Gene Therapy (1997) 4, 432–441 1997 Stockton Press All rights reserved 0969-7128/97 $12.00 Positive and negative regulation of gene expression in eukaryotic cells with an inducible transcriptional regulator Y Wang, J Xu, T Pierson, BW O’Malley and SY Tsai Department of Cell Biology, Baylor College of Medicine, One Baylor Plaza, Houston, Texas 77030, USA To facilitate the understanding of the complex process of target gene expression and its control, we report a modified inducible system for activation or repression of target gene expression in response to an exogenously administered compound. The main component of this inducible system is a chimeric transcriptional activator (GLVP) consisting of an N-terminal VP16 transcriptional activation domain fused to a yeast GAL4 DNA binding domain and a mutated human progesterone receptor (hPR) ligand binding domain (LBD). This chimeric regulator binds to a target gene containing the 17-mer GAL4 upstream activation sequence (UAS) in the presence of anti-progesterone, RU486. We showed that the combination of two different types of domains (VP16 and poly-glutamine stretch) into one chimeric molecule could result in a further increase in transcriptional activation potency. Through mutational analysis, we modified the original GLVP and generated a more potent version of the RU486 inducible regulator GL914VPC9 with a 19 amino acid deletion of the hPR-LBD (DC19) and a C-terminally located VP16 activation domain. More importantly, this new chimeric regulator can effectively activate target gene expression at a much lower concentration of RU486 (0.01 nM). The concept of RU486 regulatable gene expression is not limited to gene activation. By replacing the VP16 activation domain with a KRAB transcriptional repression domain, we are able to achieve inducible repression of target gene expression. We also present evidence that individual functional domains within a chimeric protein could modulate each other’s function depending on their relative positions within the molecule. Using this potent regulator, we demonstrate that inducible nerve growth factor (NGF) secretion into conditioned media can elicit neurite outgrowth in co-cultured PC12 cells. This new versatile inducible system can potentially be used to control target gene expression in a mammalian system in vivo. Keywords: inducible system; gene activation and repression; RU486 Introduction The expression of most mammalian genes is intricately regulated in vivo in response to a wide range of stimuli, including physical (pressure, temperature, light), electrical (eg motor and sensory neuron signal transmission) as well as biochemical (ions, nucleotides, neurotransmitters, steroids and peptides) in nature. While the mechanism of transcriptional regulation of gene expression has been extensively studied,1 progress on achieving target gene regulation in mammalian cells, without interfering with endogenous gene expression, has been limited. Currently, most strategies for target gene activation or repression are performed in a constitutive manner. Such uncontrolled regulation of gene expression is not ideal physiologically, and can even be deleterious to cell growth and differentiation. Several inducible systems have been employed for controlling target gene expression. These inducible agents include heavy metal ions, 2 heat shock,3 isopropyl b-dthiogalactoside (b-gal),4 and steroid hormones such as estrogen5 and glucocorticoids. 6 However, many of these Correspondence: SY Tsai Received 5 September 1996; accepted 23 December 1996 inducers are either toxic to mammalian cells or interfere with endogenous gene expression. 7 Utilizing a bacterial tetracycline-responsive operon element, Gossen et al developed an interesting model for controlling gene expression with a tetracycline-controlled transactivator (tTA and rtTA). 8,9 No et al recently reported a threecomponent system consisting of a chimeric GAL4-VP16ecdysone receptor, its partner retinoid X receptor (RXR), and a target gene; they demonstrated its application in activating reporter gene expression in an ecdysonedependent manner.10 Previously we have reported a novel RU486-inducible system for controlling target gene expression.11 This inducible system consists of a regulator and a target gene. The regulator is a chimeric RU486-inducible transcriptional activator composed of a VP16 transcriptional activation domain in the N-terminus followed by a yeast GAL4 DNA binding domain and a mutated human progesterone receptor (hPR) ligand binding domain (LBD). This mutated PR, containing a 42 amino acid deletion in the C-terminus (DC42) of the LBD, does not bind to progesterone, but binds the progesterone antagonist RU486 (mifepristone) and activates transcription.12 The advantage of using the yeast GAL4 DNA binding domain is its specificity, since this chimeric regulator will only recognize target gene constructs containing the 17-mer (GAL4 Inducible regulation of gene expression Y Wang et al binding) sequence but not the endogenous mammalian genes. Moreover, this system is only activated in the presence of an exogenous compound, RU486, but not by any endogenous molecules present in the mammalian tissues and organs. Furthermore, the regulator GLVP was activated by a very low concentration (0.1–1 nm) of a synthetic and orally active antiprogestin RU486. We have demonstrated previously the successful use of this system both in vitro and ex vivo11 with different target gene constructs harboring either the chloramphenicol acetyltransferase or the tyrosine hydroxylase gene. While the original GLVP can efficiently activate target gene expression containing stronger promoters such as the thymidine kinase (tk) promoter, its activity on a minimal TATA promoter is limited. To enhance further the transcriptional