIDS-related disorders. N Engl J Med
3142374,1986
6. Levine AM, Meyer PR, Begandy MK, Parker JW, Taylor CR,
Irwin L, Lukes RJ: Development of B-cell lymphoma in homosexual men. Ann Intern Med 100:7,1984
7. Knowles DM, Chamulak GA, Subar M, Burke JS, Dugan M,
Wemz J, Slywotzky C, Pelicci G, Dalla-Favara R, Raphael B:
Lymphoid neoplasia associated with the acquired immunodeficiency syndrome (AIDS). Ann Intern Med 108:744,1988
8. Pelicci P-G, Knowles DM, Arlin ZA, Wieczorek R, Luciw P,
Dina D, Basilico C, Dalla-Favera R: Multiple monoclonal B cell
expansions and c-myc oncogene rearrangements in acquired immune deficiency syndrome-related lymphoproliferative disorders. J
Exp Med 164:2049,1986
9. Rechavi G, Ben-Bassat I, Berkowicz M, Martinowitz U,
Brok-Simoni F, Neumann Y,Vansover A, Gotlieb-Stematsky T,
Ramot B: Molecular analysis of Burkitt’s leukemia in two hemophilic brothers with AIDS. Blood 70:1713,1987
10. Subar M, Neri A, Inghirami G, Knowles DM, Dalla-Favera
R: Frequent c-myc oncogene activation and infrequent presence of
Epstein-Barr virus genome in AIDS-associated lymphoma. Blood
72:667,1988
11. Ewing EP, Chandler FW, Spira TJ, Brynes RK, Chan WC:
Primary lymph node pathology in AIDS and AIDS-related lymphadenopathy. Arch Pathol Lab Med 109:977,1985
12. Meyers PR, Yanagihara ET, Parker JW, Lukes RJ: A
distinctive follicular hyperplasia in the acquired immune deficiency
syndrome (AIDS) and the AIDS related complex: A prelymphomatous state for B-cell lymphoma. Hematol Oncol2:319,1984
13. Turner RR, Levine AM, Gill PS, Parker JW, Meyer PR:
Progressive histopathologic abnormalities in the persistent generalized lymphadenopathy syndrome. Am J Surg Pathol11:625,1987
14. Chadburn A, Metroka C, Mouradian J: Progressive lymph
node histology and its prognostic value in patients with acquired
immunodeficiency syndrome and AIDS-related complex. Hum
Pathol20579,1989
15. The Non-Hodgkin’s Lymphoma Pathologic Classification
Project: National Cancer Institute sponsored study of classification
of non-Hodgkin’s lymphomas. Cancer 49:2112,1982
16. Shibata D, Arnheim N, Martin WJ: Detection of human
papilloma virus in paraffin embedded tissue using the polymerase
chain reaction. J Exp Med 167225,1988
17. Shibata D, Brynes RK, Nathwanni BN, Kwok S, Sninsky J,
Arnheim N: Human immunodeficiency viral DNA is readily found
in lymph node biopsies from seropositive individuals. Am J Pathol
135:697,1989
18. Saiki RK, Scharf S, Faloona F, Mullis KB, Horn GT, Erlich
HA, Arnheim N: Enzymatic amplification of beta-globin genomic
sequences and restriction site analysis for diagnosis of sickle cell
anemia. Science 2301350,1985
19. Saiki RK, Gelfand DH, Stoffel S, Scharf SJ, Higuchi R, Horn
GT, Mullis KB, Erlich HA: Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science
239:487,1988
20. Baer R, Bankier AT, Biggin MD, Deininger PL, Farrell PJ,
Gibson TJ, Hatfull G, Hudson GS, Satchwell SC, Seguin C: DNA
sequence and expression of the B95-8 Epstein-Barr virus genome.
