MOLECULAR AND CELLULAR BIOLOGY, July 1998, p. 3880–3888
0270-7306/98/$04.0010
Copyright © 1998, American Society for Microbiology. All Rights Reserved.
Vol. 18, No. 7
Schistosome Satellite DNA Encodes Active
Hammerhead Ribozymes
GERARDO FERBEYRE,1† JAMES M. SMITH,2
AND
ROBERT CEDERGREN1*
Département de Biochimie, Université de Montréal, Montréal, Québec, Canada H3C 3J7,1 and Institute of
Parasitology, Macdonald Campus of McGill University, Ste-Anne-de-Bellevue, Quebec, Canada H9X 3V92
Received 11 February 1998/Returned for modification 2 April 1998/Accepted 20 April 1998
Using a computer program designed to search for RNA structural motifs in sequence databases, we have
found a hammerhead ribozyme domain encoded in the Sma repetitive DNA of Schistosoma mansoni. Transcripts of these repeats are expressed as long multimeric precursor RNAs that cleave in vitro and in vivo into
unit-length fragments. This RNA domain is able to engage in both cis and trans cleavage typical of the
hammerhead ribozyme. Further computer analysis of S. mansoni DNA identified a potential trans cleavage site
in the gene coding for a synaptobrevin-like protein, and RNA transcribed from this gene was efficiently cleaved
by the Sma ribozyme in vitro. Similar families of repeats containing the hammerhead domain were found in
the closely related Schistosoma haematobium and Schistosomatium douthitti species but were not present in
Schistosoma japonicum or Heterobilharzia americana, suggesting that the hammerhead domain was not acquired
from a common schistosome ancestor.
suggestive, no cellular role has yet been assigned to these
self-cleaving transcripts (17). We show here that the Sma repeats from S. mansoni and their counterparts in S. haematobium and Schistosomatium douthitti contain a hammerhead
catalytic domain having both cis and trans cleavage properties.
These observations raise the possibility that the presence of
self-cleaving domains in repetitive DNA is more than coincidental.
Schistosomes are a family of digenetic trematodes that parasitize many animal species; three members of this group,
Schistosoma mansoni, Schistosoma haematobium, and Schistosoma japonicum, infect over 200 million people worldwide.
These blood flukes possess a complex life cycle initiated by the
release of eggs from a human host. Fluke eggs produce larvae,
called miracidia, which infect snails, a secondary host. Snails in
turn shed cercariae, another larval form, which are able to
penetrate human skin, transform into schistosomula, and, after
a complex migration and differentiation process, develop into
sexual adults. Adults produce eggs to complete the cycle.
Hopefully, the study of the genomic structure of these species
could provide key information for the more effective control of
these devastating parasites.
Most eukaryotic genomes contain families of interspersed
repetitive DNA called SINEs (37), the sequences of which are
generally related to tRNAs or 7SL RNA (1, 3, 10, 41). Their
repetitive nature is thought to be due to an amplification process involving reverse transcription of RNA transcripts which
are subsequently integrated into host DNA (21, 40). The species S. mansoni contains a family of SINEs, the 335-bp Sma
repeats, which occur over 10,000 times in the haploid genome.
Many copies of this repeat are clustered on the W female
chromosome, while others are dispersed throughout the genome (38). In spite of this ability to amplify themselves, no
function has been ascribed to SINEs.
Transcripts of the highly conserved family of satellite DNAs
(Sat2) found in the newt do, however, possess a self-processing
activity typical of the hammerhead domain found in plant
viroids and their satellite RNAs (5, 7, 13, 39). Tandem arrays
of the Sat2 repeats are dispersed throughout the genome of
Notophthalmus viridescens and other newt species. Their transcripts have tissue-specific 59 ends, suggesting that transcription and/or self-cleavage are regulated in vivo (14). Although
MATERIALS AND METHODS
Searching the database for hammerhead ribozymes. The program RNAMOT
was used to search for hammerhead ribozyme domains in GenBank, release
April 1996 (23). The format of the descriptor used by the program to accomplish
this task is illustrated in Fig. 1.
Organisms. The Puerto Rican strain of S. mansoni was obtained from the
Institute of Parasitology of McGill University and was maintained by being
cycled through Biomphalaria glabrata (Puerto Rican strain) and female, CD-1
outbred mice (Charles River, St. Constant, Québec, Canada). S. mansoni adult
worms were obtained by perfusion of mice infected 7 weeks previously with 150
cercariae (29). They were washed in phosphate-buffered saline at pH 7.2, snap
frozen in liquid nitrogen, and stored at 280°C. Schistosomula of S. mansoni were
prepared by artificial transformation of cercariae (29), washed in phosphatebuffered saline, pelleted by centrifugation, snap frozen in liquid nitrogen, and
stored at 280°C.
Frozen specimens of Schistosomatium douthitti and ethanol-preserved Heterobilharzia americana were kindly provided by Scott Snyder at the University of
New Mexico. Frozen specimens of adult S. japonicum and S. haematobium were
provided by a National Institute of Allergy and Infectious Diseases supply contract (AI 55270).