activity of GLVP, we report here the generation of a more potent RU486-inducible gene regulator. Most importantly, this new gene regulator responds to RU486 at a concentration even lower than that used by the original GLVP. At this concentration, RU486 does not have any anti-progesterone or anti-glucocorticoid activity. The inducible system has been used successfully to produce secreted NGF from a reporter gene in an RU486 dependent manner to induce neurite outgrowth in co-cultured PC12 cells (of rat adrenal pheochromocytoma). We also demonstrate that this RU486-controllable ligand binding domain can be converted to an inducible repressor for shutting down target gene expression. Collectively, these studies demonstrate that individual domains within a chimeric fusion protein influence each other’s function in a position-dependent context. Results Role of additional activation domains in the chimeric regulator Several different functional domains have been characterized in transcription factors; they can be either acidic (VP16, GAL4), glutamine-rich (SP1, Oct-1, Oct2A), proline-rich (Oct3/4), or serine- and threonine-rich (Pit1).13 It is known that different types of transcriptional activation domains interact with different coactivators of the general transcriptional machinery. When different activation domains are fused together in a transactivator, they can synergize with each other to increase its transcriptional potential. Recently, Schaffner and colleagues14 demonstrated that insertion of either a poly-glutamine (poly-Q) or poly-proline (poly-P) stretch within the GAL4-VP16 enhances the activation of GAL4-VP16. In order to increase the potency of the GLVP regulator, we inserted varying lengths of poly-Q stretches encoded by the triplet repeats (CAG)n, into the N-terminus of the GLVP regulator (Figure 1a). Transactivation analysis of the various sizes of poly-Q insertions in the GLVP indicate that addition of 10–34Q increases transcriptional activity of the regulator on the reporter gene (17 × 4TATA-hGH), while further extension of poly-Q from a 66 Q oligomer to a 132 Q oligomer results in decreased activation of the target gene (Figure 1b). These experiments demonstrated that a combination of different types of functional domains of appropriate strength further improves the activation potential of the GLVP chimeric regulator. To understand whether additional activation domains of the same type would also increase the activation potential of the chimeric regulator, we constructed GLVP × 2 with two copies of VP16 activation domain at the N-terminus (Figure 1a). As shown in Figure 1c, further addition of the same type of transactivation domain (VP16) did not increase the activation potential of the regulator. Extension of the ligand binding domain of hPR further improves the responsiveness of GLVP to RU48 The original chimeric regulator GLVP contains a Cterminally truncated hPR-LBD at amino acid (aa) position 891, which disrupted the activation function (AF2) as well as the dimerization ability of the hPR. We asked whether an increase in the length of hPR-LBD in the GLVP might enhance its transcriptional activity in response to the antiprogestin RU486. For this purpose, a series of deletion mutants which extend the C-terminus of the LBD from aa 879 to aa 928 were generated (Figure 2a). These mutants were examined for their ability to confer stronger RU486, but not progesterone, inducible activity in transient cotransfection assay with a 17 × 4TATA-CAT reporter construct. By lengthening the C-terminal ligand binding domain from 879 to 914 (Figure 2a), we observed a gradual increase in RU486 induced activation of target gene expression (Figure 2b). Importantly, these mutants responded specifically to RU486, but not to the progesterone agonist R5020. Further extension of the C-terminal LBD beyond aa 914 resulted in a decrease of GLVP response to RU486 (Figure 2b). Location of the transcriptional activation domain VP16 within the chimeric regulator affects its transactivation potential The original chimeric regulator GLVP contained the VP16 transcriptional activation domain located at the Nterminus of the molecule. To address the possibility whether positioning of the VP16 activation domain within the chimeric molecule would affect its transcription activation potential, we constructed a series of chimeric regulators with the VP16 activation domain located at the C-terminus. As illustrated in Figure 3, the regulator with a C-terminally located VP16 is more potent than its N-terminal counterpart (compare GLVP and GL891VPC9 in Figure 3a and GL914VP and GL914VPC9 in Figure 3b). In addition, extension of the C-terminal LBD from aa 879 to aa 914 further increased transactivational activity of the regulator in this C-terminally located VP16 chimera (compare GL879VPC9 with GL914VPC9 in Figure 3a). Thus, extension of the LBD to aa 914 further enhances the RU486-dependent transactivation, irrespective of whether VP16 is located in the N- or C-terminus, suggesting the existence of a weak dimerization and activation function between aa 879 and 914 of the PR-LBD. By transferring the VP16 activation domain from the N-terminus to the C-terminus, we generated a much more potent transactivator GL914VPC9 . In order to exclude the possibility that this significant difference in the capacity for gene activation was not due to different protein expression levels of the two chimeric regulators, we performed Western blot analysis of extracts from HeLa cells transiently transfected with either GL914 VP or GL914VPC9 (duplicates) and confirmed that the two regulator proteins are expressed at a similar level (Figure 3c, compare 433 Inducible regulation of gene expression Y Wang et al 434 Figure 1 Effect of additional transcriptional activation domain on GLVP