ORIGINAL
RESEARCH
Evidence for Osteocalcin Binding and Activation of
GPRC6A in ␤-Cells
Min Pi, Karan Kapoor, Ruisong Ye, Satoru Kenneth Nishimoto, Jeremy C. Smith,
Jerome Baudry, and Leigh Darryl Quarles
Departments of Medicine (M.P., R.Y., L.D.Q.) and Microbiology, Immunology and Biochemistry (S.K.N.),
University of Tennessee Health Science Center, Memphis, Tennessee 38163; University of Tennessee/Oak
Ridge National Laboratory Center for Molecular Biophysics (K.K., J.C.S., J.B.), Oak Ridge, Tennessee
37830; and Department of Biochemistry and Cellular and Molecular Biology (J.C.S.), University of
Tennessee, Knoxville, Tennessee 37996
The possibility that G protein-coupled receptor family C member A (GPRC6A) is the osteocalcin
(Ocn)-sensing G protein-coupled receptor that directly regulates pancreatic ␤-cell functions is
controversial. In the current study, we found that Ocn and an Ocn-derived C-terminal hexapeptide
directly activate GPRC6A-dependent ERK signaling in vitro. Computational models probe the structural basis of Ocn binding to GPRC6A and predict that the C-terminal hexapeptide docks to the
extracellular side of the transmembrane domain of GPRC6A. Consistent with the modeling, mutations in the computationally identified binding pocket of GPRC6A reduced Ocn and C-terminal
hexapeptide activation of this receptor. In addition, selective deletion of Gprc6a in ␤-cells (Gprc6a␤-cell-cko)
by crossing Gprc6aflox/flox mice with Ins2-Cre mice resulted in reduced pancreatic weight, islet
number, insulin protein content, and insulin message expression. Both islet size and ␤-cell proliferation were reduced in Gprc6a␤-cell-cko compared with control mice. Gprc6a␤-cell-cko exhibited
abnormal glucose tolerance, but normal insulin sensitivity. Islets isolated from Gprc6a␤-cell-cko mice
showed reduced insulin simulation index in response to Ocn. These data establish the structural
basis for Ocn direct activation of GPRC6A and confirm a role for GPRC6A in regulating ␤-cell
proliferation and insulin secretion. (Endocrinology 157: 1866 –1880, 2016)
steocalcin (Ocn) released from bone has been proposed to function as a hormone regulating energy
metabolism and sex hormone production through the
binding to, and activation of G protein-coupled receptor
family C member A (GPRC6A), a class-C G protein-coupled receptor in target tissues (1–3). The possibility that
Ocn is a ligand for GPRC6A is controversial but supported by many observations. Ocn activates GPRC6A signaling responses in vitro (4, 5). Correlations between expression of GPRC6A and functional responses to Ocn are
observed in ␤-cells and Leydig cells (5–10). Ocn has been
shown to stimulate insulin secretion and cell proliferation
of ␤-cells in vitro and in vivo (4, 5, 11–13) and to stimulate
testosterone and 25-hydroxy vitamin D biosynthesis in
Leydig cells (4). Genetic interactions between GPRC6A
O
ISSN Print 0013-7227 ISSN Online 1945-7170
Printed in USA
Copyright © 2016 by the Endocrine Society
Received December 3, 2015. Accepted March 21, 2016.
First Published Online March 23, 2016
1866
press.endocrine.org/journal/endo
and Ocn also support their involvement in common signaling pathways. In this regard, double heterozygous
GPRC6A and Ocn-deficient mice exhibit additive effects
in impairing glucose homeostasis (11). In addition,
Gprc6a⫺/⫺ mice, ␤-cell-specific conditionals of Gprc6a
mice, and Ocn⫺/⫺ mice all have glucose intolerance and
impaired insulin secretion (5, 6, 11, 14). Effects of
GPRC6A on glucose homeostasis may also arise from Ocn
activation of GPRC6A in peripheral tissues regulating insulin sensitivity (6).
In spite of these data, whether Ocn is a direct ligand for
GPRC6A has recently been questioned (15). First, the
structural basis for Ocn binding to GPRC6A has not been
Abbreviations: AMPK, AMP-activated protein kinase; L-Arg, L-arginine; bOcn, bovine Ocn;
Casp3, cysteine-aspartic acid protease 3; CASR, calcium sensing receptor; Chrebp, carbohydrate-responsive element-binding protein; GPCR, G protein-coupled receptor; GPRC6A,
G protein-coupled receptor family C member A; GTT, glucose tolerance test; hOcn, human
Ocn; ITT, insulin tolerance test; Ki-67, marker of proliferation Ki-67; L-Arg, L-arginine;
LKB1, Liver kinase B1; MALDI-TOF, Matrix-assisted laser desorption ionization Time-ofFlight; mGluR, Metabotropic glutamate receptor; Ocn, osteocalcin; PI3K, Phosphoinositide
3-kinase; RMSD, root mean square deviation; Srebp1c, sterol regulatory element-binding
protein-1c; TM, transmembrane; WT, wild type.
Endocrinology, May 2016, 157(5):1866 –1880
doi: 10.1210/en.2015-2010
doi: 10.1210/en.2015-2010
press.endocrine.org/journal/endo
established. Indeed, Ocn, whose crystal structure shows 3
␣-helices surrounding an hydrophobic core, differs significantly from the known physiological amino acid and cation ligands for GPRC6A (15–17). Second, Ocn failed to
stimulate a GPRC6A receptor constructs overexpressed in
CHO or FlpIN-TREx-HEK293 cells (15, 18), suggesting
that Ocn activity is not directly mediated by GPRC6A.
Indeed, orally administered Ocn has the capacity to indirectly regulate insulin secretion through stimulation of intestinal Glucagon-like peptide-1 secretion (19), and/or
production of other insulin-regulating hormones, such as
testosterone (10). Third, a different Gprc6a⫺/⫺ mouse
model, created by deleting the transmembrane and intracellular domains, does not develop glucose intolerance
and insulin resistance (20, 21). Finally, a direct function of
GPRC6A in ␤-cells has also been questioned (15, 18, 22).
In this regard, GPRC6A is a pertussis toxin sensitive receptor, a class of G protein-coupled receptors (GPCRs)
that typically inhibit, rather than stimulate insulin secretion; and some studies failed to observe an effect of the
GPRC6A ligand, L-arginine (L-Arg), to stimulate insulin
release from islets (23).
In the current study, we reexamined the question of
whether Ocn binds to and activates GPRC6A to regulate
␤-cell function. To this end, we explored the structural
basis and the functional effects of Ocn binding to and
activation of GPRC6A and examined the role of this receptor in regulating ␤-cell function by selectively disrupting GPRC6A in pancreatic ␤-cells.
Materials and Methods
1867
Ocn in vacuo at 110°C (26, 27). Purity and decarboxylation state
were confirmed by native gel electrophoresis (25), or by blotting
followed by reaction with 4-diazobenzene sulfonic acid staining
for ␥-carboxyglutamic acid (26, 28). The Ocn-6aa-C, consisting
of 6 residues (NH2-Arg-Phe-Tyr-Gly-Pro-Val-COOH) from the
C-terminal of human Ocn (hOcn) (NP_954642.1) was synthesized by Molecular Resource Center at University of Tennessee
Health Science Center, the molecular weight of Ocn-6aa-C is
738.405 determined by Matrix-assisted laser desorption ionization Time-of-Flight mass spectrometry. The antibodies of phospho-AMP-activated protein kinase (AMPK)-␣, phospho-Liver
kinase B1 (LKB1), and phospho-Phosphoinositide 3-kinase
(PI3K) were purchased from Cell Signaling Technology. Insulin
antibody was purchased from Santa Cruz Biotechnology, Inc. An
antibody preparation for bovine Ocn (bOcn) is made in rabbit
challenged with purified Ocn following methods described previously (29). The estimated titer is 1 ␮L of antiserum will bind
0.5-ng Ocn (radioligand-binding dose dilution) (for antibodies,
please see Table 1).
Measurement of total and phospho-ERK by
Western blotting
HEK-293 and HEK-293 transfected with a mouse GPRC6A
cDNA cells (10, 30) were cultured in DMEM (25mM glucose,
catalog number 11995; Invitrogen) supplemented with 10% fetal bovine serum and 1% PBS for 48 hours followed by overnight
incubation in DMEM/F12 (17.5mM glucose, catalog number
11330; Invitrogen) containing 0.1% BSA to achieve quiescence.
Quiescent cells were treated with various concentrations of
GPRC6A ligands, including L-arginine, Ocn, and Ocn-6aa-C in
quiescent media for 20 minutes at 37°C. ERK activation will be
assessed by immunoblotting using antiphospho-ERK1/2 MAPK
antibody corrected for the total amount of ERK using an antiERK1/2 MAPK antibody (Cell Signaling Technology).
