Copyright Ó 2010 by the Genetics Society of America
DOI: 10.1534/genetics.110.122879
Functional Specialization of Sensory Cilia by an RFX Transcription
Factor Isoform
Juan Wang,* Hillel T. Schwartz†,1 and Maureen M. Barr*,2
*Department of Genetics, Rutgers, The State University of New Jersey, Piscataway, New Jersey 08854 and †Department of
Biology, Massachusetts Institute Of Technology, Cambridge, Massachusetts 02139
Manuscript received September 2, 2010
Accepted for publication October 4, 2010
ABSTRACT
In animals, RFX transcription factors govern ciliogenesis by binding to an X-box motif in the promoters
of ciliogenic genes. In Caenorhabditis elegans, the sole RFX transcription factor (TF) daf-19 null mutant
lacks all sensory cilia, fails to express many ciliogenic genes, and is defective in many sensory behaviors,
including male mating. The daf-19c isoform is expressed in all ciliated sensory neurons and is necessary
and sufficient for activating X-box containing ciliogenesis genes. Here, we describe the daf-19(n4132)
mutant that is defective in expression of the sensory polycystic kidney disease (PKD) gene battery and
male mating behavior, without affecting expression of ciliogenic genes or ciliogenesis. daf-19(n4132)
disrupts expression of a new isoform, daf-19m (for function in male mating). daf-19m is expressed in malespecific PKD and core IL2 neurons via internal promoters and remote enhancer elements located in
introns of the daf-19 genomic locus. daf-19m genetically programs the sensory functions of a subset of
ciliated neurons, independent of daf-19c. In the male-specific HOB neuron, DAF-19M acts downstream of
the zinc finger TF EGL-46, indicating that a TF cascade controls the PKD gene battery in this cell-type
specific context. We conclude that the RFX TF DAF-19 regulates ciliogenesis via X-box containing
ciliogenic genes and controls ciliary specialization by regulating non-X-box containing sensory genes. This
study reveals a more extensive role for RFX TFs in generating fully functional cilia.
C
ILIA and flagella are highly conserved structures
that fulfill important functions in motility, development, and sensation (Marshall and Nonaka
2006; Scholey and Anderson 2006). All cilia and
flagella share three general properties: a microtubulebased axoneme, a ciliary membrane containing receptors
and channels, and a ciliogenic intraflagellar transport
(IFT) machinery ( Jekely and Arendt 2006; Satir and
Christensen 2007; Sloboda and Rosenbaum 2007;
Scholey 2008). Cavalier-Smith (1978) has proposed
that the ancestral eukaryote was a ciliated unicellular
organism (Cavalier-Smith 1978). The evolutionarily
conserved cilium has undergone remarkable diversification in structure, length, morphology, molecular
composition, and function (Silverman and Leroux
2009). The principles of ciliary specialization are not
well understood.
Regulatory factor X (RFX) transcription factors (TFs)
play a conserved role in ciliogenesis in the nematode,
Supporting information is available online at http://www.genetics.org/
cgi/content/full/genetics.110.122879/DC1.
Available freely online through the author-supported open access
option.
1
Present address: California Institute of Technology, 1200 E.
California Blvd., Pasadena, CA 91125.
2
Corresponding author: Department of Genetics, Rutgers University, 145
Bevier Road, Piscataway, NJ 08854. E-mail: [email protected]
Genetics 186: 1295–1307 (December 2010)
Drosophila, zebrafish, and mammals (Swoboda et al.
2000; Dubruille et al. 2002; Bonnafe et al. 2004; Liu
et al. 2007; Thomas et al. 2010). RFX TFs share a
characteristic winged helix DNA binding domain and
bind to an X-box motif in the promoters of target genes
(Reith et al. 1990, 1994; Emery et al. 1996; Gajiwala
et al. 2000). Studies on Caenorhabditis elegans daf-19, the
sole RFX TF in the worm, provided important insight
into the role of RFX TFs in regulating ciliogenesis and
ciliogenic gene batteries (Swoboda et al. 2000; Blacque
et al. 2005; Chen et al. 2006; Senti and Swoboda 2008;
Senti et al. 2009). daf-19 null mutants fail to express
many ciliogenic genes, lack all sensory cilia, and are
defective in many sensory behaviors (Perkins et al. 1986;
Collet et al. 1998; Swoboda et al. 2000; Efimenko et al.
2005). daf-19 encodes three isoforms: DAF-19A/B functions in nonciliated neurons to maintain synaptic
activity in the adult, while DAF-19C is expressed in all
ciliated sensory neurons to regulate ciliogenesis (Senti
and Swoboda 2008). The human genome encodes
seven RFX TFs (Aftab et al. 2008). In mammals, RFX3
regulates genes involved in ciliary assembly and motility
(Bonnafe et al. 2004; El Zein et al. 2009). RFX4 is also a
ciliary TF (Ashique et al. 2009). In vertebrates, other
ciliary TFs have been identified, including HNF1b,
Foxj1, and Noto (Gresh et al. 2004; Beckers et al.
2007; Yu et al. 2008). The mechanisms of RFX target
1296
J. Wang, H. T. Schwartz and M. M. Barr
specificity and the relationships between ciliary TFs are
not known.
The C. elegans nervous system is well endowed with
sensory cilia located on the distal ends of sensory
dendrites. Sixty sensory neurons are ciliated in the core
nervous system (common in both sexes) (Ward et al.
1975; Ware et al. 1975; Perkins et al. 1986). The male
has an additional 48 sex-specific ciliated sensory neurons required for mating behaviors (Sulston et al. 1980;
Liu and Sternberg 1995; Barr and Sternberg 1999).
These cilia may exhibit unique morphologies, express
distinct repertoires of receptors and signaling molecules, and function in a variety of sensory modalities
(Bae and Barr 2008). In core amphid sensilla, amphid
channel cilia are simple single or biciliated rod-like
structures that originate from transition zones to 9 1 0
arrangement of doublet microtubules in middle segments and 9 1 0 singlet microtubules in distal segments
(Ward et al. 1975; Perkins et al. 1986). Conversely, the
amphid wing neurons (AWA/B/C) possess elaborate
branched structures (Ward et al. 1975; Perkins et al.
1986; Mukhopadhyay et al. 2007). The C. elegans Foxj1
homolog fkh-2 is required for AWB specification and is
regulated by daf-19 (Mukhopadhyay et al. 2007).
General cilium structure mutants such as daf-19 are
defective in multiple sensory behaviors, including male
mating behaviors (Perkins et al. 1986; Barr and
Sternberg 1999; Simon and Sternberg 2002; White
et al. 2007). A subset of 21 male-specific ciliated neurons
may be defined by their unique ultrastructural anatomy,
functional properties, and gene expression profiles.
Four CEM cephalic, one HOB hook, and 16 ray neurons
(RnB where n ¼ rays 1–9, but not ray 6) possess B-type
cilia that are exposed to the environment and lie
adjacent to A-type cilia embedded in the cuticle (Ward
et al. 1975; Sulston et al. 1980; Jauregui et al. 2008).
The CEM, HOB, and RnB neurons are implicated in
chemotaxis to mates, response, and vulva location,
respectively (Barr and Sternberg 1999; Chasnov
et al. 2007; White et al. 2007; Jauregui et al. 2008).
These male-specific neurons express the autosomal
dominant polycystic kidney disease (ADPKD) gene homologs lov-1 and pkd-2, the kinesin-like protein gene klp-6,
and five coexpressed with polycystin (cwp) genes, herein
called the ‘‘PKD neurons’’ and ‘‘PKD gene battery,’’
respectively (Barr and Sternberg 1999; Barr et al.
2001; Portman and Emmons 2004; Peden and Barr
2005; Miller and Portman 2010). Only ray R6B does
not possess an exposed cilium or express the PKD gene
battery. Consistent with sensory function in RnB and
HOB neurons, lov-1, pkd-2, and klp-6 mutant males are
response (Rsp) and location of vulva (Lov) defective.
Six IL2 core neurons also express klp-6 (Peden and
Barr 2005). The axonemes of the PKD and IL2 neurons
are similar in that they possess singlet microtubules of
varying numbers, which are distinct from axonemes of
the core amphid and phasmid neurons. Although the
PKD and IL2 neurons have several features in common,
they are also individually specified via distinct lineagedriven mechanisms and express different sets of neurotransmitters and neuropeptides (Lints and Emmons
1999; Nathoo et al. 2001; Shaham and Bargmann
2002; Yu et al. 2003; Lints et al. 2004; Peden et al. 2007;
Schwartz and Horvitz 2007). This raises the question
of how the shared traits of PKD and IL2 neurons are
patterned and how the PKD gene battery is regulated to
generate functional sensory cilia.
Previous studies showed that a null allele of daf-19
disrupted pkd-2 expression, although the pkd-2 promoter does not contain an X box ( Yu et al. 2003). Here,
we identify a cis-regulatory mutation in the daf-19 locus
that produces Rsp, Lov, and PKD gene battery expression
defects without affecting ciliogenesis. daf-19(n4132)
disrupts daf-19m, a daf-19 isoform required for male
mating and that specifically acts in PKD and IL2 ciliated
sensory neurons. In these neurons, DAF-19M is both
necessary and sufficient for activating the PKD gene
battery without affecting ciliogenic gene expression or
IL2 ciliogenesis. These studies reveal how the complex
genomic architecture of an RFX TF enables a single
gene to encode a pan-ciliary isoform (DAF-19C) that
regulates ciliogenesis and a tissue-specific isoform
(DAF-19M) that controls cilia specialization.
MATERIALS AND METHODS
Strains, plasmids, and PCR products: Growth and culture
of C. elegans strains were carried out as described (Brenner
1974). Male-enriched strain him-5(e1490)V (high incidence of
males) was used as the wild-type reference strain for these
studies (Hodgkin 1983). The daf-19 m86, sa190, sa232, m334,
and m407 mutant alleles form dauers constitutively, but 20–
30% are nondauers when raised at 15°. We maintained these
daf-19 alleles at 15° and shifted them to 20° one day before
the assay. All other strains were grown at 20° unless otherwise
stated. Strains used for this study are listed in supporting
information, Table S1 and File S1. daf-19 genomic DNA
fragments were generated by PCR and described in Table S2.