activity. (a) Diagrams of GLVP and its derivatives containing an additional transactivation domain. In GLVP-nQ, a poly-glutamine (n-oligomer) stretch was fused directly to the N-terminal part of the GLVP. GLVP × 2 has tandem copies of VP16 activation domain (ac 411–487) fused together at the N-terminus. The reporter plasmid, 17 × 4-TATA-hGH,40 contains four copies of 17-mer GAL4 binding sequence, adenoviral E1B minimal promoter (TATA box) and the human growth hormone gene. (b) Effect of various lengths of poly-Q insertion on GLVP transactivation potential. HepG2 cells (of liver origin) were transfected with 2 mg of expression plasmid (in pCEP4 vector) and 10 mg of reporter plasmid 17 × 4-TATA-hGH. Cells were treated with either 1 nm RU486 or vehicle control (80% ethanol). Aliquots (20 ml) of the cell culture media were taken at different time intervals as indicated and diluted 1:5 for measurement of hGH. (c) An additional copy of the VP16 activation domain into GLVP does not further increase its transactivation potential. HepG2 cells were cotransfected with 0.5 mg expression plasmid (RSV) and 5 mg of reporter 17 × 4-TATA-hGH. Cells were incubated with 10 nm RU486 (filled bar) or vehicle control (open bar) for 36 h. Cell culture medium was then harvested and diluted 1:4 for analysis of hGH content by radioimmunoassay. The standard error bar represents variations of the mean from three individual transfection experiments. lanes 2 and 3 with lanes 4 and 5). Together, these results suggested that through modification of the PR-LBD within the chimeric regulator we could further improve its response to a ligand by approximately one order of magnitude. The new regulator GL914VPC9 activates target gene expression potently at a lower concentration of RU486 Since RU486 has been known to act as an antagonist of progesterone and glucocorticoid when used at a high concentration (100 nm), it would be desirable for the chimeric regulator GLVP to activate target gene expression at a substantially lower concentration of RU486. We examined the optimal concentration of RU486 for these two transcriptional activators GL914VPC9 and GL914VP. As shown in Figure 4, GL914VP activity occurred at an RU486 concentration of 0.1 nm and reached a maximal level at 1 nm. The result is similar to what we have observed previously in a stable cell line harboring the GLVP and reporter 17 × 4-tk-TH (tyrosine hydroxylase).11 In contrast, GL914VPC9 increased reporter gene expression at an RU486 concentration 10-fold lower Inducible regulation of gene expression Y Wang et al 435 Figure 2 Extension of the ligand binding domain enhances RU486-inducible transcriptional activation. (a) Diagram of the original chimeric GLVP and its C-terminally extended derivatives. VP16 activation domain contains aa 411–489 of the HSV VP16, the GAL4 DNA binding domain was derived from residue 1 to 93. Different amino acid segments of the human progesterone receptor (hPR) ligand binding domain (LBD) were used in the chimeric protein. (b) Various C-terminal truncations of progesterone receptor ligand binding domain affect the transactivation potential of chimeric regulator. Transient transfection assay shows the activity of various GLVP derivatives on activation of target gene 17 × 4-TATA-CAT. HeLa cells were transfected with 4 mg of chimeric regulators (driven by RSV promoter) as indicated and 10 mg of reporter 17 × 4-TATA-CAT. After transfection, cells were incubated with either 10 nm RU486 (RU) or 10 nm progesterone agonist R5020 (P). Ethanol (85%) was used as vehicle control (−). (0.01 nm) than that of GL914VP. Thus, the modified GL914VPC9 is not only more potent but also activates the reporter gene at a lower concentration of ligand as compared with GL914VP. This newly discovered character of GL914VPC9 is important for its use in inducible target gene expression, since it would allow the use of a concentration which has no anti-progesterone or anti-glucocorticoid activity. This represents a significant advantage when the inducible system is applied in in vivo situations, as exemplified by transgenic mice and potentially by gene therapy. Inducible repression of target gene expression To explore the possibility of converting a transactivator GLVP to a regulatable repressor, we replaced the VP16 activation domain with a repression domain, the Krüppel-associated box-A (KRAB), from the zinc finger protein Kid-1. Kid-1 was identified as a kidney-specific transcription factor and was shown to be regulated during renal ontogeny and injury. 16,17 The KRAB domain (aa 1–70) was inserted in either the N- or C-terminus of GL914 (Figure 5a) and inducible repression by RU486 was analyzed in cotransfection experiments using HeLa cells. The reporter plasmids 17 × 4-tk-CAT (with the thymidine kinase promoter) and 17 × 5-SV-CAT (containing the SV40 enhancer) were selected in order to study the repression of basal promoter and enhancer-mediated transcriptional activity, respectively. Both reporters contain multiple copies of the GAL4 binding site (17-mer UAS sequence) and exhibit constitutive basal expression from either a tk promoter or SV40 enhancer by themselves. As shown in Figure 5b, the chimeric regulator GL914KRAB, with the KRAB repression domain inserted in the C-terminus, strongly repressed expression (six- to eight-fold) of both reporters in an RU486-dependent manner. However, the N-terminally located KRAB repression domain (KRABGL914) did not repress target gene expression in the presence of RU486 to the degree of that achieved with KRAB located in the C-terminus (GL914 KRAB). This observation is similar to what we have observed previously with the positioning of the VP16 activation domain. Inducible neurite outgrowth in PC12 cells with regulated expression of nerve growth factor To demonstrate