Measurement of cAMP accumulation
Animals
⫺/⫺
flox/flox
We generated both global Gprc6a
and Gprc6a
mice as previously reported (6) and detailed below. We used
Ins2-Cre mice (24) obtained from The Jackson Laboratory
(B6.Cg-Tg(Ins2-cre)25Mgn/J) to delete Gprc6a in ␤-cells.
Mice were maintained and used in accordance with recommendations as described (National Research Council 1985;
Guide for the Care and Use of Laboratory Animals Department
of Health and Human Services Publication NIH 86-23, Institute
on Laboratory Animal Resources, Rockville, MD) and following
guidelines established by the University of Tennessee Health Science Center Institutional Animal Care and Use Committee. The
animal study protocol was approved by the institutional review
boards at University of Tennessee Health Science Center Institutional Animal Care and Use Committee.
Reagents and antibodies
Insulin (Mouse) Ultrasensitive ELISA kit and mouse C-peptide ELISA kit were obtained from ALPCO Diagnostics. Marker
of proliferation Ki-67 (Ki-67) antibody was purchased from
Novus Biologicals. Ocn was purified from bovine tibial bone
extracts (25, 26). Decarboxylated Ocn was produced by treating
Untransfected HEK-293 and HEK-293 cells transfected with
a mouse GPRC6A cDNA (105 cells/well) (10) were incubated in
DMEM/F12 containing 0.1% BSA to achieve quiescence and
treated with vehicle control, 10mM L-arginine (31), or 60-ng/mL
bOcn for 30 minutes at 37°C. cAMP levels were measured by
using cAMP EIA kit (Cayman Chemical).
Table 1.
Antibody Table
Name
Company
Phospho-ERK1/2 MAPK
antibody
pERK1/2 MAPK antibody
Phospho-AMPK-␣ (T172)
antibody
Phospho-LKB1 (S428)
antibody
Phospho-PI3K p85
(Tyr458)p55(Tyr199)
antibody
Insulin antibody
Cell Signaling Technology
Cell Signaling Technology
Cell Signaling Technology
Cell Signaling Technology
Cell Signaling Technology
Santa Cruz Biotechnology, Inc
1868
Pi et al
Ocn Regulates ␤-Cell Function via GPRC6A
GPRC6A homology modeling
To investigate the molecular mechanism for Ocn binding to
GPRC6A, structural models of GPRC6A and Ocn were constructed and used to identify potential Ocn binding poses. In
multiple sequence alignments the helix regions are highly conserved among the GPCRs, whereas the loop regions exhibit low
sequence similarity. The GPRC6A sequence exhibits a similarity
of 43.2% and 44.7% to related family members, the Metabotropic glutamate receptor-1 (mGluR-1) and mGluR-5 receptors,
respectively, for which there are existing crystal structures of the
transmembrane domain (32). These receptor structures were selected as templates for the homology modeling calculations and
the corresponding structural models selected for docking studies.
Missing regions in the cytoplasmic loop-2 (sequence 688 – 691)
and C terminus (sequence 844 – 845) of the mGluR-1 template
structure were modeled using mGluR-5, and missing regions in
the cytoplasmic loop-2 (sequence 683– 688) and the extracellular loop-2 (sequence 721–728) of mGluR-5 template structure
were modeled using mGluR-1. Ten mainchain models with ten
sidechain conformers per mainchain model were generated for
each template using the MOE-2012 (Molecular Operating Environment, 2013.08; Chemical Computing Group, Inc) homology modeling facility with the CHARMM27 force-field (33).
The GPRC6A homology models were validated using PolyPhobius (34). The best-scoring homology models; 1 from using
mGluR-1 as a template and 1 from using mGluR-5 as a template,
were selected for docking studies based on their predicted Generalized Born/volume integral scores (35), which rank the models
based on Coulomb and Generalized Born interaction energies.
The highest scoring models are shown in figure 2 below.
These models exhibit similar structures, with a root mean square
deviation (RMSD) of approximately 4 Å (2) between the backbone atoms. These models were validated against Hidden
Markov secondary structure predictions generated by PolyPhobius, and found to be consistent (Supplemental Tables 1 and 2),
with only 1 loop region and 1 transmembrane helix in the homology models deviating from the PolyPhobius-predicted structure for 5 or more residues.
bOcn (NP_776674.1), similarity score of 93.9% to hOcn
(NP_954542.1), was used as the main template for modeling the
hOcn structure. The alignment between hOcn, bOcn, and pig
Ocn (NP_001157476.1) shows that Ocn is well conserved
among different species, with the hOcn exhibiting a similarity of
93.9% and 87.8% to the bOcn and pig Ocn, respectively. The
highest scoring model, based on Generalized Born/volume integral scores, was generated using bOcn as the main template (see
figure 2 below). The Ocn-6aa-C, consisting of 6 residues was
obtained from the hOcn homology model by deleting the rest of
the protein in MOE-2012 (see figure 2 below).
Docking of Ocn C terminus (Ocn-6aa-C)
Docking of Ocn-6aa-C to the GPRC6A homology models
was carried using Fast Fourier Transform-based rigid docking
program Cluspro (36). The docking was carried out agnostically,
ie, without prespecifying the possible binding site residues, to the
extracellular side of the transmembrane domain of the receptor.
In addition, explicit repulsions were added between the peptide
and the residues present on the cytoplasmic side of the receptor,
and the receptor residues interacting with the surrounding membrane regions.
Endocrinology, May 2016, 157(5):1866 –1880
Cluspro first ranks the generated models using a pairwise
interaction potential scoring function, and then clusters the top
1000 models, ranked by scoring function, using pairwise C-␣
RMSD between the 2 proteins. The goal of clustering is to isolate
highly populated low-energy basins on the energy landscape,
large clusters being more likely to include native structures. After
clustering, the ranked complexes were subjected to a 300 steps of
van der Waals minimization with the backbone fixed, using the
CHARMM (33) potential, to remove potential side chain
clashes. Cluspro then output the centers of the largest clusters.
Metabolic studies
For glucose tolerance test (GTT) glucose (2 g/kg body weight)
was injected ip (37) after a 5-hour fast, and blood glucose was
monitored using blood glucose strips and the Accu-Check glucometer (Roche) at indicated times. For insulin tolerance test
(ITT) (38), mice were fasted for 5 hours, injected ip with insulin
(0.75-U/kg body weight; Sigma), and blood glucose levels were
measured at indicated times as described (39). ITT data are presented as percentage of initial blood glucose concentration.
Mouse islets isolation and ligand stimulation
Primary islets were isolated using modified method (40, 41).
The insulin stimulation index was calculated as the ratio of stimulation media insulin concentrations in Ocn divided by the insulin concentration in control stimulation media (without Ocn)
at low glucose conditions (5, 42).
␤-Cell area was calculated as the ratio of the surface positive
for insulin immunostaining divided by the total pancreatic surface. ␤-Cell mass was calculated as the ␤-cell area multiplied by
pancreatic weight. To measure this ratio, slides from wild-type
(WT) and Gprc6a␤-cell-cko mice immunostained for insulin (insulin antibody; Santa Cruz Biotechnology, Inc) were examined
using ImageScope (University of Tennessee Health Science Center Imaging CORE) and analyzed using the NIH ImageJ system
software. At least 5 animals were analyzed per genotype.
We also obtained an INS-1 832/13 dp45 rat ␤-cell line from
Christopher Newgard (Sarah W. Stedman Nutrition and Metabolism Center, Duke University School of Medicine) that was
selected for its high expression of GPRC6A (43). INS-1 cells were
cultured in RPMI 1640 (A10491, Invitrogen; contains 10mM
HEPES, 2mM glutamine, 1mM Na-pyruvate, and 25mM glucose) with 10% fetal bovine serum, 100-U/mL penicillin, 100␮g/mL streptomycin, and 50 ␮mol/L ␤-mercaptoethanol. The
cells were plated onto 24-well plates at a density of approximately 0.5 ⫻ 106 cells/well and were grown to 100% confluence
before assay. At 18 hours before secretion experiments, the standard tissue culture medium containing 11.1 mmol/L glucose was
switched to fresh medium containing 5 mmol/L glucose. Insulin
secretion was assayed in HEPES-balanced salt solution (114
mmol/L NaCl, 4.7 mmol/L KCl, 1.2 mmol/L KH2PO4, 1.16
mmol/L MgSO4, 20 mmol/L HEPES, 2.5 mmol/L CaCl2, 25.5
mmol/L NaHCO3, and 0.2% bovine serum albumin [essentially
fatty acid free]; pH 7.2) (43).