CWP-1TGFP, Posm-9TGFP, Punc-119Tdaf-19mDDIMTGFP,
Pdaf-19mTGFP, and P1-5daf-19mTGFP were made by PCR–
splice by overlap extension (SOE) (Hobert 2002) or cloning
into Fire lab vectors, as described in Table S2.
Determining gene expression pattern: All expression analysis was carried out using transgenic GFP reporters. At least six
stable lines were generated and scored for each transgene.
Behavioral assays: Response and location-of-vulva efficiency
assays were carried out according to Barr and Sternberg
(1999). Briefly, 12 unc-31(e169) young adult hermaphrodites
were placed on a 1-cm bacteria lawn on an NGM agar plate.
Males were added to the mating plate and observed for 5 min.
Response efficiency reflects the percentage of males that
successfully responded to hermaphrodite contact within
10 min. An individual male’s vulva-location ability was calculated as inverse of the number of times the male encountered
the vulva before successfully locating it. In all experiments, at
least 20 animals were scored per experimental trial. Triplicate
trials were performed for each line to obtain statistical data.
Mating efficiency assays were carried out as described by
Hodgkin (1983). Mating efficiencies were calculated as the
Ciliary Specialization in C. elegans
percentage of cross progeny divided by the number of total
progeny.
Dye-filling assay: A modified dye-filling method was used so
that in addition to amphid and phasmid neurons, IL2 neurons
were also stained (Burket et al. 2006). Stock solution (2.5 mg/ml)
of 1,19-dioctadecyl-3,3,39,39-tetramethylindocarbocyanine
perchlorate (DiI, Molecular Probe cat. no. D-282) in N,Ndimethylformamide was stored at 4°. Healthy worms were
washed off plates with 50 mm calcium acetate, then washed
with 50 mm calcium acetate two more times. Worms were
immersed in 10 mg/ml DiI in 50 mm calcium acetate and
rotated gently for 2 hr. Worms were washed with water twice
and plated on fresh bacteria lawns for 30 min before scoring.
Mapping of n4132 and cloning of daf-19m: Three-factor
mapping placed n4132 on chromosome II to the right of
unc-4. Deficiency strains were used to map n4132 to the 1.99–
2.35 region. mnDf83 and mnDf29 failed to complement
n4132, while mnDf71, mnDf25, mnDf28, mnDf12, mnDf22, and
mnDf27 complemented n4132. PCR-amplified genomic DNA
was used in n4132 rescue experiments. n4132 genomic DNA
including 2 kb upstream and 1 kb downstream of the daf-19
gene was sequenced. A deletion flanked by the sequences
‘‘CACAAGCCACAAGCTA. . . . . .GCCACCGCCGAGCCA’’ [F33H1
GenBank: Z48783.1 10,466–10,969 nucleotides (nt)] was identified in n4132.
daf-19m cDNA isolation: mRNA was isolated from mixed
staged him-5(e1490) worms using the Oligotex mRNA Mini
Kit (Qiagen cat. no. 70022). The cDNA corresponding to daf19m was generated from oligo dT primed first-strand cDNA
by using SuperScript III First-Strand Synthesis System for
RT–PCR (Invitrogen, Carlsbad, CA), followed by amplification
with forward primer 59-atgagaagagtgtacgaaacg-39 and reverse
primer 59-gacctgcaggatgatgacga-39. The daf-19m sequence is
available at GenBank (EU812221.1).
Bioinformatics: Family Relationship II (Brown et al. 2005)
was used to identify conserved DNA sequences among
Caenorhabditis species.
Microscopy and image analysis: Live worms were mounted
on 2% agarose pads with 10 mm levamisol as described
previously (Bae et al. 2006). Fluorescence images were obtained
with an Axioplan 2 (Carl Zeiss MicroImaging, Oberkochen,
Germany) microscope equipped with a digital CCD camera
(Photometrics Cascade 512B; Roper Scientific), captured with
Metamorph software (Universal Imaging, West Chester, PA),
and then deconvolved with AutoDeblur 1.4.1 (Media Cybernetics). Photoshop (Adobe) was used for image rotation,
cropping, and brightness/contrast adjustments.
RESULTS
The n4132 mutation disrupts sensory but not
ciliogenic gene expression in male-specific PKD
neurons and core IL2 neurons: To understand how
cilia are specialized for sensory functions, we characterized the n4132 mutant, which was isolated on the basis
of the loss of Ppkd-2TGFP expression in male-specific
CEM head neurons. n4132 mutant males do not express
lov-1, pkd-2, or klp-6 GFP reporters in the male-specific
CEMs, HOB, and RnB neurons, herein referred to as the
PKD neurons (Figure 1, C, D, G, and H; Table 1). n4132
also disrupts KLP-6TGFP expression in the core IL2
neurons of males and hermaphrodites from embryogenesis through adulthood (Table 1). Five cwp (coex-
1297
pressed with polycystin) genes share an identical
expression pattern with lov-1 and pkd-2 (Portman and
Emmons 2004; Miller and Portman 2010), with a fulllength CWP-1TGFP translational fusion also expressed
in IL2 neurons (Table 1). n4132 abolishes CWP-1T
GFP expression in IL2 and PKD neurons (Table 1). The
nlp-8 neuropeptide gene reporter is expressed in core
neurons (PVT in the tail and some amphid neurons
including ASK and ADL in the head) and in the malespecific HOB neuron (Nathoo et al. 2001). n4132
specifically disrupts Pnlp-8TGFP in HOB without affecting expression in core neurons (Table 1). The TRPV
channel osm-9 is expressed in the male-specific PKD
neurons, core IL2 neurons, and core neurons in the
amphid and phasmid sensilla (Colbert et al. 1997;
Knobel et al. 2008). In n4132 animals, osm-9 expression is disrupted only in the IL2 and PKD neurons
(compare n4132 in Figure 1, K and L to wild type in
Figure 1, I and J; Table 1). In contrast, the daf-19(m86)
null allele abolishes osm-9 expression in PKD and all
core neurons [compare daf-19(m86) in Figure 1, M and
N to wild type in Figure 1, I and J].
To determine whether n4132 acts specifically in a
subset of ciliated sensory neurons or plays a broad role
in the ciliated nervous system, we examined a battery of
ciliary GFP reporters. n4132 does not affect ciliogenic
gene expression of intraflagellar transport (IFT) component OSM-6TGFP in PKD, core IL2, or other ciliated
sensory neurons (compare n4132 in Figure 1, Q and R
to wild type in Figure 1, O and P; Table 1). n4132 does
not affect ciliogenic gene expression of other IFT
reporters including osm-5, bbs-1, bbs-2, bbs-5, and daf-10
in PKD, core IL2, and other ciliated sensory neurons
(Table 1). The odorant receptor odr-10 and guanylate
cyclase (gcy-5 and gcy-32) genes that are expressed in the
core nervous system are not affected by the n4132
mutation (Table 1). We conclude that the n4132
mutation specifically disrupts expression of sensory
signaling genes in IL2 and PKD neurons (pkd-2, lov-1,
klp-6, cwp-1, nlp-8, and osm-9) without affecting genes
required for ciliogenesis or acting in other ciliated
sensory neurons.
Like pkd-2, lov-1, and klp-6 mutants, n4132 males exhibit response and Lov defects (Figure 2A). The response
efficiency of n4132 males is not significantly different
from the lov-1; pkd-2 double mutant (35% of mutant
males respond to contact with a hermaphrodite compared
to 95% of wild-type males, Figure 2A). However, n4132
males exhibit more severe Lov defects than lov-1; pkd-2
mutants (Figure 2A). n4132 mutant males are able to
sire cross progeny in 24-hr mating efficiency assays, albeit
at lower levels than lov-1; pkd-2 double mutant males
(Figure 2B). We conclude that n4132 affects male mating behavior, consistent with a role in functional specialization of PKD ciliated sensory neurons.
n4132 is a hypomorphic, recessive allele of daf-19:
We mapped n4132 to a small region near the daf-19
1298
J. Wang, H. T. Schwartz and M. M. Barr
Figure 1.—daf-19(n4132) disrupts expression of sensory
but not ciliogenesis genes in core IL2 and male-specific
PKD neurons. The cartoon shows the cell body positions of
CEM, IL2, and amphid neurons in the male head, HOB,
RnB, and phasmid in the male tail. (A, B, E, F) In wild-type
males, LOV-1TGFP and PKD-2TGFP are expressed in four
CEM, one HOB, and 16 RnB (n ¼ 1–9 but not 6) neurons.
(C, D, G, H) In n4132 males, LOV-1TGFP and PKD-2TGFP
expression is completely abolished. Autofluorescence is observed in the intestine as well as the sclerotized hook and spicule structures of the male tail. (I and J) In wild type, osm-9
is expressed more broadly in ciliated sensory neurons, including the male-specific PKD neurons and core IL2, amphids,
and phasmids (Colbert et al. 1997; Knobel et al. 2008). (K
and L) In daf-19(n4132), osm-9 is not expressed in core IL2,
male-specific CEM neurons, and 50% of HOB and RnB neurons. In those cells having osm-9 expression, the expression
level is reduced (see also Table 1). (K and L) daf-19(n4132)
does not affect osm-9 expression in core amphids or phasmids.
(M and N) In daf-19(m86) null males, osm-9 expression is completely abolished. (O–R) In wild-type and n4132 males, the
osm-6 ciliogenic gene is expressed in all ciliated neurons. Cil-
locus on chromosome II. Rescue of the PKD-2TGFP
expression, response, and Lov defects was obtained by
transforming n4132 animals with cosmid F33H1 or
ORF F33H1.1, which contains the RFX TF gene daf-19.
To identify the lesion in daf-19, we sequenced n4132
genomic DNA including 2 kb upstream and 1 kb downstream noncoding regions. The n4132 allele contains
a 504-bp deletion within the fifth intron of the daf-19
genomic clone (F33H1, GenBank: Z48783.1) deleted
10,466–10,969 nt, Figure 3A). In contrast, the daf19(m86) null allele introduces a stop codon in exon 7
(F33H1, GenBank: Z48783.1; nt 9760 C to T) before all
conserved domains, including the DNA binding domain (DBD) and DNA dimerization (DIM) domain
(Figure 3A) (Swoboda et al. 2000).
daf-19(m86) null animals resemble n4132 mutants
in that pkd-2 expression in PKD neurons and nlp-8
expression in HOB is abolished ( Yu et al. 2003).