the use of the inducible system in a biological situation, we designed a regulatable expression model for nerve growth factor (NGF). NGF has been shown to stimulate neurite (axon) outgrowth of PC12 cells (from rat adrenal pheochromocytoma) when added to the cell culture medium.18 We have established a stable rat fibroblast cell line (C4FRNGF) that possesses both regulator GL914VPC9 and reporter 17 × 4-TATA-NGF. These cells were grown in the presence or absence of RU486 (10 nm) for 2 days and the conditioned medium was collected and assayed for NGF-stimulated neurite outgrowth of PC12 cells. When conditioned medium (from C4FRNGF cells treated with RU486) was added to PC12 cells, we observed strong neurite outgrowth from PC12 cells after 48 h of incubation (Figure 6C and D). Little if any neurite outgrowth was observed in PC12 cells incubated with the conditioned medium that was collected from stable cells treated with vehicle only (85% ethanol) (Figure 6 A and B). These results demonstrate that the inducible system can be used to study a particular biological phenomenon in a controllable fashion. Discussion Transcriptional regulation of gene expression has been intensively studied over the past decade.1,19,20 It is generally believed that transcription factors selectively bind to their recognition sequences on DNA (promoters and enhancers) and directly interact with the TBP-associated factors (TAFs), coactivators, or corepressors to activate or repress transcriptional activity. Nuclear hormone recep- Inducible regulation of gene expression Y Wang et al 436 Figure 3 C-terminally located VP16 activation domain is more potent in activating target gene expression. (a) Transcriptional activation of GLVP versus its C-terminally located VP16 activation domain and various extensions of the hPR-LBD. HeLa cells were cotransfected with regulator plasmid (4 mg) and reporter 17 × 4-TATA-CAT (10 mg). RU486 (+) or vehicle control (−) was added to the cells as indicated. Results were from three separate transfection experiments and experimental variations are illustrated with error bars. Numbers above the bar are fold induction for each regulator in the presence of RU486 (10 nm). (b) C-terminally located VP16 domain is a more potent transcriptional activator. CAT assay showing activity of Nterminally located VP16 regulator pGL 914VP and the C-terminally located VP16 regulator pGL 914VPC9 . HeLa cells were cotransfected with the expression plasmid (4 mg) and reporter 17 × 4-TATA-CAT (10 mg) and 100 mg of cell extracts were assayed for 1.5 h. RU486 (+, 10 nm) or vehicle control (−, 85% ethanol) was added to the cells as indicated. (c) Expression level of GLVP and GL914VP C9 regulators is comparable in the HeLa cells. Western blot of protein extracts (20 mg) from HeLa cells transfected with 10 mg of GLVP (lanes 2 and 3) or GL 914VPC9 (lanes 4 and 5) and pCEP4 control vector (lane 1). Each lane represents an individual transfection of HeLa cells. The blot was probed with anti-GAL4 (1–147) antibody (Clontech) and developed with ECL staining (Amersham). tors, such as steroid, thyroid, retinoid and orphan receptors, are a unique class of inducible transcription factors that can modulate their respective target genes in response to their cognate ligands. Recently, we and others have identified several coactivators (SRC-1),21 CBP,22 and corepressors (N-CoR, SMART) 23,24 that mediate nuclear hormone receptor activation of target genes. These studies suggest that multiple protein factors are involved in the complex process of transcriptional regulation of gene expression. To understand further this complex process of gene regulation, we have utilized an inducible chimeric regulator to study: (1) how mutations in the hPR ligand binding domain affect its response to ligand; (2) how different types of activation domains function together in a chimeric molecule; and (3) whether the positioning of a transactivation domain might affect its activation potential. Mutagenesis studies of the hPR ligand binding domain have demonstrated that extension of the LBD deletion from aa position 891–914 increases the activation potential of the chimeric regulator. We propose that the addition of this short stretch of 23 aa increases the PRLBD’s dimerization potential and subsequent binding to its response element. During the course of this study, we also discovered that further extension of the hPR-LBD from residue 917 to 928 results in a decrease of transactivation, suggesting that this region may serve as a repressor interacting domain. In fact, when this 12 aa stretch was ligated to the GAL4 DNA binding domain, it was sufficient to confer transcriptional repression of a target gene, suggesting that these 12 aa might interact with a yet unidentified cellular co-repressor.25 Many chimeric proteins have been constructed in recent years in order to combine different functional domains of various proteins into one versatile chimera. While it is clear that each protein domain can function independently, relatively little is known about how individual domains modulate each other’s function within a chimeric protein. In this study, we demonstrated that the activation potential of VP16 is influenced by its relative position within the chimeric regulator. The C-terminally located VP16 chimeric regulator GL914VPC9 effectively Inducible regulation of gene expression Y Wang et al 437 Figure 4 Dose–response of regulator GL 914VP vs GL914 VPC9 to RU486 induced gene activation. HeLa cells were transfected with 4 mg of regulators and 10 mg of reporter 17 × 4-TATA-CAT. Cells were incubated with various concentrations of RU486 or vehicle control (85% ethanol) as indicated. The CAT activities were assayed using 100 mg of protein extracts from transfected cells with overnight incubation at 