Real-time RT-PCR
For quantitative real-time RT-PCR assessment of insulin,
glucagon, sterol regulatory element-binding factor-1 (Srebf1),
and carbohydrate-responsive element-binding protein (Chrebp)
gene expression, we isolated total RNA from the islets or pan-
doi: 10.1210/en.2015-2010
creas or other tissues of Control and Gprc6a␤-cell-cko mice by
standard TRIzol method (Invitrogen) and reverse transcribed
2.0 ␮g of total RNAs using cDNA synthesis kit (Bio-Rad). PCR
reactions were described in previously publication (5, 6). The
primers for mouse insulin (NM_008386) consisted of
mIns1.F313: ggggagcgtggcttcttcta and mIns1.R452: acaatgccacgcttctgcc; for mouse glucagon (NM_008100) consisted of
mGCG.For145: gaagacaaacgccactcaca and mGCG.Rev472: tggtgctcatctcgtcagag; for Srebf1 gene (NM_011480) consisted of
mSrebp1c.F3294: tgttggcatcctgctatctg and mSrebp1c.R3483:
agggaaagctttggggtcta; for mouse Chrebp gene (NM_021455)
consisted of mChrebp.For1973: agatggagaaccgacgtatca and
mChrebp.Rev2076: actgagcgtgctgacaagtc; and for the cyclophilin A
(NM_008907) consisted of CycA.For: ctgcactgccaagactgaat and CycA.Rev: ccacaatgttcatgccttct. The RT-PCR primers for rat Gprc6a
(NM_001271106) consisted of rGPRC6A.For1460: ctgtcacgaagatggcagaa and rGPRC6A.Rev1898: cagaccactaatcccccaga (primer set
1–2); rGPRC6A.For535: aaaatccgctttccttcgttr and GPRC6A.
Rev1400: tgggcatcaaaatgaaatgar (primer set 3–4); GPRC6A.For122:
tgtttgccattcacgaaaaa and rGPRC6A.Rev694: cctggattgcaaatgtgttg
(primer set 5–6).
Statistics
We evaluated differences between groups by one-way
ANOVA, followed by a post hoc Tukey’s test. Significance was
set at P ⬍ .05. All values are expressed as means ⫾ SEM. All
computations were performed using the Statgraphic statistical
graphics system (STSC, Inc).
Results
Signal transduction pathways stimulated by Ocn
activation of GPRC6A
To establish that Ocn activates GPRC6A and that
GPRC6A is coupled to signaling pathways known to regulate insulin production and ␤-cell proliferation, we examined the effects of Ocn in activating ERK phosphorylation, AMPK, and cAMP signaling in HEK-293 cells
transfected with GPRC6A or untransfected HEK-293
cells that lack GPRC6A expression (10). We observed a
dose-dependent effect of Ocn in stimulating ERK phosphorylation with an estimated EC50 of 49.9-ng/mL (Figure 1A). A similar ERK phosphorylation response is observed for synthetic human uncarboxylated Ocn (H-7534;
(Glu17,21,24)-Ocn; BACHEM) at 40 –100-ng/mL (data
not shown). An effect of Ocn is seen for PI3K phosphorylation, AMPK phosphorylation and LKB1 phosphorylation (Figure 1B) and cAMP accumulation (Figure 1C) in
HEK-293 cells transfected with GPRC6A, with a significant response observed from 20-ng/mL (Figure 1A). No
response to Ocn was observed in nontransfected HEK293 cells (Figure 1, A and C) (7). Consistent with previous
reports (5, 9), L-Arg (20mM), a ligand for GPRC6A, and
Ocn (80-ng/mL) stimulated cAMP only in HEK-293 cells
overexpressing GPRC6A (Figure 1C). The magnitude of
press.endocrine.org/journal/endo
1869
the cAMP response was similar to forskolin, which stimulated cAMP in HEK-293 cells in a receptor independent
manner (ie, with and without GPRC6A overexpression).
Interestingly, we found that Ocn-stimulated cAMP accumulation in HEK-293 cells transfected with GPRC6A was
significantly blocked by Ocn antibody (Figure 1D).
To look at interactions between Ocn and L-Arg (31),
we assessed the effects of Ocn (80-ng/mL) in stimulating
cAMP accumulation in the presence and absence of L-Arg
(10mM). We found that the addition of L-Arg augmented
the effects of Ocn in stimulating cAMP in HEK-293 cells
expressing GPRC6A (Figure 1E). These additive effects
suggest that L-Arg and Ocn may be binding to different
sites on GPRC6A that are complementary. This possibility
is supported by structural modeling and GPRC6A receptor mutagenesis (see below). Ocn is cleaved by the circulating serine protease, plasmin, at a single R43-R44 site
near its carboxyl end to create an N-terminal 1- to 43amino acid peptide and C-terminal 44 – 49 6-amino acid
peptide (44). Although it has been suggested that Ocn is
too large to activate GPRC6A (15), a 7-amino acid peptide
has recently been shown to activate the related receptor
calcium-sensing receptor (CASR) (45). Therefore, we examined the ability of the hexapeptide cleavage product of
Ocn (Ocn-6aa-C; sequence NH2-Arg-Phe-Tyr-Gly-ProVal-COOH) to stimulate GPRC6A transfected into HEK293 cells. The identical RFYGPV sequence is a highly evolutionarily conserved sequence in land vertebrates from
mammals (human) to amphibians (clawed frog) (46). To
expand on the number of species from mammals, birds,
reptiles, and amphibians: chimpanzees, domestic cow,
chicken, dog, American alligator, and Mexican axolotl
share the RFYGPV C-terminal sequence determined by
uniprot protein sequence alignment (www.uniprot.org).
Although mouse Ocn has the RIYGITI C-terminal sequence, the activity of human and bOcn for mouse gprc6a
and modeling studies provoked a test of the Ocn-6aa-C as
an agonist. As assessed by ERK phosphorylation, we observed a dose-dependent activation of GPRC6A by Ocn6aa-C, with an estimated EC50 of approximately 1 ␮g/mL
(Figure 1F). This concentration of Ocn-6aa-C required for
receptor activation, however, was roughly 20-fold greater
than for intact Ocn, which has an estimated EC50 of 49.9
ng/mL. The maximal response to Ocn-6aa-C was achieved
at concentrations of 5 ␮g/mL (6.77␮M) (Figure 1F),
whereas the maximal effects of intact Ocn were observed
at 80 ng/mL (Figure 1A). Ocn and the Ocn-6aa-C peptide, at functional concentrations, did not have additive
effects on GPRC6A activation (Figure 1G). Neither intact Ocn nor Ocn-6aa-C stimulated ERK activity in
HEK-293 cells not transfected with GPRC6A (Figure 1,
A, C, D, F, and G).
1870
Pi et al
Ocn Regulates ␤-Cell Function via GPRC6A
Endocrinology, May 2016, 157(5):1866 –1880
Figure 1. Evidence for Ocn activation of GPRC6A. A, Dose-dependent effects of Ocn on GPRC6A-mediated ERK phosphorylation in HEK-293 cells
overexpressing GPRC6A. B, Ocn actives GPRC6A-mediated PI3K, AMPK, and LKB1 phosphorylation in HEK-293 cells overexpressing GPRC6A. C,
cAMP response to forskolin, Ocn, or L-arginine (31), a known GPRC6A ligand, in HEK-293 cells with and without GPRC6A transfection. D, An Ocn
blocking antibody inhibited Ocn-stimulated cAMP accumulation in HEK-293 cells transfected with GPRC6A. E, Ocn and L-Arg show additive cAMP
responses. * and **, significant differences from control and stimulated groups at P ⬍ .05 and P ⬍ .01 (n ⱖ 4). F, Ocn-derived 6-aa C-terminal
peptide (Ocn-6aa-C) activates GPRC6A-mediated ERK phosphorylation in HEK-293 cells expressing GPRC6A but not in control HEK-293 cells
(lower panel). G, Ocn-6aa-C and Ocn show nonadditive effects on GPRC6A-dependent ERK activation.
Docking of Ocn-6aa-C
Computational docking of Ocn-6aa-C to the extracellular side of the transmembrane domain of the GPRC6A
receptor homology models was carried out as described in
Materials and Methods. The binding sites found in the
mGluR-1 and mGluR-5 based models of GPRC6A, generated using the rigid-body docking protocol, are shown in
Figure 2, A and B, respectively, and the binding pocket
residues are shown in Figure 2, D and E (and Supplemental
Table 3). The cluster sizes and weighted energy scores for
these models are given in Table 2. The top ranked cluster
center in mGluR-1 represents more than 90% of the top
1000 predicted models (based on pairwise interaction po-
tential scoring function), and in mGluR-5 represents more
than 60% of the top 1000 predicted models.