However, n4132 is distinct from other daf-19 alleles
(m86, sa190, and sa232), which do not express ciliogenic
genes like osm-6 and do not form cilia. The daf-19 alleles
m86, sa190, sa232, m334, and m407 also result in constitutive formation of dauer larvae (Daf-c) (Malone and
Thomas 1994; Swoboda et al. 2000), whereas the n4132
mutant is not Daf-c (Table 2). In daf-19(m86), IL2,
amphid, and phasmid ciliated sensory neurons fail to
fill with lipophilic fluorescent dyes (Perkins et al. 1986).
This dye-filling defective (Dyf) phenotype is indicative
of cilium structure defects. In n4132 animals, IL2,
amphid, and phasmid cilia are intact, as judged by
fluorescent dye uptake (200/200 animals normal in dyefilling assays) and visualization of an OSM-6TGFP reporter in amphid, phasmid, and male-specific sensory
cilia (Figure S1; Figure 1, compare panels O and P with
Q and R). That the IL2 neurons of n4132 animals are
not Dyf, do express ciliogenic reporters, but do not express sensory genes strongly suggests that daf-19(n4132)
affects the function but not development of IL2 cilia.
To genetically confirm that n4132 is an allele of daf-19,
we performed complementation tests between n4132
and the daf-19 Daf-c alleles m86, sa190, sa232, m334,
and m407 (Table 2). n4132 complements the Daf-c
phenotypes of m86, sa190, sa232, m334, and m407.
Conversely, the daf-19 alleles m86, sa190, and sa232
failed to complement n4132 PKD-2TGFP expression
defects (Table 2). The Tc1 transposon insertion alleles
of daf-19 m334 and m407 map to the fifth intron of the
daf-19 genomic clone (Figure 3A), are in opposite
orientations (m334 is 59 to 39 while m407 is 39 to 59)
(Swoboda et al. 2000), and exhibit varying defects in
PKD-2TGFP expression (Table 2). m334 is defective
in PKD-2TGFP expression in the CEMs but has normal
iary transition zones and ciliary axonemes are visible in wildtype and daf-19(n4132) males (arrowheads). In daf-19(m86)
males, lov-1, pkd-2, and osm-6 expression is completely abolished (Swoboda et al. 2000; Yu et al. 2003). Bar, 10 mm.
Ciliary Specialization in C. elegans
1299
TABLE 1
Comparison of reporter expression pattern in wild type and daf-19 mutant worms
Expression pattern
Reporter
Hermaphrodite
LOV-1TGFP
CEM
HOB
RnB
CEM
HOB
RnB
PKD-2TGFP
KLP-6TGFP
Male
IL2
IL2
CEM
HOB
RnB
CWP-1TGFP
Pnlp-8TGFP
Posm-9TGFP
Posm-5TGFP
OSM-6TGFP
DAF-10TGFP
bbs-1TGFP
bbs-2TGFP
bbs-5TGFP
ODR-10TGFP
gcy-5TGFP
gcy-32TGFP
IL2
IL2
CEM
HOB
RnB
HOB
ASK and ADL
IL2
Amphid and
phasmid
IL2
CEM
HOB
RnB
Amphid and phasmid
sensory neurons
sensory neurons
sensory neurons
sensory neurons
sensory neurons
sensory neurons
All ciliated
All ciliated
All ciliated
All ciliated
All ciliated
All ciliated
AWA
ASER
URX, AQR, and PQR
expression in HOB and RnB tail neurons. The n4132/
m334 heterozygote has nearly normal PKD-2 expression:
92% of males express PKD-2TGFP in CEMs, 100% of
males express PKD-2TGFP in HOB, and 83% of males
express PKD-2TGFP in a subset of RnB neurons. The
m407 allele does not affect PKD-2TGFP and only
partially complements n4132. n4132/m407 heterozygotes exhibit normal HOB expression but only express
PKD-2TGFP in only a subset of CEM and RnB neurons.
These results indicate that pkd-2 expression in CEM,
HOB, and RnB neurons is differentially regulated, that
the directionality of the Tc1 insertion impacts PKD2TGFP expression, and that n4132 displays complex
interactions with m334 and m407. We conclude that
the n4132 mutation disrupts a particular aspect of
daf-19 function by affecting sensory gene expression
in PKD and IL2 neurons, but does not act globally in
the ciliated nervous system.
Genotype (% worm with wild-type reporter expression)
WT
daf-19(n4132)
100
100
100
100
100
100
100
100
100
100
100
100
100
100
100
100
100
100
100
100
0
0
0
0
0
0
24
13
0
0
2
0
0
0
0
0
0
100
0
99
96
98
98
96
96
100
100
100
100
100
100
100
100
100
0
0
47
40
98
100
100
100
100
100
100
100
100
100
n4132 specifically disrupts the daf-19m isoform:
The predicted daf-19 gene encodes three isoforms,
DAF-19A, DAF-19B, and DAF-19C with alternative splicing
and an internal promoter (Figure 3A) (Senti and
Swoboda 2008). daf-19a/b are required for synaptic
maintenance while daf-19c is necessary and sufficient for
ciliogenesis (Senti and Swoboda 2008; Senti et al.
2009). We identified a fourth cDNA isoform by RT–PCR
using mRNA from mixed-stage, mixed-sex culture
(Figure 3B) (accession no. EU812221.1). We refer to
this new isoform as DAF-19M for its apparent function in
regulating mating behavior and gene expression in PKD
neurons. daf-19m starts with an unique exon containing
a 166 bp 59-UTR and an 11-amino-acid (aa)-coding
region not present in other isoforms, followed by exon
6 and the DNA sequence shared among all daf-19
isoforms (Figure 3C). Based on the cDNA sequence,
daf-19m encodes a predicted 622-aa protein. All four
1300
J. Wang, H. T. Schwartz and M. M. Barr
Figure 2.—daf-19(n4132) males are response, Lov (location
of vulva), and mating efficiency defective. (A) Response and
location of vulva efficiency was scored for each genotype.
n4132 males exhibit behavioral efficiency defects when compared to wild type (P , 0.01 for both Response Efficiency and
Location of vulva Efficiency assay). n4132 and lov-1;pkd-2 have
comparable response efficiencies. n4132 males have a more
severe Lov defect than lov-1; pkd-2 double mutants. (B)
n4132 males are able to sire progeny, but mating efficiency
is significantly lower than lov-1; pkd-2 double mutant (P ,
0.01). Error bars indicate standard error of the mean. An asterisk indicates a significant difference between n4132 and
lov-1; pkd-2 (*P , 0.01). NS, not significantly different. Statistical analyses were performed by nonparametric Mann–Whitney
tests with a two-tailed P-value.
daf-19 isoforms encode the same DNA binding and
DNA dimerization domains. In the daf-19(n4132)
background, the daf-19m but not daf-19a or daf-19b
cDNA is absent as determined by RT–PCR (Figure 3B).
From a mixture of cDNA clones, we obtained one copy
of daf-19b and 29 daf-19a cDNAs, indicating the latter
is more abundant. We infer that daf-19c is intact,
because daf-19(n4132) animals form cilia as judged
by dye filling, IFT reporters, and non-Daf-c phenotype.
We conclude that daf-19(n4132) specifically disrupts
daf-19m, a specific isoform of daf-19 required for
functional specialization of a subset of ciliated neurons.
To determine how the n4132 lesion affects daf-19m,
we identified a minimal-sized fragment capable of
phenotypic rescue. PCR2, a PCR amplicon that lacks
the predicted promoter and exons 1 to 2 of daf-19a/b
(6826–17819 in F33H1 GenBank: Z48783.1), fully
rescues the n4132 PKD-2TGFP expression and mating behavior defects (Figure 3C). A shorter fragment
(PCR3) lacking all coding and noncoding regions
of daf-19a/b to intron five (6828–14,217 in F33H1
GenBank: Z48783.1) and exons 1 and 2 of daf-19c,
rescues PKD-2TGFP expression in tail but not head
neurons. PCR3 also rescues n4132 Lov defects but not
response defects. Introducing the n4132 molecular
lesion into PCR3 to generate PCR4 (6828–14,217 in
F33H1 GenBank: Z48783.1, with deletion 10,466 to
10,969) does not rescue any n4132 defects, indicating
that those deleted elements are required to activate
PKD-2TGFP expression in the tail.
daf-19m is expressed in IL2 and PKD neurons via
discrete regulatory elements: To determine DAF-19M
site of action, we examined daf-19m expression patterns by fusing the putative daf-19m promoter, a 1-kb
region upstream of exon 6 to GFP, resulting in the
P1daf-19mTGFP reporter (Figure 4B). P1daf-19mTGFP
is specifically expressed in the male tail HOB and RnB
neurons but not in male-specific CEM head neurons or
other ciliated neurons. This result is consistent with
PCR3 rescue of PKD-2TGFP expression in tail HOB
and RnB but not head CEM neurons.
To determine the element(s) responsible for daf-19m
activity in core IL2 and male-specific CEM head neurons, we used comparative genomics. The genomes of
three Caenorhabditis species (elegans, briggsae, and
remanei) contain daf-19, lov-1, pkd-2, and klp-6, suggesting a possible conserved transcriptional regulatory
pathway. Interspecific comparisons of noncoding regions enable identification of cis-acting regulatory
elements that control gene expression and that are
evolutionarily constrained. By comparing intronic daf19 sequence of C. elegans, C. briggsae, and C. remanei, we
identified a 22-bp conserved sequence in intron two of
daf-19a/b and outside of the daf-19c regulatory and
genomic regions, located 5572 bp from the daf-19m
start codon (Figure 4A and Figure S2) (Senti and
Swoboda 2008). Adding this 22-bp element to P1daf19mTGFP (generating P4daf-19mTGFP) drives GFP
expression in the male-specific PKD head and tail
neurons and core IL2 neurons (Figure 4, C–E). We
conclude that this 22-bp sequence acts remotely as
a daf-19m CEM/IL2 element. The CEM and IL2
neurons are born embryonically, yet daf-19m is expressed in distinct temporal patterns. In core IL2s,
P4daf-19mTGFP is expressed throughout development
in males and hermaphrodites. In male-specific CEMs,
P4daf-19mTGFP expression commences in the mid to
late L4 male, a stage that coincides with pkd-2 expression and the onset of sexual maturity. daf-19(n4132)
animals have a deletion in the HOB/RnB region but
retain the CEM/IL2 element, yet do not express the
PKD sensory genes in both head and tail neurons.