37°C. activates target gene expression containing a minimal promoter at an RU486 concentration 10-fold lower than its N-terminally located VP16 counterpart, GL914VP. At this concentration, RU486 is expected to have no interference with endogenous gene expression. Therefore, this new inducible system will afford an improved margin of safety over our previously reported GLVP and further contribute to its application for gene regulation in vivo. Figure 6 Control of neurite outgrowth with regulatable expression of nerve growth factor (NGF). Morphology of PC12 cells grown in medium collected from the C4FRNGF2 stable cell line culture in the presence of 10 nm RU486 or vehicle control (85% ethanol). The stable rat fibroblast cell line (C4FRNGF2) was established by transfecting GL914VP C9 (pCEP4 vector containing the hygromycin resistance gene) and 17 × 4-TATANGF reporter gene (containing the neomycin resistance gene) and selected with hygromycin and G418. C4FRNGF2 cells were incubated with either RU486 or vehicle control for 48 h and morphological phenotypes of the cells were studied. (A and B) vehicle control. (C and D) RU486-treated stable cell culture medium stimulates neurite outgrowth of PC12 after 48 h incubation. In all, mutational studies revealed that the chimeric regulator GL914VPC9 is about eight to 10 times more potent than our originally described regulator GLVP and responds at a lower ligand concentration. Our results also demonstrated that within a chimeric protein, individual Figure 5 Inducible repression of target gene expression. (a) Diagram of inducible repressor and reporter constructs. Kid-1 KRAB domain containing amino acid residues 1–70 was fused to the N- or C-terminus of the GAL4-PRLBD (640–914) chimera. (b) CAT assay demonstrating inducible repression of target gene expression in the presence of RU486. HeLa cells were cotransfected with 4 mg of expression plasmid containing the inducible repressor constructs and 10 mg of reporter plasmid. pCEP4 parental vector was used as the control. After transfection, cells were incubated with either 10 nm of RU486 (+) or vehicle control (−). Numbers indicate the percentage of acetylated chloramphenicol (% conversion) and fold repression in the presence of RU486. Inducible regulation of gene expression Y Wang et al 438 functional domains, such as those involved in transactivation, DNA binding and ligand binding, can modulate each other’s function, depending on their relative positions. Protein–protein interaction studies suggest that different types of transactivation or transrepression domains interact with their respective TAFs or coactivator, corepressor molecules within the RNA polymerase II preinitiation complex to alter gene transcription. 20,26 Glutamine-rich stretches have been identified in various transcriptional factors (SP1, Oct-1 and androgen receptor) although their precise function is unknown.13,14 Expanded regions of triplet CAG repeats have been implicated in several neurodegenerative diseases such as Huntington’s, Kennedy’s, dentatorubral-pallidoluysian atrophy (DRPLA), and hereditary spinocerebellar ataxias (SCA1).27–29 Recently, several groups have isolated proteins responsible for the above mentioned neurodegenerative diseases and confirmed that they indeed contain long poly-glutamine (Q) stretches encoded by the expanded CAG repeats.30–32 To understand further the role of poly-Q stretches in transcriptional regulation, we inserted various lengths of poly-Q in the N-terminus of GLVP. Our results demonstrated that addition of a 10–34 oligomer of poly-Q results in synergistic transcriptional activation, while expanded CAG triplet repeats beyond 66 oligomeric glutamines do not increase further the transactivation potential of chimeric regulator GLVP. These observations suggest that structural and conformational changes might be involved in proteins encoded by the expanded CAG triplet repeat as compared with the regular length poly-Q which is encoded by 10–30 repeats of CAG in normal protein. These results suggest that a neurological disease with expanded CAG repeats (.40 mer) may not be due to aberrant high transcriptional potential but rather due to an influence on other aspects of cell function.33 A transcription factor can either activate or repress gene expression depending on the promoter/enhancer context of its particular target DNA and the coregulator proteins with which it interacts.34 For example, in the absence of thyroid hormone (T3), the thyroid hormone receptor (TR) normally binds to its recognition sequence on DNA and represses target gene activation through interactions with corepressors (Refs 24, 35 and H Shibata, SY Tsai, M-J Tsai, BW O’Malley (unpublished data)). In the presence of T3, the corepressor is released from the receptor and coactivators are recruited to enhance gene expression. Many transcription factors, such as p53, WT1, YY1, Rel, can also act as dual activators and repressors depending on the DNA template and protein cofactors with which they interact. The Drosophila zinc finger transcription factor, Krüppel, is encoded by a gap gene and is essential for organogenesis during later stages of the development. Through in vitro protein–protein interaction studies, Sauer et al36 have demonstrated that the Krüppel protein can act as a transcriptional activator at a low protein concentration (monomeric form) by interacting with TFIIB. However, at a higher protein concentration, Krüppel forms a dimer and directly interacts with TFIIEb resulting in transcriptional repression. Several Krüppel-related proteins have recently been identified in mammalian cells.16,17,37 One of them, Kid-1, was isolated from rat kidney and contains a highly conserved region of approximately 75 aa at the N-terminus termed Krüppel-associated box (KRAB). It has