In the 2 alternative predicted binding modes shown in
Figure 2, Ocn-6aa-C appears to bind to roughly the same
region of the receptor. Fifteen of the predicted binding
residues in the 2 sites are common in both models, including Arg662, Gln663, Glu743, Cyt744, Glu746, Gly747,
Ser748, Phe752, Leu756, Ile799, Tyr802, Ala803,
Val810, Pro811, and Glu814 (Supplemental Table 3 and
Figure 2, D and E). Most of the interactions between the
Ocn C terminus and GPRC6A involve a mix of hydrophobic and hydrophilic (hydrogen bonds and ionic) interactions. In both predicted models, the hydrophobic resi-
doi: 10.1210/en.2015-2010
press.endocrine.org/journal/endo
1871
Figure 2. Docking of Ocn C-terminal (Ocn-6aa-C) to GPRC6A. A, Binding site in the mGluR-1-based template model, Ocn-6aa-C is shown in pink
ribbon-stick representation. B, Binding site in the mGlur-5-based model. C, Ocn and Ocn-6aa-C models based on bOcn structure. Ocn C-terminal
consisting of 6 residues: Arg44, Phe45, Tyr46, Gly47, Pro48, and Val49. D and E, Ocn-6aa-C binding sites. Binding pocket residues found in the
(D) mGluR-1- and (E) mGluR-5-based models of GPRC6A, generated using the rigid-body docking protocol.
dues in the Ocn C-terminal peptides Phe45, Tyr46, Pro48,
Gly47, and Val49 are surrounded by aliphatic side-chains
and/or aromatic residues in GPRC6A. The peptide is also
located in hydrogen bond acceptor-rich regions, with the
side chains (Arg44, Tyr46) and the backbone of the peptide forming possible polar interactions with the receptor.
Mutagenesis of GPRC6A predicted binding pocket
residues blocks activation by Ocn
To test the above modeling we mutated Arg662 (R662), Glu746 (E-746), Phe666 (F-666), and Trp797 (W797) in mouse GPRC6A into alanine by site-directed mutagenesis (Figure 2, D and E) (47). Arg662 and Glu746 are
present in the binding site in both the models and conserved in human GPRC6A. Phe666 is present in the
mGluR1 model and conserved in human GPRC6A (Figure
2D), and Trp797 (which corresponds to human W-795) is
present in the mGluR5 model (Figure 2E). Mutant and the
WT mGPRC6A cDNAs were transiently transfected into
HEK-293 cells. We confirmed that R662A and WT
mGRPC6A proteins were equally expressed, as assessed
by Western blotting using a Myc antibody, which recognized the Myc epitope located at the amino-terminal tail of
the WT and mutant receptors (Supplemental Figure 1).
Ocn stimulated ERK phosphorylation in the WT receptor
but not the R662A mutant receptor-transfected HEK-293
cells (Figure 3A). Interestingly, L-Arg, which is believed to
bind to the venous fly trap motif of GPRC6A, activated
the R662A mutant, although the response was less than
the WT GPRC6A (Figure 3A). Cells transfected with the
E746A mutant GPRC6A also showed no response to Ocn
1872
Pi et al
Ocn Regulates ␤-Cell Function via GPRC6A
Table 2. The Cluster Sizes and Weighted Energy
Scores of mGluR-1 and mGluR-5 Models Generated
Using Cluspro by Clustering the Top 1000 Models
Cluster
Members
mGluR-1 model
1
641
2
193
3
166
mGluR-5 model
1
922
2
54
3
24
Representative
Weighted
Score
Center
Center
Center
⫺1220.3
⫺1226.4
⫺1227.4
Center
Center
Center
⫺1207.8
⫺1151.8
⫺1164.8
Cluster: number of clusters generated by clustering the top-1000
docking models based on the RMSD between the models. Members:
number of structural models (out of 1000) present in each cluster.
Representative: the model selected to represent the cluster; this is the
centroid/center of the cluster with the maximum number of neighbors
(smallest RMSD distances with the other members of the cluster).
Weighted score: the predicted binding free energy values generated by
the Cluspro scoring function in kcal/mol for the cluster centers. The
rigid-docking program Cluspro clusters the top-1000 docking models
predicted by their binding-free energies based on a scoring function.
The best model is predicted as the center of the largest cluster.
stimulation, but remained responsive to L-Arg (Figure
3B). The R662A and E746A mutant receptors also lost
their response to Ocn-6aa-C stimulation (Figure 3C). Similarly, the F666A and W797A mutant receptors lost their
response to Ocn, but maintained their responsiveness to
L-Arg (Figure 3D). These results indicate that the binding
sites identified by the computational modeling are probably correct, and are distinct from the L-Arg agonist site.
Gprc6a␤-cell-cko mice have impaired insulin
production, glucose intolerance, and resistance to
Ocn stimulation of insulin secretion
We created Gprc6aflox/flox mice to investigate the tissuespecific effects of loss-of-GPRC6A function. Gprc6aflox/flox
mice were produced by using the loxP-FRT system to
successfully delete the Gprc6a exons 2 and 3 and schematically shown in Figure 4A. To test the function of
GPRC6A in ␤-cells, we generated Gprc6a␤-cell-cko (Ins2Cre/⫹;Gprc6aflox/⫺) mice by crossing Gprc6aflox/⫺ mice
with Ins2-Cre mice. This approach selectively deleted exons 2 and 3 in the pancreas, but not in other organs that
were tested, including the liver, fat, muscle, and testis (Figure 4B). Gprc6a␤-cell-cko mice exhibited a 77% reduction
in Gprc6a mRNA levels in ␤-cells (Figure 4C).
The gross appearance (Figure 5A) and body weight
(Figure 5B) of Gprc6a␤-cell-cko mice were not different
from the WT male mice. The fasting blood glucose levels
were not different between 10-week-old Gprc6a␤-cell-cko
both male and female mice (223.0 ⫾ 10.7 mg/dL) and male
and female controls (211.7 ⫾ 10.87 mg/dL; P ⫽ .0625)
(9). However, fasting serum insulin (0.818 ⫾ 0.098 ng/
mL) and C-peptide (763.8 ⫾ 5.77pM) concentrations in
Endocrinology, May 2016, 157(5):1866 –1880
Gprc6a␤-cell-cko mice were both significantly lower than
respective values in controls (1.24 ⫾ 0.084 ng/mL and
1151 ⫾ 72.2pM, P ⫽ .02 and 0.02, respectively) in male
and female mice.
Next, we performed GTT and ITT (38) in Gprc6a␤-cell-cko
mice in both male and female mice. After injection of
glucose (2 g/kg) Gprc6a␤-cell-cko mice had a significantly
higher serum glucose levels than controls (Figure 5C), similar to the impaired glucose tolerance observed in global
Gprc6a⫺/⫺ (6). In contrast, Gprc6a␤-cell-cko and control
mice exhibited a similar sensitivity to insulin administration (0.75 U/kg) (Figure 5D). These findings contrast with
the hyperglycemia and insulin resistance observed in
global Gprc6a⫺/⫺ mice (6).
We found that the pancreas weight (Figure 6A) and the
number of islets (Figure 6B) were significantly decreased in
Gprc6a␤-cell-cko mice compared with the controls. In hematoxylin and eosin-stained slides, the size of islets from
Gprc6a␤-cell-cko mice is smaller compared with the controls
(Figure 6D, upper panel). Furthermore, pancreatic insulin
content was decreased in Gprc6a␤-cell-cko mice compared
with the controls (Figure 6C). To determine the functional
bases of the phenotype observed in Gprc6a␤-cell-cko mice,
pancreas sections were analyzed by histomorphometry.
Insulin immunolabeling showed that ␤-cell area and ␤-cell
mass were significantly reduced in Gprc6a␤-cell-cko compared with control mice (Figure 6E).
We also analyzed ␤-cell proliferation in islet ␤-cells, as
assessed by Ki-67 antibody immunostaining. As shown
in Figure 6F, upper panel, ␤-cells proliferated significantly decreased in Gprc6a␤-cell-cko than in control mice.
However, we did not detect any difference between
Gprc6a␤-cell-cko mice and controls in the expression of
the apoptosis marker cysteine-aspartic acid protease 3
(Figure 6F, bottom panel).
Next, we evaluated the effects of agonist stimulation of
GPRC6A in islets derived from Gprc6a␤-cell-cko mice.
Treatment of isolated islets from control mice with Ocn at
concentrations of 80 ng/mL resulted in stimulation indices
of 2.8, in the presence of low glucose (5.6mM). In contrast,
islets isolated from Gprc6a␤-cell-cko mice had an attenuated
response to Ocn, with respective stimulation indices of
1.7, a response significantly lower than observed in control mice (Figure 6G).
To further investigate the abnormality of islets from
Gprc6a␤-cell-cko mice, we assess the gene expression in
Gprc6a␤-cell-cko mice compared with WT mice (Figure 7).