Ciliary Specialization in C. elegans
1301
Figure 3.—n4132 is a hypomorphic
allele of daf-19 that specifically disrupts DAF-19M, an isoform of the RFX
TF required for male mating behaviors.
(A) Genomic structure of daf-19 isoforms and the locus mutated in
n4132. The daf-19(n4132) hypomorphic allele is a deletion in the fifth
intron of the daf-19b predicted structure. White boxes are exons, light gray
regions are untranslated regions
(UTRs). (B) The daf-19m cDNA was
amplified by RT–PCR from total mRNA
of wild-type mixed-stage and mixed-sex
cultures and sequenced (accession no.
EU812221). In n4132 animals, the daf19m but not daf-19a/b cDNA is absent.
(C) Diagram of daf-19m genomic rescue of daf-19(n4132) defects in PKD2TGFP expression and male mating
behavior (RE, response efficiency; LE,
location of vulva efficiency). daf-19m
cDNA structure compared to the daf-19b isoform. daf-19m uses an internal promoter (in the fifth predicted intron) and a distal
upstream element (in the second predicted intron) but shares the DBD and DIM domain with daf-19a/b. daf-19 genomic
fragments were scored for the ability to rescue n4132 PKD-2TGFP expression and behavioral defects (restoration of RE and
LE). Both PCR1 and PCR2 fully rescue daf-19(n4132) defects. PCR2 lacks the promoter and two exons of daf-19a/b and contains the daf-19c and daf-19m genomic regions. The shorter PCR3 fragment rescues PKD-2TGFP expression in tail (HOB and
RnB) but not head (CEM) neurons. PCR3 rescues n4132 Lov but not response defects (normal LE, abnormal RE). PCR4, made
by introducing the n4132 molecular lesion to PCR3, abolishes rescue of n4132.
These data indicate that the CEM/IL2 remote element
depends upon the HOB/RnB promoter region.
To identify the essential HOB/RnB element, the 504-bp
n4132 molecular lesion was introduced to P1daf19mTGFP1, generating P2daf-19mTGFP. This lesion
abolished HOB and RnB expression (P2daf-19mTGFP
in Figure 4B). To define the HOB/RnB element, we
compared this 504-bp region among C. elegans, C.
briggsae, and C. remanei and identified a 13-bp conserved
element located 93 bp from the daf-19m start codon
(Figure 4A). Deletion of this 13-bp element (P3daf19mTGFP) destroyed HOB and RnB expression of daf-
19m (Figure 4B). Moreover, daf-19m expression from
the CEM/IL2 element depends on this 13-bp element
(P5daf-19mTGFP in Figure 4, F–H). In summary, we
identified two elements that confer precise spatial and
temporal regulation to daf-19m: the HOB/RnB element
and the CEM/IL2 remote enhancer element.
DAF-19M is sufficient to drive PKD-2TGFP expression and localization in core IL2 and male PKD
neurons: To test daf-19m function, we fused a daf-19m
cDNA or genomic fragment to GFP reporter and scored
for rescue of n4132 PKD-2TGFP expression defects.
DAF-19M is nuclear localized (Figure S3A), while PKD-
TABLE 2
Complementation tests between n4132 and other daf-19 alleles
pkd-2 expression
Genotype
n4132/n4132
m86/m86
n4132/m86
n4132/sa190
n4132/sa232
m334/m334
n4132/m334
m407/m407
n4132/m407
a
Daf-C
CEM
HOB
RnB
Number
Non-Daf-C
Daf-C
Non-Daf-C
Non-Daf-C
Non-Daf-C
Daf-C
Non-Daf-C
Daf-C
Non-Daf-C
—
—
—
—
—
—
1(92%)
1
183%b
—
—
—
—
—
1
1
1
1
—
—
—
—
—
1
183%a
1
130%b
.100
20
20
20
20
23
12
20
30
These males express PKD-2TGFP in two to five pairs of RnB (compared to eight pairs of RnB neurons in wild
type).
b
One to three CEM neurons express PKD-2TGFP (as opposed to four CEM neurons in wild type).
1302
J. Wang, H. T. Schwartz and M. M. Barr
Figure 4.—daf-19m is exclusively
expressed in male-specific PKD neurons and core IL2 neurons. (A) Discrete cis-regulatory elements regulate
daf-19m expression in head (CEM/
IL2) and tail (HOB/RnB) neurons.
The CEM/IL2 and HOB/RnB elements are conserved among Caenorhabditis species C. elegans (Ce), C.
briggsae (Cb), and C. remanei (Cr).
(B) Diagram of daf-19m promoterTGFP reporters and their relationship to daf-19 and the n4132
deletion. (C and F) In hermaphrodites, P4daf-19mTGFP is expressed
in IL2 neurons (C) and abolished
in P5daf-19mTGFP by deleting the
HOB/RnB element (F). (D and E,
G and H) In the male, P4daf19mTGFP is expressed in IL2 and
CEM head neurons (D) and HOB
and RnB tail neurons (E), and is
completely abolished in P5daf19mTGFP, which removes the 13-bp
HOB/RnB element (G and H).
Bar, 10 mm.
2TGFP is nonnuclear and localized to the cell body and
cilia (Figure S3B). The distinct DAF-19M nuclear and
PKD-2 cytoplasmic/ciliary subcellular distribution patterns enable visualization of both reporters (Figure 5,
B–J; Figure S3C). Expression of the full length daf-19m
cDNA using the daf-19m P1 promoter did not rescue
PKD-2TGFP expression in n4132 tail HOB/RnB or
head CEM/IL2 neurons (data not shown). Swoboda
et al. (2000) reported that a genomic segment (from
3 kb upstream of daf-19a/b start codon to the DNA
binding domain coding region) fused to GFP (pJT1228)
fully rescued daf-19(m86) ciliogenesis defects, indicating
that the DIM domain is not required for transcription
activation activity of daf-19 (Swoboda et al. 2000). We
therefore generated a daf-19m genomic fragment containing the P1 promoter, 59-UTR and regions up to and
including the DNA binding domain-encoding region
fused to GFP reporter (P1daf-19mTDAF-19DDIMTGFP).
This construct rescued n4132 PKD-2TGFP expression
and localization in male tail HOB and RnB neurons.
Including the 22-bp CEM/IL2 remote element in P4daf19mTDAF-19DDIMTGFP induced PKD-2TGFP expression and localization in CEM, HOB, and RnB neurons,
similar to PKD-2TGFP expression and localization in
wild-type males. In PKD neurons, daf-19m is necessary
and sufficient for functional specialization neurons, is
not autoregulated, and does not require a DIM domain
in this context. In IL2 neurons, P4daf-19mTDAF19DDIMTGFP ectopically induced PKD-2TGFP expression and ciliary localization in both male and
hermaphrodite throughout embryogenesis, larval development, and adulthood in the n4132 background
(Figure 5A). This result suggests that the DIM domain
may be required for regulation of DAF-19M activity in
IL2 neurons.
To determine whether DAF-19M function is sufficient and independent of DAF-19C, we used a panneural promoter (Punc-119) to drive expression of the
genomic DAF-19MDDIMTGFP fragment (Punc-119T
DAF-19MDDIMTGFP) in wild-type, daf-19(n4132), and
daf-19(m86) backgrounds. In the daf-19(m86) null mutant, Punc-119TDAF-19MDDIMTGFP does not rescue dyefilling phenotype in amphid, phasmid, or in IL2
neurons (0%, n ¼ 100), indicating that daf-19m cannot
substitute for daf-19c function in ciliogenesis. However,
Punc-119TDAF-19MDDIMTGFP does activate PKD2TGFP expression in male-specific PKD and core IL2
neurons of daf-19(m86) mutants, indicating that daf-19m
Ciliary Specialization in C. elegans
1303
Figure 5.—daf-19m function is
restricted to IL2 and PKD neurons and is sufficient for PKD-2
expression. (A) Genomic structure and rescuing fragments of
daf-19. daf-19 isoforms differ in
the 59 exons. Isoform-specific
exons are labeled accordingly
(a, b, c, or m); no label indicates
an exon conserved among all
four isoforms. P1daf-19mTDAF19MDDIMTGFP rescues PKD2TGFP expression in the tail
but not head neurons of n4132
males. Including the 22-bp CEM
and IL2 element in P4daf19mTDAF-19MDDIMTGFP rescues PKD-2TGFP expression in
head and tail neurons of n4132
animals. (B–J) Pan-neuronal
expression of daf-19m (Punc119TDAF-19MDDIMTGFP) is sufficient to drive PKD-2TGFP
expression and localization in
core IL2 and male-specific PKD
neurons, but is insufficient to induce PKD-2TGFP expression
outside of the endogenous daf19m expressing neurons. (B and
C) In wild-type hermaphrodites
and males, pan-neural expression
of daf-19mDDIM is sufficient to induce PKD-2TGFP expression
and ciliary localization in core
IL2. (C and D) In wild-type
males, PKD-2TGFP expression
remains restricted to IL2 and male-specific PKD neurons with Punc-119TDAF-19MDDIMTGFP. (E–J) In daf-19(n4132) and daf19(m86) backgrounds, pan-neuronal expression of daf-19mDDIM rescues PKD-2TGFP expression in male-specific PKD neurons
and ectopically in core IL2 neurons, indicating that DAF-19M is necessary and sufficient for pkd-2 expression. PKD-2TGFP is nonnuclear and localizes to cell bodies (small arrows) and cilia (arrowheads) or dendritic tips in daf-19(m86) (H–J). Bar, 10 mm.
is sufficient to drive pkd-2 expression independent of
daf-19a/b/c (Figure 5, H–J).