been shown that the KRAB domain can act as a potent repressor when fused to a yeast GAL4 DNA binding domain or TetR.38 In the present study, we demonstrated that by replacing the VP16 transcriptional activation domain with this Kid1 KRAB repression domain, we could convert a regulatable transactivator into a regulatable repressor. We postulate that by exchanging the GAL4 DNA binding domain with the DNA binding domain of another protein, repression of a target gene (eg tumor proliferation gene) could be achieved in response to ligand RU486. Recently, Deuschle et al38 reported that the KRAB domain isolated from Kox1 zinc finger protein, which shares extensively homology with that of Kid-1, interacts with a 110 kDa adaptor protein termed SMP1 (silencingmediating protein 1). The characteristics and mechanism of this adaptor protein have yet to be determined. Using the newly modified GL914VPC9, we have successfully achieved regulation of neurite outgrowth in PC12 cells via RU486 controllable expression of NGF. Our studies show that this novel inducible system can be employed to analyze biological function in a temporal manner. For example, the role of a growth factor could be assessed at a particular stage of development and the sequential relationship of in vivo cell death and proliferation could be delineated in a manner not possible with constitutive expression of the test gene. Recently, we have successfully demonstrated tissuespecific regulation of gene expression in transgenic mice utilizing this inducible system.39 We also foresee the use of our RU486 inducible regulator to create an inducible gene knockout (either temporal and/or spatial) in transgenic mice which could circumvent an embryonic lethality resulting from the use of current gene knockout techniques. We envision that combinatorial inclusion of other inducible systems such as the tetracycline or ecdysone system with the RU486 inducible system might allow biologists one day to modulate complex biological processes which involve multiple levels of control. Materials and methods Plasmid constructs Construction of poly-glutamine stretch insertion into GLVP: The poly-glutamine stretch containing multiple repeats of CAG was constructed by a method developed by Seipel et al15 utilizing multimerization of DNA fragment (BsaI and BbsI digested) coding glutamine repeats leading to poly-Qn. Plasmid pBluescript-KS(II) was digested with Acc65I and SacI, the linearized vector was gel purified and ligated with the annealed oligonucleotide pair R3/R4 to create plasmid pPAP. The oligonucleotide sequence for R3 (upper strand) is: 5′-GTACGTTTAA ACGCGGCGCGCCGTCGACCTGCAGAAGCTTACTAG TGGTACCCCATGGAGA TCTGGATCCGAATTCAC GCGTTCTAGATTAATTAAGC-3′ and the sequence for R4 (lower strand) is: 5′-GGCCGCTTAATTAATCTAGAA CGCGTGAATTCGGATCCAGAT CTCCATGGGGTAC CACTAGTAAGCTTCTGCAGGTCGACGGCGCGCCGC GTTTAAAC-3′. The following restriction sites are incorporated into pPAP as the multiple cloning sites (from T3 to T7): PmeI, AscI, SalI, PstI, HindIII, SpeI, Acc65I, NcoI, BglII, BamHI, EcoRI, MluI, XbaI, PacI, NotI, SacI. Oli- Inducible regulation of gene expression Y Wang et al gonucleotides coding for 10 glutamines were annealed and subcloned into the BglII and BamHI site of plasmid pPAP. The sequence for the upper and lower strand oligonucleotide is, 10QU 5′-GATCTCGGTCTCCAACAG CAACAGCAACAGCAACAGCAACAGGGTCTTCTG-3′ and 10QL: 5′-GATCCAGAAGACCCTGTTGCTGTTGCT GTTGCTGTTGCTGTTGGAGACCGA-3′, respectively. The insert was confirmed by restriction digestion and sequencing. The plasmid with 10Q insert (pPAP-10Q) was digested with BsaI and BbsI (New England Biolab, Beverly, MA, USA) overnight and precipitated. Onetenth of the precipitated DNA (containing both vector and fragment) was re-ligated to create plasmid pPAP18Q. Each ligation step results in pAP-2(n-1)Q from the previous vector pPAP-nQ. In this way various expansions of poly-Q were achieved and the resulting plasmids pPAP-34Q, pPAP-66Q and pPAP132Q were created and confirmed by sequencing. The BglII and BamHI fragments (coding for poly-Q stretch) from these plasmids were purified and cloned into the BglII site of pRSV-GLVP to generate GLVP with various poly-Q inserts at the N-terminus. These GLVP-nQ were reinserted into the pCEP4 expression vector (containing CMV immediate–early gene enhancer/promoter) creating pCEP4-GLVP-nQ. Chimeric fusion protein with various C-terminus deletions: To construct GLVP chimeras with various C-terminal deletions of the human progesterone receptor ligand binding domain, the HindIII to BamHI fragment containing these various deletions in pRSV-hPR plasmids25 was gel purified with QIAEX II gel extraction kit (Qiagen, Chatworth, CA, USA). The purified fragments were subcloned into HindIII and BamHI sites of pRSV-GLVP11 replacing the aa region 610–891 of the GLVP. GLVPC9 chimeras with VP16 activation at the C-terminus: We used two-step clonings to move VP16 activation to the C-terminus of the chimeric fusion protein. First, the hPR-LBD region (from aa 800 to various C-termini) was amplified using 5′ primer (5′-TATGCCTTACCATGT GGC-3′) with a different 3′ primer as a pair and digested with HindIII to SalI to prepare the fragment for ligation. For a different position of amino acid truncation, the 3′ primers incorporating the SalI site are: P3S–879: 5′-TTGG TCGACAAGATCATGCATTATC-3′; P3S–891: 5′-TTGTC GACCCGCAGTACAGATGAAGTTG-3′, and P3S–914: 5′TTGGTCGACCCAGCAATAACTTCAGACATC-3′. The DNA fragment containing the VP16 activation domain (aa 411–490) was isolated from pMSV-VP16-D3′-b58N′ (from A Friedman, Johns Hopkins Oncology Center, Baltimore, MD, USA) with SalI and BamHI. The digested PCR fragment and VP16 activation were ligated together into the HindIII and BamHI sites of expression vector pCEP4 (Invitrogen, San Diego, CA, USA). The ligated