We found that insulin message expression was also significantly lower in the pancreas obtained from Gprc6a␤-cell-cko
mice (ie, decreased by 65%) (Figure 7A). In contrast,
glucagon expression was not attenuated (Figure 7B). The
expression of both sterol regulatory element-binding
doi: 10.1210/en.2015-2010
press.endocrine.org/journal/endo
1873
Figure 3. Mutagenesis of residues in predicted Ocn-binding pocket of GPRC6A. A, Comparison of Ocn and L-Arg activation of WT (upper panel)
and R662A GPRC6A transfected in HEK-293 cells (lower panel). Bar graph depicting fold increase in ERK activation in response to Ocn and L-Arg in
WT and mutant GPRC6A. B, Comparison of Ocn and L-Arg activation of WT (upper panel) and E746A GPRC6A transfected in HEK-293 cells (lower
panel). Bar graph depicting fold increase in ERK activation in response to Ocn and L-Arg in WT and mutant GPRC6A. C, Comparison of Ocn-6aa-C
and L-Arg activation of WT (upper panel) and R662A GPRC6A (middle panel) and E746A GPRC6A (lower panel) transfected in HEK-293 cells. Bar
graph depicting fold increase in ERK activation in response to Ocn-6aa-C and L-Arg in WT and mutant GPRC6As. D, Comparison of Ocn and L-Arg
activation of WT (upper panel), F666A (middle panel), and W797A (lower panel) GPRC6A transfected in HEK-293 cells. Bar graph depicting fold
increase in ERK activation in response to Ocn and L-Arg in WT and mutant GPRC6A.
protein-1c (Srebp1c) and Chrebp (48) mRNA levels were
increased in the pancreas of Gprc6a␤-cell-cko mice compared with controls (Figure 7C). In contrast, we observed
no difference in expression of Srebp1c or Chrebp mRNA
levels in the liver (Figure 7C). Similar alterations of insulin,
glucagon, Srebp1c, and Chrebp message expression were
observed in isolated islets derived from Gprc6a␤-cell-cko and
control mice. Insulin message expression was reduced by
65% in isolated pancreatic islets derived from Gprc6a␤-cell-cko
mice compared with control group mice (Figure 7D). This
response was selective for insulin, because glucagon expression was not attenuated in islets from Gprc6a␤-cell-cko
mice (Figure 7E). Srebp-1c and Chrebp mRNA expression
were also significantly increased in islets from the
Gprc6a␤-cell-cko strain (Figure 7F).
Finally, because changes in ␤-cell mass in the in vivo
studies rather than direct regulation of insulin secretion by
␤-cells could account for our findings, we sought to test
whether Ocn directly stimulates insulin secretion in a
␤-cell line that expresses Gprc6a. We selected an INS-1
clone that expressed the full-length Gprc6a message (Figure 7G). Ocn resulted in a dose-dependent stimulation of
ERK phosphorylation, achieving activation at concentrations of 20 ng/mL (Figure 7H), similar to the response of
Gprc6a expressed in HEK-293 cells (Figure 1A). Ocn resulted in a dose-dependent increase in insulin secretion
from these INS-1 cells (Figure 7I).
Discussion
In the current study, we address uncertainties regarding
the physiological and pathological roles of the widely expressed G protein-coupled receptor, GPRC6A. Specifically, we address whether Ocn, a bone-derived peptide, is
a ligand for GPRC6A and the discrepancies in the phenotype of different Gprc6a knockout mouse models and results of in vitro studies regarding GPRC6A regulation of
␤-cell functions. We show that GPRC6A is a physiologically relevant receptor for Ocn and demonstrate a direct
1874
Pi et al
Ocn Regulates ␤-Cell Function via GPRC6A
Endocrinology, May 2016, 157(5):1866 –1880
Figure 4. Generation of a conditional allele of Gprc6a mouse model. A, Schematic representation of the targeting strategy. Exon 1– 6 open
reading frames are represented by open boxes, and thin lines represent untranslated regions of the Gprc6a locus. The neomycin resistance gene
(for positive selection) flanked by 2 FRT sites and LoxP (open triangle) are indicated. B, Specificity of Gprc6a deletion was tested by PCR in the
indicated tissues. C, Efficiency of Gprc6a deletion by Ins2-Cre in pancreas was tested by real-time PCR using specific Gprc6a primers as described
in Materials and Methods. Expression was assessed by real-time PCR using total RNA derived from control group (WT, ⫹/⫹;Gprc6aflox/⫹,
⫹/⫹;Gprc6aflox/⫺, or Ins2-Cre/⫹;Gprc6aflox/⫹) and Gprc6a␤-cell-cko mouse tissues as indicated. Gprc6a expression is relative to the level of the
cyclophilin control gene. Values represent the mean ⫾ SEM. *, significant difference between control group and Gprc6a␤-cell-cko mice (P ⬍ .05;
n ⱖ 4).
role for GPRC6A in regulating ␤-cell functions, including
␤-cell mass and insulin secretion, using both in vivo and in
vitro model systems.
Several lines of evidence support that Ocn is a direct
ligand for GPRC6A. First, we show that Ocn dose dependently activates ERK and cAMP second-messenger
pathways in HEK-293 cells expressing GPRC6A but not
in HEK-293 lacking GPRC6A expression. Ocn also stimulated AMPK phosphorylation, which has important
functions in pancreatic ␤-cells, including the regulation of
insulin secretion, cell proliferation, and survival (49). Second, we performed structural modeling, suggesting sites in
the heptahelical domain of GPRC6A that bind Ocn, as
well as showing where a hexapeptide (Ocn-6aa-C) derived
from the Ocn C-terminal docks with GPRC6A. We de-
rived 2 alternative computational models of Ocn binding
to GPRC6A and identified residues specifically interacting
with the hormone in the models (Table 2). Mutagenesis of
Arg662, Phe666, Glu746, and Trp797 in GPRC6A, residues suggested from the modeling to be important for
binding Ocn, indeed resulted in reduced Ocn receptor activation in vitro.
Analogous to our findings, previous mutagenesis-based
studies of class-C GPCR allosteric sites show that the positions of the peptide binding-pocket residues predicted to
bind Ocn are also implicated in the binding of allosteric
modulators of the related receptors mGluR-1, mGluR-5,
and CASR (50 –52). These include Arg662, Phe666,
Leu756, Trp795, Phe798, and Glu814. Hence, the modeling and mutagenesis results presented here are consistent
doi: 10.1210/en.2015-2010
press.endocrine.org/journal/endo
1875
Figure 5. Phenotype of Gprc6a␤-cell-cko mice. A, Gross appearance of adult WT and Gprc6a␤-cell-cko male mice. B, Comparison of the body weight
in control group and Gprc6a␤-cell-cko male mice at ages ranging from 3 to 18 weeks. Data represent the mean ⫾ SEM from 4 to 6 mice in each
group. GTT (C) and ITT (D) (38) in WT and Gprc6a␤-cell-cko mice. Shown is blood glucose (mg/dL) during GTT in 10-week-old control and Gprc6a␤cell-cko male and female mice. ITT data are presented as percentage of initial blood glucose concentration. Data represent the mean ⫾ SEM from
more than 5 male and female mice in each group. *, difference from control group and Gprc6a␤-cell-cko mice at P ⬍ .05.
with Ocn interacting with residues in the common allosteric site for class-C GPCRs, which may follow a similar
mode of activation of GPRC6A.
We found that full-length Ocn activated GPRC6A at
lower concentrations than a C-terminal hexapeptide of
Ocn (46). We speculate that the C-terminal is able to bind
with higher affinity to GPRC6A in the presence of fulllength Ocn, because the rest of the Ocn protein may act as
a scaffold to keep the peptide in place in the allosteric
binding site. We also found that Ocn and L-Arg had additive effects on GPRC6A receptor activation and that the
GPRC6A R662A and E746A mutants lost functional responses to Ocn and Ocn-6aa-C but not L-Arg. The molecular basis for the functional interactions between Ocn
and L-Arg may be due to Ocn activation of binding sites
in the transmembrane domain that are distinct from the
amino acid ligand binding sites in the venous fly trap motif
(22, 47, 53). This observation makes it unlikely that Ocn
actions are indirectly L-Arg released by the breakdown of
Ocn or effects on L-Arg metabolism (15).
Most importantly, we confirmed previous studies that
GPRC6A regulates ␤-cell functions (11). Indeed, we found
that GPRC6A directly regulates insulin production and
secretion by ␤-cells and that Ocn stimulation of insulin
secretion was inhibited in islets derived from mice with
conditional deletion of Gprc6a in ␤-cells (Gprc6a␤-cell-cko
mice). Gprc6a␤-cell-cko mice exhibited impaired glucose
tolerance due to diminished insulin secretion. Gprc6a␤-cell-cko
mice also exhibited reduced circulating insulin and Cpeptide concentrations, diminished pancreatic insulin
content, and impaired glucose tolerance. Finally, we confirmed that Ocn stimulated insulin secretion in INS-1
clone that expressed GPRC6A transcripts.