In all three genetic backgrounds, Punc-119TDAF19MDDIMTGFP does not induce expression of PKD2TGFP in other ciliated neurons, with exception of IL2
neurons. This observation suggests that DAF-19M function
is restricted to PKD and IL2 neurons by unidentified
positive and/or negative regulators. Similarly, PKD2TGFP ciliary localization requires cell-type specific
transporting components that are only present in PKD
neurons (Bae et al. 2006), but have the potential to be
ectopically expressed in IL2 neurons by DAF-19MDDIM
overexpression. In IL2 neurons overexpressing daf19mDDIM (Punc-119TDAF-19MDDIMTGFP or P4daf19mTDAF-19MDDIMTGFP), PKD-2TGFP is expressed
and localized to cilia or distal dendrites in cilia-less daf19(m86) animals, indicating that the cell type-specific
transporting components are under the control of
daf-19m.
egl-46 acts upstream of daf-19m in a cell type-specific
manner: Previous work of Sternberg and colleagues
showed that the zinc finger TF EGL-46 is a cell-specific
TF that regulates HOB differentiation, while daf-19
regulates lov-1 and pkd-2 expression in all PKD neurons (Yu et al. 2003). The GFP-tagged daf-19 genomic
clone that rescues daf-19 ciliogenesis defects is expressed in all ciliated neurons in the hermaphrodite
as well as in all 36 ray neurons (RnA and RnB) and both
hook neurons (HOA and HOB) in the male tail
(Swoboda et al. 2000; Yu et al. 2003). Yu et al. (2003)
also showed that daf-19(m86) is not defective in egl-46
expression, and egl-46 is not required for daf-19 expression, leading to the proposal that daf-19 and egl-46
act in distinct pathways to regulate gene expression in
the HOB neuron.
On the basis of work by the Swoboda lab (Senti and
Swoboda 2008) and shown here, we now know that
the GFP-tagged daf-19 genomic reporter (2.9 kb of the
daf-19 promoter and 10 kb of daf-19 genomic sequence just downstream of the DBD domain fused to
GFP) includes the promoters of all daf-19 isoforms:
a, b, c, and m (Figure 3A). To determine the relationship of daf-19m and egl-46, we examined daf-19m
expression in egl-46 mutant males. Surprisingly, we
1304
J. Wang, H. T. Schwartz and M. M. Barr
Figure 6.—egl-46 is required for
daf-19m expression in the HOB
neuron. (A and D) In wild-type
and egl-46 hermaphrodites, daf19m is expressed in IL2 neurons.
(B and C) In the wild-type male,
daf-19m is expressed in IL2 and
CEM neurons in the head and
the HOB and RnB neurons in
the tail. (E) In the egl-46 male
head, daf-19m is expressed in IL2
and CEM neurons. (F) In the egl46 male tail, daf-19m expression is
lost in the HOB neuron but intact
in RnB neurons. Arrowheads point
to rays 4 and 5.
found that egl-46 is required for daf-19m expression
only in HOB, but not in any other cell types (Figure 6).
egl-46 hermaphrodites exhibit normal daf-19m expression
in IL2 neurons (n ¼ 20 animals, 120/120 cells; Figure 6,
A and D). In egl-46 males, 20/22 males do not express daf19m in HOB neuron (Figure 6F), while 22/22 males
exhibit normal daf-19m expression in head CEM and IL2
neurons (Figure 6E) and tail RnB (Figure 6F). We
conclude that that egl-46 acts upstream of daf-19m to
regulate PKD gene expression specifically in the HOB
neuron but not other PKD neurons.
DISCUSSION
RFX TFs perform an evolutionarily conserved role in
ciliogenesis (Silverman and Leroux 2009; Thomas
et al. 2010). Cilia are highly specialized for functions in
signal transduction, development, or motility (Marshall
and Nonaka 2006). On the other hand, all cilia and
flagella are built by the evolutionarily conserved intraflagellar transport (IFT) machinery, which was first
identified in the unicellular algae Chlamydomonas
(Kozminski et al. 1995). By contrast, ciliogenesis in
metazoa depends on RFX TFs (Chu et al. 2010). The
C. elegans genome encodes a sole RFX TF DAF-19, in
contrast to two in Drosophila melanogaster, nine in Danio
rerio, and seven in the genomes of Mus musculus and
Homo sapiens (Chu et al. 2010; Thomas et al. 2010).
Swoboda and colleagues demonstrated that the daf-19
locus encoded three isoforms, with the daf-19c isoform
being necessary and sufficient for ciliogenesis (Swoboda
et al. 2000; Senti and Swoboda 2008; Senti et al. 2009).
Our study provides the first evidence that a fourth tissuespecific isoform, daf-19m, regulates the functional specialization but not formation of cilia.
C. elegans diversifies gene function by internal promoters that generate spatial–temporal specific isoforms
(Choi and Newman 2006). As the sole RFX TF in
C. elegans, daf-19 encodes distinct isoforms that function in synaptic maintenance (DAF-19A/B), ciliogenesis
(DAF-19C), and ciliary functional specialization (DAF19M) (Senti and Swoboda 2008). Senti et al. (2009)
showed that in some core ciliated neurons (ASER, ADF,
ASH, AWC, PHA, and PHB) expression of the daf-19c
isoform is necessary and sufficient to generate a fully
functional cilium. However, in another ciliated neuron
(ASJ), daf-19c expression is insufficient to rescue the
ASJ dye-filling defect of daf-19(m86) null animals, suggesting additional function from the daf-19 locus is
required to generate a fully functional cilium in some
contexts. Our work shows that the daf-19m isoform is
required for cilia specialization in the male-specific PKD
neurons and core IL2 neurons. The daf-19m isoform is
not required for dauer formation, ciliogenesis, or for
expression of ciliogenic genes. Conversely, the daf-19
Tc1 insertion allele m407 is Daf-c without affecting
PKD-2TGFP expression, indicating that these daf-19
functions are genetically separable. Expression of daf19m using a pan-neural promoter does not rescue daf19(m86) dye-filling defects but is sufficient to activate
PKD-2TGFP expression and localization. These results
indicate that daf-19m specifically regulates genes required for sensory signaling in a daf-19c-independent
manner. We conclude that in some sensory neurons, daf19c is sufficient for the development and functional
specialization of a cilium, whereas in PKD and IL2
neurons, pan-ciliary daf-19c regulates generic ciliogenesis while the tissue-specific daf-19m isoform controls
functional specialization.
This model raises the question of how similar and
coexpressed RFX isoforms target different gene batteries (ciliogenic vs. sensory genes). In mammalian genomes, genes with alternative promoters are common
(Davuluri et al. 2008). Mammalian RFXs have alternative isoforms, with RFX3 encoding eight (Aftab et al.
2008) and RFX4 encoding six (Zhang et al. 2007).
Similar to the case for daf-19, RFX3 regulates two
categories of genes: those involved in ciliary assembly
and in ciliary motility (El Zein et al. 2009). Rfx4_v3 is a
novel brain-specific isoform, which was identified on
the basis of mutant phenotype of transgene inserted
into an intron (Zhang et al. 2007), which is reminiscent of daf-19m identification, based on n4132 mutant phenotypes. RFX TFs bind to the X-box motif,
Ciliary Specialization in C. elegans
which is common in the genome. In C. elegans, there are
700 predicted X-box genes (Efimenko et al. 2005; Chen
et al. 2006). In human, the L1 regulatory motif that is
similar to X box is most highly enriched regulatory
motif in the genome (Xie et al. 2007). In addition to the
canonical X-box promoter motif, genes expressed in
ciliated cell types may have half an X box, a modified X
box, or as of yet unidentified regulatory elements in
their promoters (Piasecki et al. 2010). Given the
multiplicity of X boxes, noncanonical X boxes, and
RFX TFs, how is ciliary gene expression temporally and
spatially regulated?
DAF-19C target genes contain authentic X-box motif
in the proximal promoter region (GTHNYY AT
RRNAAC within 250 bp from the start codon) (Efimenko
et al. 2005; Senti and Swoboda 2008). However, DAF-19M
isoform target genes do not have a canonical, half, or
modified X box in their promoters. In a similar
scenario, FKH-2, the C. elegans homolog of Foxj1, the
master regulator of motile cilia in mammals, is required
for the specialization of AWB cilia, regulated by daf-19,
but does not contain an X box in its promoter
(Mukhopadhyay et al. 2007). Hence, the daf-19 locus
might regulate target genes in different ways: generic
cilia development genes may be directly regulated by
DAF-19C via binding to X-box motif, whereas the cilia
specialization genes may be directly regulated by DAF19 via unidentified promoter motifs or indirectly
regulated by DAF-19 through TF cascades.
In the HOB neuron, the EGL-46 zinc finger TF acts
upstream of daf-19m to control PKD gene battery
expression. In other PKD neurons (IL2s, CEMs, and
RnBs), egl-46 plays no apparent role in daf-19m or PKD
gene battery regulation. EGL-46 shares sequence similarity with mouse Insm1, a zinc finger TF essential or
pancreatic islet cell development (Gierl et al. 2006).
Intriguingly, Rfx6 is coexpressed with Insm1 in mouse
embryonic E15.5 pancreas (Soyer et al. 2010). In the
mouse pancreas, Rfx6 is not required for ciliogenesis or
expression of cilia genes (Smith et al. 2010). Rather,
authors propose that Rfx3 and Rfx6 heterodimer or
Rfx6 homodimer may regulate genes involved in
islet development, but not ciliogenesis (Smith et al.
2010). The epistatic relationship between Rfx6 and
Insm1 in mouse is not known. Given the relative simplicity of C. elegans, the identification of daf-19m direct
targets, PKD gene battery cis-regulatory elements, and
PKD gene battery direct regulators will reveal how
ciliated cells are molecularly programmed to generate
a functionally specialized cilium.
DAF-19M shares the conserved DBD and DIM domains with known DAF-19 isoforms. RFX homo- or
heterodimer formation may transcriptionally activate or
repress different sets of genes according to cell typespecific functional requirements. The RFX1 DIM domain may play a repressive function (Katan et al. 1997).
For example, the Saccharomyces cerevisiae RFX CRT1
1305
functions as a transcriptional repressor in a DNA
damage and replication block checkpoint pathway
(Huang et al. 1998). The DIM domain is not required
for daf-19c or daf-19m function in ciliogenesis or sensory gene expression in PKD neurons, respectively.
However, pan-neural expression of DAF-19MDDIM ectopically activates PKD-2TGFP expression and localization in IL2 neurons, suggesting the DIM domain may
have repressor function in this neuronal context. The
four isoforms of daf-19 use distinct promoters for
distinct spatial and temporal regulation, yet differ
only slightly in amino-terminal sequence. DAF-19A and
DAF-19B differ in only 25 amino acids, although the
function of the two has not been separated. DAF-19C
and DAF-19M have only 22 and 11 unique amino
acids, respectively. At present, we do not know the role
of these short, unique N-terminal sequences in DAF-19
regulation or function, nor do we know the function of
the daf-19m 59-UTR on mRNA stability or translation.