Nature 310:207,1984
21. Spreck SH, Strominger J L Analysis of the transcript encoding the latent Epstein-Barr virus nuclear antigen I: A potentially
polycistronic message generated by long-range splicing of several
exons. Proc Natl Acad Sci USA 828305,1985
22. Polvino-Bodnar M, Shedd D, Miller G: Deletion mutants
that affect expression of Epstein-Barr virus nuclear antigen in
COS-1 cells after gene transfer with simian virus 40 vectors
containing portions of the Bam HI K fragment. J Virol58:324,1986
23. Li H, Gyllensten UB, Cui X, Saiki RK, Erlich HA, Arnheim
N Amplification and analysis of DNA sequences in single human
sperm and diploid cells. Nature 335:414,1988
24. Pritchett R, Pedersen M, Kieff E: Complexity of EBV
homologous DNA in continuous lymphoblastoid cell lines. Virology 74:227,1976
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
EBV IN PGL
25. Fennewald S, van Santen V, Kieff E: Nucleotide sequence of
an mRNA transcribed in latent growth-transforming virus infection indicates that it may encode a membrane protein. J Virol
51:411,1984
26. Hennessy K, Fenwald S, Hummel M, Cole T, Kieff E: A
membrane protein encoded by Epstein-Barr virus in latent growthtransforming infection. Proc Natl Acad Sci USA 81:7207,1984
27. Ou CY, Kwok S, Mitchell SW, Mack DH, Sninsky JJ, Krebs
JW, Feorino P, Warfield D, Schochefman G: DNA amplification
for direct detection of HIV-1 in DNA of peripheral blood mononuclear cells. Science 239:295,1988
28. Yao QY, Rickinson AB, Epstein MA: A re-examination of
the Epstein-Barr virus carrier state in healthy seropositive individuals. Int J Cancer 35:35,1985
29. Staal SP, Ambinder R, Beschorner WE, Hayward GS, Mann
R: A survey of Epstein-Barr virus DNA in lymphoid tissue. Am J
Clin Pathol91:1,1989
30. Quinnan GV, Masur H, Rook AH, Annstrong G, Frederick
WR, Epstein J, Manischewitz JF, Macher AM, Jackson L, Ames J:
Herpesvirus infections in the acquired immune deficiency syndrome. JAMA 25272,1984
31. Saito I, Servenius B, Compton T, Fox RI: Detection of
Epstein-Barr virus DNA by polymerase chain reaction in blood and
tissue biopsies from patients with Sjogren’s syndrome. J Exp Med
169:2191,1989
32. Peiper SC, Myers JL, Broussard EE, Sixbey JW:Detection
of Epstein-Barr virus genomes in archival tissues by polymerase
chain reaction. Arch Pathol Lab Med 114:711, 1990
33. Abid-Rahman M, Kingsley LA, Breinig MK, Ho M, Armstrong JA, Atchison RW, Lyter DW, Rinaldo CR Jr: Enhanced
antibody responses to Epstein-Barr virus in HIV-infected homosexual men. J Infect Dis 159:472,1989
34. Uccini S, Monardo F, Vitolo D, Faggioni A, Gradilone A,
Agliano AM, Manzari V, Ruco LP, Baroni CD: Human immunodeficiency virus (HIV) and Epstein-Barr virus (EBV) antigens and
genome in lymph nodes of HIV-positive patients affected by
1533
persistent generalized lymphadenopathy (PGL). Am J Clin Pathol
92729,1989
35. Ernberg I, Altiok E: The role of Epstein-Barr virus in
lymphomas of HIV-carriers. Acta Pathol Microbiol Immunol
Scand 858,1989 (suppl)
36. Niedobitek G, Hamilton-Dutoit S, Herbst H, Finn T, Vetner
M, Pallesen G, Stein H: Identification of Epstein-Barr virusinfected cells in tonsils of acute infectious mononucleosis by in situ
hybridization. Hum Pathol20796,1989
37. Crescenzi M, Seto M, Herzig GP, Weiss PD, Griffith RC,
Korsmeyer SJ: Thermostable DNA polymerase chain amplification
of t( 14;18) chromosomal breakpoints and detection of minimal
residual disease. Proc Natl Acad Sci USA 185:4869,1988
38. Weiss LM, Hu E, Wood GS, Moulds C, Cleary ML, Warnke
R, Sklar J: Clonal rearrangements of T-cell receptor genes in
mycosis fungoides and dermatopathic lymphadenopathy. N Engl J
Med 313539,1985
39. Harper ME, Marselle LM, Gallo RC, Wong-Staal F Detection of lymphocytes expressing human T-lymphotropic virus type
111 in lymph nodes and peripheral blood from infected individuals
by in situ hybridization. Proc Natl Acad Sci USA 83:772,1986
40. Biberfeld P, Chayt KJ, Marselle LM, Biberfeld G, Gallo RC,
Harper ME: HTLV-111 expression in infected lymph nodes and
relevance to pathogenesis of lymphadenopathy. Am J Pathol
125:436,1986
41. Schnittman SM, Lane HC, Higgins SE, Folks T, Fauci AS:
Direct polyclonal activation of human B lymphocytes by the
acquired immune deficiency syndrome virus. Science 233:1084,
1986
42. Groopman JE, Molina JH, Scadden D T Hematopoietic
growth factors. Biology and clinical applications. N Engl J Med
321:1449,1989
43. Nakajima K, Martinez-Maza 0, Hirano T, Breen EC,
Nishanian PG, Salazar-Gonzalez JF, Fahey JL, Kishimoto T
Induction of IL-6 production by HIV. J Immunol142:531,1989
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
1991 77: 1527-1533
Epstein-Barr virus in benign lymph node biopsies from individuals
infected with the human immunodeficiency virus is associated with
concurrent or subsequent development of non-Hodgkin's lymphoma
D Shibata, LM Weiss, BN Nathwani, RK Brynes and AM Levine
Updated information and services can be found at:
http://www.bloodjournal.org/content/77/7/1527.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American
Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.