vector pCEP4-PV (LBD 810–879 and VP16), -C3 (LBD 810–891 and VP16), -C2 (LBD 810–914 and VP16), respectively, now contain C-terminal fragments of hPR-LBD from the HindIII site (amino 810) to various truncations of LBD fused 3′ to the VP16 activation domain with BamHI after the termination codon of VP16. We then replaced the HindIII–BamHI fragment from pGL (in pAB vector) with PV, C3, and C2 fragments, respectively, to yield pGL879VPC9, pGL891VPC9, and pGL914VPC9. These chimeric fusion proteins were then subcloned into Acc65I and BamHI sites of pCEP4 expression vector and were named as pCEP4-GL879VPC9, pCEP4-GL891VPC9, pCEP4GL914VPC9. Inducible repressor containing the Kid-1 KRAB domain: The Kid-1 gene (cDNA kindly provided by Dr JV Bonventre, Massachusetts General Hospital, Charlestown, MA, USA) containing the KRAB domain (aa 1–70) was amplified with two sets of primers for insertion into the N- or C-terminus of GL914, respectively. For the KRAB domain to be inserted at the N-terminus of the fusion protein, the Kid-1 cDNA was amplified with a set of primers as follows: Kid3: 5′-CGACAGATCTGGCTCCTGAG CAAAGAGAA-3′, Kid4: 5′-CCAGGGATCCTCTCCTTGC TGCAA-3′. The PCR products were digested with BglII and BamHI and subcloned into pRSV-GL891 to create pRSV-KRABGL891. The KpnI–SalI fragment of KRABGL891 was then purified and subcloned into KpnI–SalI sites in pRSV-GL914VP to create pRSV-KRABGL 914. The entire KRABGL914 fragment (KpnI–BamHI) was then inserted into the KpnI and BamHI-digested pCEP4 generating pCEP4-KRABGL914. For C-terminally located KRAB domain, the Kid-1 gene was amplified with the following set of primers: Kid1: 5′-TCTAGTCGACGATGGCTCCTG AGCAAAGAGAAG-3′, Kid2: 5′-CCAGGGATCCTATCC TTGCTGCAACAG. The primer Kid2 also contains a termination codon (TAG) after aa 70. The PCR products were digested with SalI and BamHI and purified using QIAEX II gel extraction kit (Qiagen). The HindIII and SalI fragment (317 bp) from pBS-GL 914VPC9, was isolated as was the vector fragment of pCEP4-GL914VPC9 digested with HindIII and BamHI. These three piece fragments were ligated to create pCEP4-GL914KRAB. Transient transfection, CAT assay, hGH assay and Western blot HeLa and CV1 cells were transfected with the described amount of DNA using the polybrene-mediated Ca2PO4 precipitation method and CAT assay was performed and quantified as described previously.11 HepG2 cells (106) were grown in DMEM with 10% fetal bovine serum and 1 × penicillin–streptomycin–glutamine (GIBCO-BRL, Gaithersburg, MD, USA) and transfected with the polybrene-mediated Ca2 PO4 precipitation method. Aliquots of the cell culture media were taken at different time intervals and hGH production was measured using the hGH clinical assay kit (Nichols Institute Diagnostics, San Juan Capistrano, CA, USA) according to the manufacturer’s instructions. For Western blot analysis, protein extracts (20 mg) were prepared from transiently transfected HeLa cells, separated on SDS polyacrylamide gel and trans-blotted on to nylon membrane as previously described. The blot was probed with anti-GAL4-DBD (aa 1–147) monoclonal antibody (Clontech, Palo Alto, CA, USA) and developed with an ECL kit (Amersham, Arlington Heights, IL, USA). Stable cell line generation and neurite outgrowth assay Rat FR cells, derived from rat fetal skin cells (CRL 1213; American Type Culture Collection, Rockville, MD, USA) were transfected with pCEP4-GLVP914VPC9 by the Ca2PO4 method as described previously.11 Cells were grown in DMEM with 10% fetal bovine serum and selected with 50 mg/ml hygromycin-B (Boehringer Mannheim, Indianapolis, IN, USA). After 2–3 weeks, colonies were picked and subsequently expanded. Each clone was then transi- 439 Inducible regulation of gene expression Y Wang et al 440 ently transfected with 2 mg of the p17 × 4-TATA-CAT plasmid utilizing Lipofectin (GIBCO-BRL). Twenty-four hours later, the cells were treated with either RU486 (10−8 m) or 80% ethanol vehicle. Cells were harvested 48 h later and CAT activity was measured using 50 mg of cell extracts. Clones showing RU486-inducible CAT activity were subsequently transfected with the vector p17 × 4-TATA-rNGF (Neo). Stable cells containing both genes were selected with hygromycin (50 mg/ml) and G418 (100 mg/ml) for 2–3 weeks and subsequently expanded. Each colony was then seeded into a 10 cm culture dish and treated with 10−8 m RU486 or vehicle control (80% ethanol). After 48 h, the conditioned medium was collected and frozen. Subsequently, the conditioned medium was thawed and diluted two-fold in DMEM with 10% horse serum and 5% fetal bovine serum. The diluted conditioned medium was then placed on PC12 cells, with new diluted conditioned medium added every 2 days. After 5–7 days, PC12 cells were observed for neurite outgrowth. 12 13 14 15 16 17 18 Acknowledgements We thank Dr JV Bonventre for Kid-1 cDNA and 17 × 5SV-CAT plasmids and Dr SR Whittemore for rat NGF cDNA. We are also grateful to Drs Tom Spencer and Neil McKenna for comments on the manuscript. We especially thank Dr Ming-Jer Tsai for helpful suggestions and discussions. This work was supported by National Institute Health grants to Sophia Y Tsai and Bert W O’Malley. The RU486 regulatable gene switch system has been licensed by Baylor College of Medicine to Gene Medicine Inc., Woodlands, Texas. References 1 McKnight SL. Transcription revisited: a commentary on the 1995 Cold Spring Harbor Laboratory meeting, ‘Mechanisms of Eukaryotic Transcription’. Genes Dev 1996; 10: 367–381. 2 Mayo KE, Warren R, Palmiter RD. The mouse metallothioneinI gene is transcriptionally regulated by cadmium following transfection into human or mouse cells. Cell 1982: 29: 99–108. 3 Nover L (ed). Heat Shock Response. CRC Press: Boca Raton, 1991, pp 167–220. 