The IL2 and CEM neurons are born during embryogenesis, whereas the tail HOB and RnB neurons are
born during the fourth larval (L4) stage before adulthood. daf-19m and the PKD gene battery are not
expressed in CEM neurons until the late L4 stage.
Expression of the daf-19m isoform is spatially regulated by two hierarchal cis-regulatory elements. An
internal promoter activates daf-19m expression in RnB
and HOB neurons after ray and hook sensilla development. Adding a remote enhancer element to the
RnB/HOB promoter drives daf-19m expression in IL2
and CEM head neurons. The CEM/IL2 enhancer
sequences are AT enriched. An ARID family TF CFI-1
(CEM neuron Fate Inhibition 1) binds to an AT rich
region and is required for the CEM fate inhibition
(Shaham and Bargmann 2002). However, cfi-1 is
not required for pkd-2 expression in CEM neurons
(Shaham and Bargmann 2002). Identifying the TFs
that activate daf-19m, daf-19m direct targets, and PKD
gene battery regulators will reveal how a cilium is
specialized in form and function.
We thank H. R. Horvitz, in whose lab the n4132 mutant was isolated;
P. Swoboda and G. Senti for sharing unpublished data and stimulating
discussions; P. Anderson, J. Kimble, Q. Mitrovich, and P. W. Sternberg
for critical intellectual input in the early stages of this work; Barr and
Swoboda lab members for constructive criticism of the manuscript; A.
Hart, M. Leroux, D. Riddle, P. W. Sternberg, and the Caenorhabditis
Genetics Center, which is funded by the National Institutes of Health
(NIH) National Center for Research Resources (NCRR) for strains.
We also thank the two anonymous reviewers for constructive criticism
and valuable experimental suggestions. This research was supported
by grants from the Polycystic Kidney Disease Foundation (to J.W.) and
NIH/National Institute of Diabetes and Digestive and Kidney Diseases
(to M.M.B.).
LITERATURE CITED
Aftab, S., L. Semenec, J. S. Chu and N. Chen, 2008 Identification
and characterization of novel human tissue-specific RFX transcription factors. BMC Evol. Biol. 8: 226.
1306
J. Wang, H. T. Schwartz and M. M. Barr
Ashique, A. M., Y. Choe, M. Karlen, S. R. May, K. Phamluong et al.,
2009 The Rfx4 transcription factor modulates shh signaling by
regional control of ciliogenesis. Sci. Signal. 2: ra70.
Bae, Y. K., and M. M. Barr, 2008 Sensory roles of neuronal cilia: cilia
development, morphogenesis, and function in C. elegans. Front.
Biosci. 13: 5959–5974.
Bae, Y. K., H. Qin, K. M. Knobel, J. Hu, J. L. Rosenbaum et al.,
2006 General and cell-type specific mechanisms target
TRPP2/PKD-2 to cilia. Development 133: 3859–3870.
Barr, M. M., and P. W. Sternberg, 1999 A polycystic kidney-disease
gene homologue required for male mating behaviour in C. elegans. Nature 401: 386–389.
Barr, M. M., J. DeModena, D. Braun, C. Q. Nguyen, D. H. Hall
et al., 2001 The Caenorhabditis elegans autosomal dominant polycystic kidney disease gene homologs lov-1 and pkd-2 act in the
same pathway. Curr. Biol. 11: 1341–1346.
Beckers, A., L. Alten, C. Viebahn, P. Andre and A. Gossler,
2007 The mouse homeobox gene noto regulates node morphogenesis, notochordal ciliogenesis, and left right patterning. Proc.
Natl. Acad. Sci. USA 104: 15765–15770.
Blacque, O. E., E. A. Perens, K. A. Boroevich, P. N. Inglis, C. Li
et al., 2005 Functional genomics of the cilium, a sensory organelle. Curr. Biol. 15: 935–941.
Bonnafe, E., M. Touka, A. AitLounis, D. Baas, E. Barras et al,
2004 The transcription factor RFX3 directs nodal cilium development and left-right asymmetry specification. Mol. Cell. Biol.
24: 4417–4427.
Brenner, S., 1974 The genetics of Caenorhabditis elegans. Genetics
77: 71–94.
Brown, C. T., Y. Xie, E. H. Davidson and R. A. Cameron,
2005 Paircomp, FamilyRelationsII and cartwheel: tools for interspecific sequence comparison. BMC Bioinformatics 6: 70.
Burket, C. T., C. E. Higgins, L. C. Hull, P. M. Berninsone and E. F.
Ryder, 2006 The C. elegans gene dig-1 encodes a giant member
of the immunoglobulin superfamily that promotes fasciculation
of neuronal processes. Dev. Biol. 299: 193–205.
Cavalier-Smith, T., 1978 The evolutionary origin and phylogeny of
microtubules, mitotic spindles and eukaryote flagella. BioSystems 10: 93–114.
Chasnov, J. R., W. K. So, C. M. Chan and K. L. Chow, 2007 The
species, sex, and stage specificity of a Caenorhabditis sex pheromone. Proc. Natl. Acad. Sci. USA 104: 6730–6735.
Chen, N., A. Mah, O. E. Blacque, J. Chu, K. Phgora et al.,
2006 Identification of ciliary and ciliopathy genes in Caenorhabditis elegans through comparative genomics. Genome Biol. 7: R126.
Choi, J., and A. P. Newman, 2006 A two-promoter system of gene
expression in C. elegans. Dev. Biol. 296: 537–544.
Chu, J. S., D. L. Baillie and N. Chen, 2010 Convergent evolution of
RFX transcription factors and ciliary genes predated the origin of
metazoans. BMC Evol. Biol. 10: 130.
Colbert, H. A., T. L. Smith and C. I. Bargmann, 1997 OSM-9, a
novel protein with structural similarity to channels, is required
for olfaction, mechanosensation, and olfactory adaptation in Caenorhabditis elegans. J. Neurosci. 17: 8259–8269.
Collet, J., C. A. Spike, E. A. Lundquist, J. E. Shaw and R. K.
Herman, 1998 Analysis of osm-6, a gene that affects sensory cilium structure and sensory neuron function in Caenorhabditis elegans. Genetics 148: 187–200.
Davuluri, R. V., Y. Suzuki, S. Sugano, C. Plass and T. H. Huang,
2008 The functional consequences of alternative promoter
use in mammalian genomes. Trends Genet. 24: 167–177.
Dubruille, R., A. Laurencon, C. Vandaele, E. Shishido, M.
Coulon-Bublex et al., 2002 Drosophila regulatory factor X is
necessary for ciliated sensory neuron differentiation. Development 129: 5487–5498.
Efimenko, E., K. Bubb, H. Y. Mak, T. Holzman, M. R. Leroux et al.,
2005 Analysis of xbx genes in C. elegans. Development 132:
1923–1934.
El Zein, L., A. Ait-Lounis, L. Morle, J. Thomas, B. Chhin et al.,
2009 RFX3 governs growth and beating efficiency of motile
cilia in mouse and controls the expression of genes involved
in human ciliopathies. J. Cell Sci. 122: 3180–3189.
Emery, P., B. Durand, B. Mach and W. Reith, 1996 RFX proteins, a
novel family of DNA binding proteins conserved in the eukaryotic kingdom. Nucleic Acids Res. 24: 803–807.
Gajiwala, K. S., H. Chen, F. Cornille, B. P. Roques, W. Reith et al.,
2000 Structure of the winged-helix protein hRFX1 reveals a
new mode of DNA binding. Nature 403: 916–921.
Gierl, M. S., N. Karoulias, H. Wende, M. Strehle and C. Birchmeier,
2006 The zinc-finger factor Insm1 (IA-1) is essential for the development of pancreatic beta cells and intestinal endocrine cells.
Genes Dev. 20: 2465–2478.
Gresh, L., E. Fischer, A. Reimann, M. Tanguy, S. Garbay et al.,
2004 A transcriptional network in polycystic kidney disease.
EMBO J. 23: 1657–1668.
Hobert, O., 2002 PCR fusion-based approach to create reporter
gene constructs for expression analysis in transgenic C. elegans.
BioTechniques 32: 728–730.
Hodgkin, J., 1983 Male phenotypes and mating efficiency in Caenorhabditis elegans. Genetics 103: 43–64.
Huang, M., Z. Zhou and S. J. Elledge, 1998 The DNA replication
and damage checkpoint pathways induce transcription by inhibition of the Crt1 repressor. Cell 94: 595–605.
Jauregui, A. R., K. C. Nguyen, D. H. Hall and M. M. Barr,
2008 The Caenorhabditis elegans nephrocystins act as global
modifiers of cilium structure. J. Cell Biol. 180: 973–988.
Jekely, G., and D. Arendt, 2006 Evolution of intraflagellar transport from coated vesicles and autogenous origin of the eukaryotic cilium. Bioessays 28: 191–198.
Katan, Y., R. Agami and Y. Shaul, 1997 The transcriptional activation and repression domains of RFX1, a context-dependent regulator, can mutually neutralize their activities. Nucleic Acids Res.
25: 3621–3628.
Knobel, K. M., E. M. Peden and M. M. Barr, 2008 Distinct protein
domains regulate ciliary targeting and function of C. elegans PKD2. Exp. Cell Res. 314: 825–833.
Kozminski, K. G., P. L. Beech and J. L. Rosenbaum, 1995 The
Chlamydomonas kinesin-like protein FLA10 is involved in motility associated with the flagellar membrane. J. Cell Biol. 131:
1517–1527.
Lints, R., and S. W. Emmons, 1999 Patterning of dopaminergic neurotransmitter identity among Caenorhabditis elegans ray sensory
neurons by a TGFbeta family signaling pathway and a hox gene.
Development 126: 5819–5831.
Lints, R., L. Jia, K. Kim, C. Li and S. W. Emmons, 2004 Axial patterning of C. elegans male sensilla identities by selector genes.
Dev. Biol. 269: 137–151.
Liu, K. S., and P. W. Sternberg, 1995 Sensory regulation of male
mating behavior in Caenorhabditis elegans. Neuron 14: 79–89.
Liu, Y., N. Pathak, A. Kramer-Zucker and I. A. Drummond,
2007 Notch signaling controls the differentiation of transporting epithelia and multiciliated cells in the zebrafish pronephros.
Development 134: 1111–1122.
Malone, E. A., and J. H. Thomas, 1994 A screen for nonconditional dauer-constitutive mutations in Caenorhabditis elegans.