The loss of pancreatic ␤-cell mass represents a critical
step in the progression of type 2 diabetes, and it is known
that ␤-cell numbers and insulin secretory capacity can increase to meet metabolic demands. We found a decrease in
the size, number of islets and ␤-cell insulin content and cell
proliferation by Ki-67 immunostaining in Gprc6a␤-cell-cko
␤-cell mice, a pancreatic phenotype similar to what we
observed in Gprc6a⫺/⫺ mice (9). The lack of increased
apoptosis and diminished proliferation found in the
Gprc6a␤-cell-cko ␤-cell mice adds additional support to the
idea that the reduction in islet size is due to positive effects
of GPRC6A in regulating ␤-cell proliferation. The related
observation that Ocn augments insulin content and en-
1876
Pi et al
Ocn Regulates ␤-Cell Function via GPRC6A
Endocrinology, May 2016, 157(5):1866 –1880
Figure 6. Characterization of the phenotype of Gprc6a␤-cell-cko mice. A, Comparison of pancreas weight in 10-week-old control group and
Gprc6a␤-cell-cko mice. The weight of pancreas was normalization by body weight. Comparison of islet number (B) and insulin content (C) in
pancreas from in control group and Gprc6a␤-cell-cko mice. Values represent the mean ⫾ SEM. *, significant difference between control group and
Gprc6a␤-cell-cko mice (P ⬍ .05; n ⱖ 4). D, Representative hematoxylin and eosin staining. E, Immunostaining for insulin (red staining), the quantified
average stained area for WT and Gprc6a␤-cell-cko mouse pancreas sections is indicated below the image. F, The immunostaining for Ki-67 (upper
panel, arrowheads show Ki-67-positive staining) and cysteine-aspartic acid protease 3 (Casp3) in WT and Gprc6a␤-cell-cko mice (bottom panel). G,
Islets from Gprc6a␤-cell-cko mice showed impaired insulin stimulation index by Ocn. Stimulation index was attenuated in response to 60-ng/mL Ocn
in isolated islets from Gprc6a␤-cell-cko mice. Values represent the mean ⫾ SEM. *, significant different between control group and Gprc6a␤-cell-cko
mice (P ⬍ .05; n ⱖ 3); #, significant different between Ocn-treated control group and Gprc6a␤-cell-cko mice (P ⬍ .05; n ⱖ 3).
hanced human ␤-cell proliferation of cultured human islets and increased the production of insulin and C-peptide
in human islets grafted into NOD-SCID mice, suggests our
observations in mice are relevant to human ␤-cell function
(26). We also found that Srebp1c and Chrebp expression
were increased in the pancreas of Gprc6a␤-cell-cko mice,
suggesting that these transcription factors are downstream of GPRC6A in ␤-cells, the significance of which
will need to be determined (54 –57). It is noteworthy that
global Gprc6a⫺/⫺ mice exhibit a fatty liver, and Chrebp
up-regulates genes involved in fatty acid synthesis in a
glucose-dependent manner. Infusion of Ocn in high-fat
diet-fed mice has been shown to attenuate nonalcoholic
hepatosteatosis and decrease liver fat content (58). Chrebp
is expressed in liver as well as pancreatic ␤-cells and adipocytes. Overall, our findings, in addition to other reports
(5, 13, 26, 39, 48), define a direct role of Ocn in the regulation of serum insulin levels and ␤-cell proliferation
through activation of GPRC6A.
The pancreatic islet and ␤-cell phenotype in our
Gprc6a␤-cell-cko mice is the same as that observed with a
different Gprc6aflox/flox mouse model using Pdx1-Cre to
delete Gprc6a in ␤-cells. Thus, 2 independent studies indicate that GPRC6A directly controls ␤-cell proliferation
and insulin production (11).
Both of these studies, that targeted the extracellular
domain of GPRC6A (11), differ from another Gprc6a
knockout mouse model that deleted the transmembrane
(TM) domain. Indeed, mice with deletion of the TM domain of GPRC6A failed to exhibit increased fat mass, alterations in testosterone production, or abnormalities in
insulin secretion or glucose homeostasis (20, 22, 23) that
were observed in Gprc6a knockout mice created by targeting the extracellular domain.
The reasons for the discrepancies in these in vivo studies
are not certain. It is noteworthy, that disruption of the
extracellular domain the related CASR also results in a
different phenotype than targeting the TM domain of
CASR (59). This has been explained by either residual
dominant negative actions of the extracellular domain in
TM knockouts or residual functions due to alternatively
splicing in the extracellular domain knockouts, and could
similarly explain the differences in the 2 Gprc6a targeting
strategies. Environmental factors may also explain the discrepancies in the different GPRC6A-deficient mice. For
example, the GPRC6A-deficient mice, that were previously reported to exhibit no alterations in body composition or glucose metabolism, demonstrated increased
basal plasma glucose levels, impaired oral glucose tolerance, and insulin resistance, when placed on a high-fat
doi: 10.1210/en.2015-2010
press.endocrine.org/journal/endo
1877
Figure 7. Selective deletion of Gprc6a in pancreatic ␤-cell attenuated insulin, Srebp1c, and Chrebp expression but not glucagon expression in
pancreas. Comparison of insulin (A) and glucagon (B) expression in pancreas from in control group and Gprc6a␤-cell-cko mice. C, Comparison of
Srebp1c and Chrebp expression in pancreas and liver from in control group and Gprc6a␤-cell-cko mice. Expression was assessed by real-time PCR
using total RNA derived from pancreas or liver from control group and Gprc6a␤-cell-cko mice. Insulin, glucagon, Srebp1c, and Chrebp expression is
relative to the level of the cyclophilin control gene. Comparison of insulin (D) and glucagon (E) expression in pancreatic islets. Expression was
assessed by real-time PCR using total RNA derived from isolated islets from control group and Gprc6a␤-cell-cko mice. Insulin and glucagon
expression is relative to the level of the cyclophilin control gene. F, Comparison of Srebp1c and Chrebp expression in isolated islets from control
and Gprc6a␤-cell-cko mice. Expression of insulin, Srebp1c, and Chrebp, but not glucagon, were significantly different in islets from Gprc6a␤-cell-cko
mice compared with the islets from control group mice. G, Expression of GPRC6A transcript in INS-1 ␤-cells. The expected sized fragment was
generated from 3 different primer sets for gprc6a, set 1–2 spanning exons 1 and 2 of 438-bp length, set 3– 4 spanning exons 3 and 4 of 865 bp,
and set 5– 6 spanning exons 5– 6 of 572 bp. Dose-dependent effects of Ocn on GPRC6A-mediated ERK phosphorylation (H) and insulin secretion
(I) in INS-1 ␤-cells. Values represent the mean ⫾ SEM. *, significant difference between control group and Gprc6a␤-cell-cko mice (P ⬍ .05; n ⱖ 3).
diet; albeit these changes were attributed to a central effect
of GPRC6A in stimulating appetite, rather than a direct
effects of this receptor to regulate insulin secretion by
␤-cells (21)
In addition, there are inconsistent findings regarding
activation of GPRC6A in ␤-cells. Some investigators failed
to show that Ocn activates mouse GPRC6A expressed in
heterologous cell lines. The GPRC6A construct used in
these studies, however, was not a WT cDNA but contained
an mGluR signal peptide and c-myc insert in N terminus
that may have altered Ocn sensing (15, 18). Interestingly,
Ocn was found to stimulate insulin secretion in INS-1 rat
1878
Pi et al
Ocn Regulates ␤-Cell Function via GPRC6A
␤-cell line, but unlike our findings that show INS-1 cells
express GPRC6A, GPRC6A expression was not detected
in their INS-1 cells (18). Moreover, these investigators
found that GPRC6A is expressed in islets but failed to
show that L-arginine, which was shown to activate
GPRC6A in vitro, stimulates insulin secretion in vivo (23).
Differences in the GPRC6A constructs, cell lines used
and/or the study conditions may account for these negative in vitro findings.
From previous studies, we know that calcium modulates Ocn activation of GPRC6A (5, 7). Circular dichroism
and nuclear magnetic resonance have shown that in the
absence of Ca2⫹ binding Ocn is predominantly a random
coil but with Ca2⫹ is a folded protein (38, 60 – 62). These
observations are consistent with the fact that Ocn does not
activate GPRC6A in the absence of calcium in the media
but activates GPRC6A in the presence of 1mM calcium (7,
63). High-resolution structures from nuclear magnetic
resonance and x-ray crystallography of porcine and fish
␥-carboxylated Glu (Gla) Ocn show that the structure is
characterized by a protein core formed by 3 ␣-helical segments stabilized by a disulfide salt-bridge between 2 cysteines, with Ca2⫹ binding to the 3 Gla residues (64, 65). A
recently available crystal structure of bovine Glu-Ocn
shows a similar structure with Ca2⫹ bound, along with
highly flexible N- and C-terminal regions (17). Interactions between Ocn and GPRC6A are likely to require an
increased local concentration of Ca2⫹ binding in the orthosteric site of the receptor, which results in Ocn adopting the 3-helical tertiary structure needed for forming
proper binding/interactions with the receptor.