4 Baim SB, Labow MA, Levine AJ, Shenk T. A chimeric mammalian transactivator based on the lac repressor that is regulated by temperature and isopropyl b-d-thiogalactoside. Proc Natl Acad Sci USA 1991; 88: 5072–5076. 5 Braselmann S, Graninger P, Busslinger M. A selective transcriptional induction system for mammalian cells based on Gal4estrogen receptor fusion proteins. Proc Natl Acad Sci USA 1993; 90: 1657–1661. 6 Lee F, Mulliagen R, Berg P, Ringold G. Glucocorticoids regulate expression of dihydrofolate reductase cDNA in mouse mammary tumour virus chimaeric plasmids. Nature 1981; 294: 228– 232. 7 Figge J et al. Stringent regulation of stably integrated chloramphenicol acetyl transferase genes by E. coli lac repressor in monkey cells. Cell 1988; 52: 713–722. 8 Gossen M, Bujard H. Tight control of gene expression in mammalian cells by tetracycline-responsive promoters. Proc Natl Acad Sci USA 1992; 89: 5547–5551. 9 Gossen M et al. Transcriptional activation by tetracyclines in mammalian cells. Science 1995; 268: 1766–1769. 10 No D, Yao T-P, Evans RM. Ecdysone-inducible gene expression in mammalian cells and transgenic mice. Proc Natl Acad Sci USA 1996; 93: 3346–3351. 11 Wang Y, O’Malley BW Jr, Tsai SY, O’Malley BW. A regulatory 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 system for use in gene transfer. Proc Natl Acad Sci USA 1994; 91: 8180–8184. Vegeto E et al. The mechanism of RU486 antagonism is dependent on the conformation of the carboxy-terminal tail of the human progesterone receptor. Cell 1992; 69: 703–713. Wegner M, Drolet DW, Rosenfeld MG. POU-domain proteins: structure and function of developmental regulators. Curr Opin Cell Biol 1993; 5: 488–498. Gerber H-P et al. Transcriptional activation modulated by homopolymeric glutamine and proline stretches. Science 1994; 263: 808–811. Seipel K, Georgiev O, Gerber H-P, Schaffner W. C-terminal domain (CTD) of RNA-polymerase II and N-terminal segment of the human TATA binding protein (TBP) can mediate remote and proximal transcriptional activation, respectively. Nucleic Acids Res 1993; 21: 5609–5615. Witzgall R et al. Kid-1, a putative renal transcription factor: regulation during ontogeny and in response to ischemia and toxic injury. Mol Cell Biol 1993; 13: 1933–1942. Witzgall R et al. The Krüppel-associated Box-A (KRAB-A) domain of zinc finger proteins mediates transcriptional repression. Proc Natl Acad Sci USA 1994; 91: 4514–4518. Greene LA, Tischler AS. Establishment of a noradrenergic clonal line of rat adrenal pheochromocytoma cells which respond to nerve growth factor. Proc Natl Acad Sci USA 1976; 73: 2424–2428. Goodrich JA, Tjian R. TBP-TAF complexes: selectivity factors for eukaryotic transcription. Curr Opin Cell Biol 1994; 6: 403–409. Pugh BF. Mechanisms of transcription complex assembly. Curr Opin Cell Biol 1996; 8: 303–311. Oñate SA, Tsai SY, Tsai M-J, O’Malley BW. Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science 1995; 270: 1354–1357. Kamei Y et al. A CBP integrator complex mediates transcriptional activation and AP-1 inhibition by nuclear receptors. Cell 1996; 85: 403–414. Hörlein AJ et al. Ligand-independent repression by the thyroid hormone receptor mediated by a nuclear receptor co-repressor. Nature 1995; 377: 397–404. Chen JD, Evans RM. A transcriptional co-repressor that interacts with nuclear hormone receptors. Nature 1995; 377: 454–457. Xu J et al. The extreme C-terminus of progesterone receptor contains a transcriptional repressor domain that functions through a putative corepressor. Proc Natl Acad Sci USA 1996; 93: 12195–12199. Goodrich JA et al. Drosophila TAFII40 interacts with both a VP16 activation domain and the basal transcription factor TFIIB. Cell 1993; 75: 519–530. Kuhl DPA, Caskey CT. Trinucleotide repeats and genome variation. Curr Opin Gen Dev 1993; 3: 404–407. Ross CA, McInnis MG, Margolis RL, Li S-H. Genes with triplet repeats: candidate mediators of neuropsychiatric disorders. Trends Neurosci 1993; 16: 254–260. Ashley CT Jr, Warren ST. Trinucleotide repeat expansion and human disease. Ann Rev Genet 1995; 29: 703–728. Servadio A et al. Expression analysis of the ataxin-1 protein in tissues from normal and spinocerebellar ataxia type 1 individuals. Nat Genet 1995; 10: 94–98. Yazawa I et al. Abnormal gene product identified in hereditary dentatorubral-pallidoluysian atrophy (DRPLA) brain. Nat Genet 1995; 10: 99–103. Trottier Y et al. Cellular localization of the Huntington’s disease protein and discrimination of the normal and mutated form. Nat Genet 1995; 10: 104–110. Burke JR et al. Huntingtin and DRPLA proteins selectively interact with the enzyme GAPDH. Nat Med 1996; 2: 347–350. Kingston RE, Bunker CA, Imbalzano AN. Repression and activation by multiprotein complexes that alter chromatin structure. Genes Dev 1996; 10: 905–920. Baniahmad A et al. The tau4 activation domain of the thyroid hormone receptor is required for release of a putative Inducible regulation of gene expression Y Wang et al corepressor(s) necessary for transcriptional silencing. Mol Cell Biol 1995; 15: 76–86. 36 Sauer F et al. Control of transcription by Krüppel through interactions with TFIIB and TFIIEb. Nature 1995; 375: 162–164. 37 Margolin J et al. Krüppel-associated boxes are potent transcriptional repression domains. Proc Natl Acad Sci USA 1994; 91: 4509–4513. 38 Deuschle U, Meyer WK-H, Thiesen H-J. Tetracycline-reversible silencing of eukaryotic promoters. Mol Cell Biol 1995; 15: 1907–1914. 39 Wang Y, DeMayo F, Tsai SY, O’Malley BW. Ligand-inducible and liver-specific target gene expression in transgenic mice. Nat Biotechnol 1997 (in press). 40 Wang Y, O’Malley BW, Tsai SY. Inducible system designed for future gene therapy. In: Tuan R (ed). Methods in Molecular Biology, Vol. 63: Recombinant Proteins: Detection and Isolation Protocols. Humana Press: New Jersey, 1997 (in press). 441
© Copyright 2026 Paperzz