Genetics 136: 879–886.
Marshall, W. F., and S. Nonaka, 2006 Cilia: tuning in to the cell’s
antenna. Curr. Biol. 16: R604–R614.
Miller, R. M., and D. S. Portman, 2010 A latent capacity of the C.
elegans polycystins to disrupt sensory transduction is repressed by
the single-pass ciliary membrane protein CWP-5. Dis. Model.
Mech. 3: 441–450.
Mukhopadhyay, S., Y. Lu, H. Qin, A. Lanjuin, S. Shaham et al.,
2007 Distinct IFT mechanisms contribute to the generation
of ciliary structural diversity in C. elegans. EMBO J. 26: 2966–
2980.
Nathoo, A. N., R. A. Moeller, B. A. Westlund and A. C. Hart,
2001 Identification of neuropeptide-like protein gene families
in Caenorhabditis elegans and other species. Proc. Natl. Acad. Sci.
USA 98: 14000–14005.
Peden, E., E. Kimberly, K. Gengyo-Ando, S. Mitani and D. Xue,
2007 Control of sex-specific apoptosis in C. elegans by the BarH
homeodomain protein CEH-30 and the transcriptional repressor
UNC-37/Groucho. Genes Dev. 21: 3195–3207.
Peden, E. M., and M. M. Barr, 2005 The KLP-6 kinesin is required
for male mating behaviors and polycystin localization in Caenorhabditis elegans. Curr. Biol. 15: 394–404.
Perkins, L. A., E. M. Hedgecock, J. N. Thomson and J. G. Culotti,
1986 Mutant sensory cilia in the nematode Caenorhabditis elegans. Dev. Biol. 117: 456–487.
Ciliary Specialization in C. elegans
Piasecki, B. P., J. Burghoorn and P. Swoboda, 2010 Regulatory
factor X (RFX)-mediated transcriptional rewiring of ciliary genes
in animals. Proc. Natl. Acad. Sci. USA 107: 12969–12974.
Portman, D. S., and S. W. Emmons, 2004 Identification of C. elegans
sensory ray genes using whole-genome expression profiling. Dev.
Biol. 270: 499–512.
Reith, W., C. Herrero-Sanchez, M. Kobr, P. Silacci, C. Berte et al.,
1990 MHC class II regulatory factor RFX has a novel DNA-binding
domain and a functionally independent dimerization domain.
Genes Dev. 4: 1528–1540.
Reith, W., C. Ucla, E. Barras, A. Gaud, B. Durand et al.,
1994 RFX1, a transactivator of hepatitis B virus enhancer I, belongs to a novel family of homodimeric and heterodimeric DNAbinding proteins. Mol. Cell. Biol. 14: 1230–1244.
Satir, P., and S. T. Christensen, 2007 Overview of structure and
function of mammalian cilia. Annu. Rev. Physiol. 69: 377–400.
Scholey, J. M., 2008 Intraflagellar transport motors in cilia: moving
along the cell’s antenna. J. Cell Biol. 180: 23–29.
Scholey, J. M., and K. V. Anderson, 2006 Intraflagellar transport
and cilium-based signaling. Cell 125: 439–442.
Schwartz, H. T., and H. R. Horvitz, 2007 The C. elegans protein
CEH-30 protects male-specific neurons from apoptosis independently of the bcl-2 homolog CED-9. Genes Dev. 21: 3181–3194.
Senti, G., and P. Swoboda, 2008 Distinct isoforms of the RFX transcription factor DAF-19 regulate ciliogenesis and maintenance of
synaptic activity. Mol. Biol. Cell 19: 5517–5528.
Senti, G., M. Ezcurra, J. Lobner, W. R. Schafer and P. Swoboda,
2009 Worms with a single functional sensory cilium generate
proper neuron-specific behavioral output. Genetics 183: 595–
605, 1SI-3SI.
Shaham, S., and C. I. Bargmann, 2002 Control of neuronal subtype
identity by the C. elegans ARID protein CFI-1. Genes Dev. 16: 972–983.
Silverman, M. A., and M. R. Leroux, 2009 Intraflagellar transport
and the generation of dynamic, structurally and functionally diverse cilia. Trends Cell Biol. 19: 306–316.
Simon, J. M., and P. W. Sternberg, 2002 Evidence of a mate-finding
cue in the hermaphrodite nematode Caenorhabditis elegans. Proc.
Natl. Acad. Sci. USA 99: 1598–1603.
Sloboda, R. D., and J. L. Rosenbaum, 2007 Making sense of cilia
and flagella. J. Cell Biol. 179: 575–582.
Smith, S. B., H. Q. Qu, N. Taleb, N. Y. Kishimoto, D. W. Scheel
et al., 2010 Rfx6 directs islet formation and insulin production
in mice and humans. Nature 463: 775–780.
1307
Soyer, J., L. Flasse, W. Raffelsberger, A. Beucher, C. Orvain et al.,
2010 Rfx6 is an Ngn3-dependent winged helix transcription
factor required for pancreatic islet cell development. Development 137: 203–212.
Sulston, J. E., D. G. Albertson and J. N. Thomson, 1980 The Caenorhabditis elegans male: postembryonic development of nongonadal structures. Dev. Biol. 78: 542–576.
Swoboda, P., H. T. Adler and J. H. Thomas, 2000 The RFX-type
transcription factor DAF-19 regulates sensory neuron cilium formation in C. elegans. Mol. Cell 5: 411–421.
Thomas, J., L. Morle, F. Soulavie, A. Laurencon, S. Sagnol et al.,
2010 Transcriptional control of genes involved in ciliogenesis: a
first step in making cilia. Biol. Cell 102: 499–513.
Ward, S., N. Thomson, J. G. White and S. Brenner, 1975 Electron
microscopical reconstruction of the anterior sensory anatomy of
the nematode Caenorhabditis elegans. J. Comp. Neurol. 160: 313–
337.
Ware, R. W., D. Clark, K. Crossland and R. L. Russell, 1975 The
nerve ring of the nematode Caenorhabditis elegans: sensory input
and motor output. J. Comp. Neurol. 162: 71–110.
White, J. Q., T. J. Nicholas, J. Gritton, L. Truong, E. R. Davidson
et al., 2007 The sensory circuitry for sexual attraction in C. elegans males. Curr. Biol. 17: 1847–1857.
Xie, X., T. S. Mikkelsen, A. Gnirke, K. Lindblad-Toh, M. Kellis
et al., 2007 Systematic discovery of regulatory motifs in conserved regions of the human genome, including thousands
of CTCF insulator sites. Proc. Natl. Acad. Sci. USA 104:
7145–7150.
Yu, H., R. F. Pretot, T. R. Burglin and P. W. Sternberg,
2003 Distinct roles of transcription factors EGL-46 and DAF19 in specifying the functionality of a polycystin-expressing sensory neuron necessary for C. elegans male vulva location behavior.
Development 130: 5217–5227.
Yu, X., C. P. Ng, H. Habacher and S. Roy, 2008 Foxj1 transcription
factors are master regulators of the motile ciliogenic program.
Nat. Genet. 40: 1445–1453.
Zhang, D., D. C. Zeldin and P. J. Blackshear, 2007 Regulatory factor X4 variant 3: a transcription factor involved in brain development and disease. J. Neurosci. Res. 85: 3515–3522.
Communicating editor: J. Engebrecht
GENETICS
Supporting Information
http://www.genetics.org/cgi/content/full/genetics.110.122879/DC1
Functional Specialization of Sensory Cilia by an RFX Transcription
Factor Isoform
Juan Wang, Hillel T. Schwartz and Maureen M. Barr
Copyright Ó 2010 by the Genetics Society of America
DOI: 10.1534/genetics.110.122879
2 SI
J. Wang et al.
FIGURE S1.—Both wild type (+) and n4132 animals are able to uptake lipophilic fluorescent dye DiI through IL2
and amphid cilia. Arrowheads point to IL2 cell bodies and brackets indicated amphid cell bodies.
J. Wang et al.
3 SI
FIGURE S2.—Three-way analysis of interspecific daf-19 sequences using FamilyRelationshipII. C. elegans daf-19
(Cedaf-19) sequence from GCGTTTCGTAGA to TAAATAAAAATT (F33H1 15735 to 17838 nt) is used, whose
function was tested first by attaching to P1daf-19m::GFP reporter to make Pdaf-19m::GFP reporter (also see Figure 6).
23.6 Kb Cbdaf-19 and 19.7 Kb Crdaf-19 sequences were downloaded from Wormbase (www.wormbase.org) . Boxes in
Cedaf-19 indicate positions of the conserved elements. The four DNA elements were then attached to P1daf-19m::GFP
to test function, with the fourth element TTCTTAATTTTTTTATAATT being the only functional requirement.
4 SI
J. Wang et al.
FIGURE S3.— Distinct cellular localization of DAF-19m::GFP and PKD-2::GFP. A. DAF-19m::GFP resides in
exclusively in the nucleus. B. PKD-2::GFP localizes to cell bodies and cilia, arrows point to cilia. Note nuclear
exclusion of PKD-2::GFP in cell bodies (arrowheads). C. DAF-19m::GFP + PKD-2::GFP. Arrowheads point to the
nuclear area, which is clear in panel B, filled with DAF-19M in panel C.