The fact that GPRC6A is expressed in liver, adipocytes,
muscle, and bone, raises the possibility that GPRC6A regulates insulin sensitivity in peripheral tissues. In contrast
to the insulin resistance and hyperglycemia in global
Gprc6a⫺/⫺ mice, Gprc6a␤-cell-cko mice exhibited normal
insulin sensitivity (9). The higher fasting glucose levels in
Gprc6a⫺/⫺ mice compared with Gprc6a␤-cell-cko mice
could be explained by diminished glucose utilization in
peripheral tissues in the global knockout mouse model.
Conditional deletion of Gprc6a in these other organs will
be necessary to determine the potential role of GPRC6A in
regulating gluconeogenesis, fatty acid metabolism and insulin resistance. The fact that Ocn promotes insulin-induced glucose uptake in C2C12 myotubules (66), however, is consistent with a role of GPRC6A in muscle
glucose utilization. A dual role for GPRC6A in regulating
␤ -cell function and peripheral tissue insulin sensitivity
would make this receptor an attractive therapeutic target
for treating type 2 diabetes.
In conclusion, there is a consensus that GPRC6A can
sense cations and L-amino acids (16), and recently, data
Endocrinology, May 2016, 157(5):1866 –1880
have been presented showing that testosterone can bind to
and activate GPRC6A at sites that overlap those identified
for Ocn (32). Although a single receptor that can sense at
least 4 structurally distinct ligands, including cations,
amino acids, testosterone and Ocn, at first seems questionable (16), we demonstrate both functional and structural data supporting that Ocn is a ligand for GPRC6A. As
such, GPRC6A is a point of integration for diverse ligands
ranging from nutrients to hormones, heretofore thought
to be separate and unrelated. More importantly, GPRC6A
regulation of insulin production, ␤-cell proliferation and
peripheral tissue sensitivity defines a potential new target
for treatment for type 2 diabetes. Future structural modeling and development of small molecules that mimic the
action of Ocn in activating GPRC6A may represent an
important drug development opportunity.
Acknowledgments
Address all correspondence and requests for reprints to: Min Pi,
PhD, Department of Medicine, University of Tennessee Health
Science Center, 19 South Manassas Street, Memphis, TN 38163.
E-mail: [email protected]; or Leigh Darryl Quarles, MD, Department of Medicine, University of Tennessee Health Science Center, 19 South Manassas Street, Memphis, TN 38163. E-mail:
[email protected].
Author contributions: M.P., K.K., R.Y., and Y.W. performed
experiments; S.K.N. provided important reagents and reviewed
the manuscript; M.P., K.K., J.C.S., J.B., and L.D.Q. designed the
study and wrote and reviewed the manuscript; and M.P. and
L.D.Q. are guarantors of this work and, as such, had full access
to the data in the study and take responsibility for the integrity
of the data and the accuracy of the data analysis.
This work was supported by National Institutes of Health
Grant R01-AR37308 and Americans Diabetes Association
Grant 1-13-BS-149-BR (to L.D.Q.).
Disclosure Summary: The authors have nothing to disclose.
References
1. Karsenty G, Oury F. Regulation of male fertility by the bone-derived
hormone osteocalcin. Mol Cell Endocrinol. 2014;382:521–526.
2. Oury F, Khrimian L, Denny CA, et al. Maternal and offspring pools
of osteocalcin influence brain development and functions. Cell.
2013;155:228 –241.
3. Oury F, Ferron M, Huizhen W, et al. Osteocalcin regulates murine
and human fertility through a pancreas-bone-testis axis. J Clin Invest. 2013;123:2421–2433.
4. Oury F, Sumara G, Sumara O, et al. Endocrine regulation of male
fertility by the skeleton. Cell. 2011;144:796 – 809.
5. Pi M, Wu Y, Quarles LD. GPRC6A mediates responses to osteocalcin in ␤-cells in vitro and pancreas in vivo. J Bone Miner Res.
2011;26:1680 –1683.
6. Pi M, Chen L, Huang MZ, et al. GPRC6A null mice exhibit os-
doi: 10.1210/en.2015-2010
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
teopenia, feminization and metabolic syndrome. PLoS One. 2008;
3:e3858.
Pi M, Parrill AL, Quarles LD. GPRC6A mediates the non-genomic
effects of steroids. J Biol Chem. 2010;285:39953–39964.
Pi M, Quarles LD. Multiligand specificity and wide tissue expression
of GPRC6A reveals new endocrine networks. Endocrinology. 2012;
153:2062–2069.
Pi M, Quarles LD. GPRC6A regulates prostate cancer progression.
Prostate. 2012;72:399 – 409.
Pi M, Zhang L, Lei SF, et al. Impaired osteoblast function in
GPRC6A null mice. J Bone Miner Res. 2010;25:1092–1102.
Wei J, Hanna T, Suda N, Karsenty G, Ducy P. Osteocalcin promotes
␤-cell proliferation during development and adulthood through
Gprc6a. Diabetes. 2014;63:1021–1031.
Fulzele K, Riddle RC, DiGirolamo DJ, et al. Insulin receptor signaling in osteoblasts regulates postnatal bone acquisition and body
composition. Cell. 2010;142:309 –319.
Ferron M, Wei J, Yoshizawa T, et al. Insulin signaling in osteoblasts
integrates bone remodeling and energy metabolism. Cell. 2010;142:
296 –308.
Ducy P, Desbois C, Boyce B, et al. Increased bone formation in
osteocalcin-deficient mice. Nature. 1996;382:448 – 452.
Jacobsen SE, Nørskov-Lauritsen L, Thomsen AR, et al. Delineation
of the GPRC6A receptor signaling pathways using a mammalian cell
line stably expressing the receptor. J Pharmacol Exp Ther. 2013;
347:298 –309.
Clemmensen C, Smajilovic S, Wellendorph P, Bräuner-Osborne H.
The GPCR, class C, group 6, subtype A (GPRC6A) receptor: from
cloning to physiological function. Br J Pharmacol. 2014;171:1129 –
1141.
Malashkevich VN, Almo SC, Dowd TL. X-ray crystal structure of
bovine 3 Glu-osteocalcin. Biochemistry. 2013;52:8387– 8392.
Rueda P, Harley E, Lu Y, et al. Murine GPRC6A mediates cellular
responses to L-amino acids, but not osteocalcin variants. PLoS One.
2016;11:e0146846.
Mizokami A, Yasutake Y, Gao J, et al. Osteocalcin induces release
of glucagon-like peptide-1 and thereby stimulates insulin secretion
in mice. PLoS One. 2013;8:e57375.
Clemmensen C, Pehmøller C, Klein AB, Ratner C, Wojtaszewski JF,
Bräuner-Osborne H. Enhanced voluntary wheel running in
GPRC6A receptor knockout mice. Physiol Behav. 2013;118:144 –
151.
Clemmensen C, Smajilovic S, Madsen AN, Klein AB, Holst B,
Bräuner-Osborne H. Increased susceptibility to diet-induced obesity
in GPRC6A receptor knockout mice. J Endocrinol. 2013;217:151–
160.
Wellendorph P, Bräuner-Osborne H. Molecular basis for amino
acid sensing by family C G-protein-coupled receptors. Br J Pharmacol. 2009;156:869 – 884.
Smajilovic S, Clemmensen C, Johansen LD, et al. The L-␣-amino
acid receptor GPRC6A is expressed in the islets of Langerhans but
is not involved in L-arginine-induced insulin release. Amino Acids.
2013;44:383–390.
Lee JY, Ristow M, Lin X, White MF, Magnuson MA, Hennighausen
L. RIP-Cre revisited, evidence for impairments of pancreatic ␤-cell
function. J Biol Chem. 2006;281:2649 –2653.
Nishimoto SK, Price PA. Proof that the ␥-carboxyglutamic acidcontaining bone protein is synthesized in calf bone. Comparative
synthesis rate and effect of coumadin on synthesis. J Biol Chem.
1979;254:437– 441.
Sabek OM, Nishimoto SK, Fraga D, Tejpal N, Ricordi C, Gaber AO.
Osteocalcin effect on human ␤ cells mass and function. Endocrinology. 2015;156:3137–3146.