J. Wang et al.
5 SI
TABLE S1
Transgenic and mutant strain list used in this study
Strain
Description
Ref
MT13057
nIs133 I; him-5(e1467ts) V; n4132
Hillel Schwartz and
H.R. Horvitz
PT1727
daf-19 (n4132)II; him-5(e1490)V
This study
PT1725
daf-19 (n4132)II; pha-1(e2123ts)III; him-5(e1490)V
This study
PT1726
daf-19 (n4132)II; pha-1(e2123ts)III; myIs4[PKD-2::GFP +ccGFP] him-5(e1490)V
This study
PT1770
daf-19 (n4132)II; pha-1(e2123ts)III; him-5(e1490)V; syEx301[lov-1::GFP1+ pBX1]
This study
PT1771
daf-19 (n4132)II; pha-1(e2123) III; him-5(e1490) V; myEx256[Posm-5::gfp+ pBX1]
This study
PT1772
daf-19 (n4132)II; pha-1(e2123) III; him-5(e1490) V; myEx4[DAF-10::GFP+ pBX1]
This study
PT1773
daf-19 (n4132)II; him-5(e1490) V; nxEx1[Pbbs-1::GFP + dpy-5(+)]
This study
PT1774
daf-19 (n4132)II; him-5(e1490) V; nxEx2[Pbbs-2::GFP + dpy-5(+)]
This study
PT1734
daf-19 (n4132)II; him-5(e1490), mnIs17[OSM-6::gfp; unc-36(+)] V
This study
PT1731
daf-19 (m86)II; him-5(e1490)V
This study
PT1777
daf-19 (n4132)II;him5(e1490)V; rtEx277 [Pnlp-8::GFP +lin-15(+)]
This study
PT1778
daf-19 (n4132)II; chIs1200 [ceh-26::GFP + dpy-20(+)]III; him-5(e1490)V; Is[ceh-26::GFP]
This study
PT1750
daf-19 (n4132)II; pha-1(e2123ts)III; myIs4[him-5(e1490)V; myEx633[PCR1+pBX1]
This study
PT1779
daf-19 (n4132)II; pha-1(e2123ts)III; myIs4 him-5(e1490)V; myEx634[PCR2+pBX1]
This study
PT1780
daf-19 (n4132)II; pha-1(e2123ts)III; him-5(e1490), myIs4V; myEx635[PCR3+pBX1]
This study
PT1781
daf-19 (n4132)II; pha-1(e2123ts)III; him-5(e1490), myIs4 V; myEx636[PCR4+pBX1]
This study
PT1783
pha-1(e2123) III; him-5(e1490) V; myEx637[P1daf-19m::GFP+pBX1]
This study
PT1784
pha-1(e2123) III; him-5(e1490) V; myEx638[P2daf-19m::GFP+pBX1]
This study
PT1785
pha-1(e2123) III; him-5(e1490) V; myEx639[P3daf-19m::GFP+pBX1]
This study
PT1786
pha-1(e2123) III; him-5(e1490) V; myEx640[P4daf-19m::GFP+pBX1]
This study
PT1787
pha-1(e2123) III; him-5(e1490) V; myEx641[P5daf-19m::GFP+pBX1]
This study
PT1764
him-5(e1490)V; myEx642[Posm-9::GFP+ccGFP]
This study
PT1766
daf-19 (n4132)II; him-5(e1490) V; myEx642[Posm-9::GFP+ ccGFP]
This study
PT1768
daf-19 (86)II; him-5(e1490)V; myEx642[Posm-9::GFP+ccGFP]
This study
PT1788
daf-19 (n4132)II; him-5(e1490)V; lin-15(n765) X; adEx1262[gcy-5::GFP+ lin-15(+)]
This study
PT1789
daf-19 (n4132)II; him-5(e1490)V; lin-15(n765) X; adEx1295[gcy-32::GFP+ lin-15(+)]
This study
PT2080
pha-1; myEx683[Punc-119::DAF-19m::GFP]
This study
PT2081
pha-1; myEx684[Pdaf-19m::GFP]
This study
PT2082
pha-1; egl-46; myEx684[Pdaf-19m::GFP]
This study
PT658
lov-1(sy582)II; pkd-2(sy606)IV; him-5(e1490) V
Barr 1999
PS622
dpy-17(e164) III; him-5(e1490) V
Brenner 1974
PS3149
pha-1(e2123ts) III; him-5(e1490) V; syEx301[lov-1::GFP1+pBX1]
Barr 1999
CB444
unc-52(e444) II
Brenner 1974
PT2
pha-1(e2123ts) III; him-5(e1490) V; myEx256(Posm-5::gfp)
Qin 2001
PT26
pha-1(e2123ts); him-5(e1490); myEx4[pBX1+ DAF-10::GFP]
Qin 2001
General strains
6 SI
J. Wang et al.
MX1
dpy-5(e907) I; nxEx1 [Pbbs-1::GFP + dpy-5(+)]
Michel Leroux
MX2
dpy-5(e907) I; nxEx2[Pbbs-2::GFP + dpy-5(+)]
Michel Leroux
DR103
dpy-10(e128) unc-4(e120) II
Varkey 1993
CB4077
eDf21 / mnC1 dpy-10(e128) unc-52(e444) II
Shen 1988
SP354
unc-4(e120) mnDf71 / mnC1 dpy-10(e128) unc-52(e444) II
Sigurdson 1984
Sp429
mnDf25 / mnC1 dpy-10(e128) unc-52(e444) II
Sigurdson 1984
SP540
mnDf27 / mnC1 dpy-10(e128) unc-52(e444) II
Sigurdson 1984
SP542
mnDf29 / mnC1 dpy-10(e128) unc-52(e444) II
Sigurdson 1984
MB5
lin-15(ts); him5(e1490); rtEx277[Pnlp-8::GFP+lin-15(+)]
Yu 2003
JT190
daf-19(sa190ts) II
Swoboda 2000
JT6824
daf-19(sa232ts) II
Swoboda 2000
DR431
daf-19(m86) / mnC1 dpy-10(e128) unc-52(e444) II
Swoboda 2000
PS3380
him-5(e1490), mnIs17[OSM-6::gfp+unc-36(+)] V
Collet 1998
TB1225
chIs1200[ceh-26::GFP + dpy-20(+)]III; him-5(e1490)V
Yu 2003
DA1262
lin-15(n765) X; adEx1262[gcy-5::GFP+ lin-15(+)]
Yu 1997
DA1295
lin-15(n765) X; adEx1295[gcy-32::GFP+ lin-15(+)]
Yu 1997
J. Wang et al.
7 SI
TABLE S2
Primers, templates, vectors used for PCR fragments and plasmids in this study
CWP-1::GFP
5' primer
3' primer
template
5’-catgacgacaaagcggatca-3’
5’-ttctcctttactgaatttctta
him-5 genomic DNA
gaggcgagaaggc-3’
5’-ctctaagaaattcagtaaag
5’-caaacccaaaccttcttccg-3’
pPD95.75
5’-gagtcgacctgcaggcatagag
B0229
gagaagaacttttcac-3’
Posm-9::GFP
5’-aaagtcgaggcttgctccc-3’
ccaagatatgggcgg-3’
5’-ccgcccatatcttggctcta
5’-gccatcgccaattggagtat-3’
pPD95.75
tgcctgcaggtcgactct-3’
PCR1
5’-gattccgacgttggctttcg-3’
5’-caagatggaacgggagac-3’
F33H1 cosmid
PCR2
5’-gcgtttcgtagaacaactac-3’
5’-caagatggaacgggagac-3’
F33H1 cosmid
PCR3
5’-cacctgacaccgttttgagc-3’
5’-caagatggaacgggagac-3’
F33H1 cosmid
PCR4
5’-cacctgacaccgttttgagc-3’
5’-caagatggaacgggagac-3’
n4132 genomic DNA
P1daf-19m::GFP
5’-gaatgcatgcggttcacaa
5’-gaagtcgacaagccac
F33H1 cloned to pPD95.75
ctaacctggatag-3’
ctgctctcgggtt-3’
5’-gaatgcatgcggttcacaa
5’-gaagtcgacaagccac
n4132 DNA cloned to
ctaacctggatag-3’
ctgctctcgggtt-3’
pPD95.75
5’-cagaattcttaatttttttataat
5’-caaacccaaaccttcttccg-3’
P1daf-19m::GFP
5’-gaatgcatgcggttcacaact
5’-cggtgatgagtcccgagcgcgc
P1daf-19m::GFP
aacctggatag-3’
ccatagtttcaacaag-3’
5’-cttgttgaaactatgggcgcgct
5’-caaacccaaaccttcttccg-3’
P1daf-19m::GFP
5’-caaacccaaaccttcttccg-3’
P4daf-19m::GFP
5’-gaatgcatgcgtttcgtagaac
5’-gttgcatgcgcaccccctgcaag
F33H1 cloned to P1daf-
aactac-3’
ccaatc-3’
19m::GFP
P2daf-19m::GFP
P3daf-19m::GFP
tgcagccatcacaagccaca-3’
P4daf-19m::GFP
cgggactcatcaccg-3’
P5daf-19m::GFP
5’-cagaattcttaatttttttataattg
cagccatcacaagccaca-3’
Pdaf-19m::GFP
To make the PCR-SOE reporter, primer 1 and 2 were paired with template 1, primer 3 and 4 were paired with template 2; in
the second round, primer 1 and 4 were paired with template made by mixing same molar concentration of products of the two
first round PCR.
8 SI
J. Wang et al.
SUPPORTING REFERENCES
1. Barr MM, Sternberg PW (1999) A polycystic kidney-disease gene homologue
required for male mating behaviour in C. elegans. Nature 401: 386-389.
2. Brenner S (1974) The genetics of Caenorhabditis elegans. Genetics 77, 71-94.
3. Qin H, Rosenbaum JL, Barr MM (2001) An autosomal recessive polycystic kidney disease gene homolog is involved
in intraflagellar transport in C. elegans ciliated sensory neurons. Curr Biol. 11: 457-61.
4. Yu S, Avery L, Baude E, Garbers DL (1997) Guanylyl cyclase expression in specific sensory neurons: a new family of
chemosensory receptors. Proc Natl Acad Sci U S A. 94: 3384-7.
5. Varkey JP, Jansma PL, Minniti AN, Ward S (1993) The Caenorhabditis elegans spe-6 gene is required for major sperm
protein assembly and shows 2nd site noncomplementation with an unlinked deficiency. Genetics 133: 79-86.
6. Shen MM, Hodgkin J (1988) mab-3, a gene required for sex-specific yolk protein expression and a male-specific
lineage in C. elegans. Cell 54: 1019-31.
7. Sigurdson DC, Spanier GJ and Herman RK (1984) C. elegans deficiency mapping. Genetics 108: 331-345.
8. Yu H, Pretot RF, Burglin TR, Sternberg PW (2003) Distinct roles of transcription factors EGL-46 and DAF-19 in
specifying the functionality of a polycystin-expressing sensory neuron necessary for C. elegans male vulva location
behavior. Development. 130: 5217-27.
9. Swoboda P, Adler HT, Thomas JH (2000) The RFX-type transcription factor DAF-19 regulates sensory neuron
cilium formation in C. elegans. Mol Cell 5: 411-421.
10. Collet J, Spike CA, Lundquist EA, Shaw JE, Herman RK (1998) Analysis of osm-6, a gene that affects sensory cilium
structure and sensory neuron function in Caenorhabditis elegans. Genetics. 148: 187–200.