Nishimoto SK, Price PA. The vitamin K-dependent bone protein is
accumulated within cultured osteosarcoma cells in the presence of
the vitamin K antagonist warfarin. J Biol Chem. 1985;260:2832–
2836.
press.endocrine.org/journal/endo
1879
28. Nishimoto SK. A colorimetric assay specific for ␥-carboxyglutamic
acid-containing proteins: its utility in protein purification procedures. Anal Biochem. 1990;186:273–279.
29. Price PA, Nishimoto SK. Radioimmunoassay for the vitamin K-dependent protein of bone and its discovery in plasma. Proc Natl Acad
Sci USA. 1980;77:2234 –2238.
30. Kuang D, Yao Y, Lam J, Tsushima RG, Hampson DR. Cloning and
characterization of a family C orphan G-protein coupled receptor.
J Neurochem. 2005;93:383–391.
31. Bhindi B, Locke J, Alibhai SM, et al. Dissecting the association
between metabolic syndrome and prostate cancer risk: analysis of a
large clinical cohort. Eur Urol. 2015;67:64 –70.
32. Pi M, Kapoor K, Wu Y, et al. Structural and functional evidence for
testosterone activation of GPRC6A in peripheral tissues. Mol Endocrinol. 2015;29:1759 –1773.
33. MacKerell AD, Bashford D, Bellott M, et al. All-atom empirical
potential for molecular modeling and dynamics studies of proteins.
J Phys Chem B. 1998;102:3586 –3616.
34. Kall L, Krogh A, Sonnhammer EL. An HMM posterior decoder for
sequence feature prediction that includes homology information.
Bioinformatics. 2005;21(suppl 1):i251–i257.
35. Labute P. The generalized Born/volume integral implicit solvent
model: estimation of the free energy of hydration using London
dispersion instead of atomic surface area. J Comput Chem. 2008;
29:1693–1698.
36. Kozakov D, Brenke R, Comeau SR, Vajda S. PIPER: an FFT-based
protein docking program with pairwise potentials. Proteins. 2006;
65:392– 406.
37. Echeverri CJ, Beachy PA, Baum B, et al. Minimizing the risk of
reporting false positives in large-scale RNAi screens. Nat Methods.
2006;3:777–779.
38. Atkinson RA, Evans JS, Hauschka PV, et al. Conformational studies
of osteocalcin in solution. Eur J Biochem. 1995;232:515–521.
39. Lee NK, Sowa H, Hinoi E, et al. Endocrine regulation of energy
metabolism by the skeleton. Cell. 2007;130:456 – 469.
40. Liu M, Shapiro ME. A new method for isolation of murine islets with
markedly improved yields. Transplant Proc. 1995;27:3208 –3210.
41. Gerling IC, Serreze DV, Christianson SW, Leiter EH. Intrathymic
islet cell transplantation reduces ␤-cell autoimmunity and prevents
diabetes in NOD/Lt mice. Diabetes. 1992;41:1672–1676.
42. Pi M, Wu Y, Lenchik NI, Gerling I, Quarles LD. GPRC6A mediates
the effects of L-arginine on insulin secretion in mouse pancreatic
islets. Endocrinology. 2012;153:4608 – 4615.
43. Hohmeier HE, Mulder H, Chen G, Henkel-Rieger R, Prentki M,
Newgard CB. Isolation of INS-1-derived cell lines with robust ATPsensitive K⫹ channel-dependent and -independent glucose-stimulated insulin secretion. Diabetes. 2000;49:424 – 430.
44. Novak JF, Hayes JD, Nishimoto SK. Plasmin-mediated proteolysis
of osteocalcin. J Bone Miner Res. 1997;12:1035–1042.
45. Walter S, Baruch A, Dong J, et al. Pharmacology of AMG 416
(Velcalcetide), a novel peptide agonist of the calcium-sensing receptor, for the treatment of secondary hyperparathyroidism in hemodialysis patients. J Pharmacol Exp Ther. 2013;346:229 –240.
46. Novak JF, Judkins MB, Chernin MI, et al. A plasmin-derived hexapeptide from the carboxyl end of osteocalcin counteracts oxytocinmediated growth inhibition [corrected] of osteosarcoma cells. Cancer Res. 2000;60:3470 –3476.
47. Faure H, Gorojankina T, Rice N, et al. Molecular determinants of
non-competitive antagonist binding to the mouse GPRC6A receptor. Cell Calcium. 2009;46:323–332.
48. Tiano JP, Mauvais-Jarvis F. Molecular mechanisms of estrogen receptors’ suppression of lipogenesis in pancreatic ␤-cells. Endocrinology. 2012;153:2997–3005.
49. Fu A, Eberhard CE, Screaton RA. Role of AMPK in pancreatic ␤ cell
function. Mol Cell Endocrinol. 2013;366:127–134.
50. Wu H, Wang C, Gregory KJ, et al. Structure of a class C GPCR
1880
51.
52.
53.
54.
55.
56.
57.
Pi et al
Ocn Regulates ␤-Cell Function via GPRC6A
metabotropic glutamate receptor 1 bound to an allosteric modulator. Science. 2014;344:58 – 64.
Doré AS, Okrasa K, Patel JC, et al. Structure of class C GPCR
metabotropic glutamate receptor 5 transmembrane domain. Nature. 2014;511:557–562.
Petrel C, Kessler A, Dauban P, Dodd RH, Rognan D, Ruat M. Positive and negative allosteric modulators of the Ca2⫹-sensing receptor interact within overlapping but not identical binding sites in the
transmembrane domain. J Biol Chem. 2004;279:18990 –18997.
Wellendorph P, Hansen KB, Balsgaard A, Greenwood JR, Egebjerg
J, Bräuner-Osborne H. Deorphanization of GPRC6A: a promiscuous L-␣-amino acid receptor with preference for basic amino acids.
Mol Pharmacol. 2005;67:589 –597.
Takahashi A, Shimano H, Nakagawa Y, et al. Transgenic mice overexpressing SREBP-1a under the control of the PEPCK promoter
exhibit insulin resistance, but not diabetes. Biochim Biophys Acta.
2005;1740:427– 433.
Diraison F, Parton L, Ferré P, et al. Over-expression of sterol-regulatory-element-binding protein-1c (SREBP1c) in rat pancreatic islets induces lipogenesis and decreases glucose-stimulated insulin release:
modulation
by
5-aminoimidazole-4-carboxamide
ribonucleoside (AICAR). Biochem J. 2004;378:769 –778.
Metukuri MR, Zhang P, Basantani MK, et al. ChREBP mediates
glucose-stimulated pancreatic ␤-cell proliferation. Diabetes. 2012;
61:2004 –2015.
Iizuka K, Bruick RK, Liang G, Horton JD, Uyeda K. Deficiency of
carbohydrate response element-binding protein (ChREBP) reduces
Endocrinology, May 2016, 157(5):1866 –1880
58.
59.
60.
61.
62.
63.
64.
65.
66.
lipogenesis as well as glycolysis. Proc Natl Acad Sci USA. 2004;
101:7281–7286.
Gupte AA, Sabek OM, Fraga D, et al. Osteocalcin protects against
nonalcoholic steatohepatitis in a mouse model of metabolic syndrome. Endocrinology. 2014;155:4697– 4705.
Chang W, Tu C, Chen TH, Bikle D, Shoback D. The extracellular
calcium-sensing receptor (CaSR) is a critical modulator of skeletal
development. Sci Signal. 2008;1:ra1.
Hauschka PV, Carr SA. Calcium-dependent ␣-helical structure in
osteocalcin. Biochemistry. 1982;21:2538 –2547.
Delmas PD, Stenner DD, Romberg RW, Riggs BL, Mann KG. Immunochemical studies of conformational alterations in bone ␥-carboxyglutamic acid containing protein. Biochemistry. 1984;23:
4720 – 4725.
Dowd TL, Rosen JF, Li L, Gundberg CM. The three-dimensional
structure of bovine calcium ion-bound osteocalcin using 1H NMR
spectroscopy. Biochemistry. 2003;42:7769 –7779.
Pi M, Faber P, Ekema G, et al. Identification of a novel extracellular
cation-sensing G-protein-coupled receptor. J Biol Chem. 2005;280:
40201– 40209.
Hoang QQ, Sicheri F, Howard AJ, Yang DS. Bone recognition
mechanism of porcine osteocalcin from crystal structure. Nature.
2003;425:977–980.
Frazão C, Simes DC, Coelho R, et al. Structural evidence of a fourth
Gla residue in fish osteocalcin: biological implications. Biochemistry. 2005;44:1234 –1242.
Tsuka S, Aonuma F, Higashi S, et al. Promotion of insulin-induced
glucose uptake in C2C12 myotubes by osteocalcin. Biochem Biophys Res Commun. 2015;459:437– 442.