Identification and amplification of Sma repeats in different organisms. DNA
was purified from S. mansoni, S. haematobium, S. japonicum, Schistosomatium
douthitti, and H. americana as follows. Frozen worms were suspended in 5 mM
Tris-HCl (pH 8)–100 mM EDTA–0.5% sodium dodecyl sulfate (SDS). Proteinase K was added to a final concentration of 50 mg/ml, and the mixture was
incubated for 3 h at 60°C. Worm lysates were then extracted once with phenol
and then with phenol-chloroform (1:1). DNA in the aqueous phase was obtained
by ethanol precipitation. To obtain DNA from B. glabrata, the same procedure
was used, but in this case, the frozen snails were first ground in liquid nitrogen
to destroy the shell. Sma repeats were amplified from the above DNA preparations with two sets of primers. Primers 1A and 1B (see Fig. 2A) are 59CCCAT
CGCACAAGCAAGTGG39 and 59CACTTAGTATTGTTTGTTTGAATC39,
respectively. Primer 1C, used to amplify Schistosomatium douthitti satellite DNA,
is 59TATAGGTTTTAGTGTCATTG39. Primers 2A and 2B are 59GACGCGC
GTTTCGTCCTATT39 and 59CTGGATTCCACTGCTATCCA39, respectively.
PCRs were carried out with either Vent DNA polymerase (New England Biolabs
[NEB]) or Taq DNA polymerase (Pharmacia) with the buffers supplied by the
manufacturers. PCR conditions were as follows: 50 pmol of the primers, 200 mM
(each) deoxynucleoside triphosphates (dNTPs), and 1 U of polymerase in 13
* Corresponding author. Mailing address: Département de Biochimie, Université de Montréal, C. P. 6128, succursale Centre-Ville,
Montréal, Québec, Canada H3C 3J7. Phone: (514) 343-6320. Fax:
(514) 343-2210. E-mail: [email protected].
† Present address: Cold Spring Harbor Laboratory, Cold Spring
Harbor, NY 11724.
3880
VOL. 18, 1998
Vent DNA polymerase or Taq DNA polymerase buffer. PCR cycles were for 30
or 60 s at 94°C; 30 or 60 s at 45, 50, 55, or 60°C; and 30 or 60 s at 72°C. Amplified
bands were cloned into pBLUESCRIPT (Stratagene) and sequenced by existing
procedures (35).
In vitro transcription and cleavage kinetics. Individual clones were PCR
amplified as described above with oligonucleotide 1B and an oligonucleotide
containing the sequence of the T7 RNA polymerase promoter 59 to the sequence
of oligonucleotide 1A, 59TAATACGACTCACTATAGGCCCATCGCACAAG
CAAGTGG39. Transcription reactions with T7 RNA polymerase (NEB) were as
described previously (28). The reaction mixtures contained 40 mM Tris-HCl (pH
8.0) at 37°C; 12 mM MgCl2; 5 mM dithiothreitol; 2 mM spermidine- (HCl)3; 25
mM NaCl; 1 mM (each) ATP, CTP, and GTP and 0.5 mM UTP; 10 mCi of
[a-32P]UTP (3,000 Ci/mmol); 1 mM DNA template; 40 U of RNasin (Pharmacia); and 100 U of T7 RNA polymerase (NEB). Reaction mixtures were incubated for 2 to 4 h at 30 or 37°C. To determine the cleavage rate in cis, full-length
transcripts from Sma or Sda templates were gel purified, eluted, phenol extracted, and recovered by ethanol precipitation. Cleavage reactions were carried
out in 40 mM Tris-HCl (pH 8.0)–10 mM MgCl2–1 mM RNA at the times and
temperatures indicated in the figures. Reactions were terminated by adding an
equal volume of 95% (vol/vol) formamide–0.1% xylene cyanol–0.1% bromophenol blue–10 mM EDTA. Products were heated at 95°C for 1 min, analyzed by
electrophoresis in 6% polyacrylamide–8 M urea gels, and quantified by densitometry of the corresponding autoradiogram.
The synaptobrevin-like gene DNA template was obtained from S. mansoni
DNA by PCR amplification with Vent DNA polymerase (NEB) and the primers
59CTGTCAGAAAACATAGATAG39 and 59AAGCTTCATAAAAATATTTA
39. PCR cycles were 1 min at 94°C, 1 min at 55°C, and 1 min at 72°C. The PCR
products were cloned into pBLUESCRIPT and sequenced. The 59 cleavage
product of the Sma transcript was obtained after in vitro transcription and gel
purification as described previously. The synaptobrevin-like protein RNA fragment was also obtained by in vitro transcription from the cloned PCR fragment
described above, after insertion into pBLUESCRIPT and digestion with XbaI.
The full-length products of both the ribozyme and the substrate were gel purified
and quantified by UV spectroscopy. The rate of the trans reaction between the
59 cleavage product of the cis reaction and the synaptobrevin-like protein RNA
was determined under single-turnover conditions. Constant amounts of substrate
(2 nM) were incubated with increasing amounts of ribozyme (from 2- to 64-fold
molar excess) for 4 h. Ribozyme and substrate were mixed in 40 mM Tris-HCl
(pH 8.0)–10 mM MgCl2–1 mM EDTA, heated for 1 min at 95°C, and cooled on
ice. Reactions were started by adding 10 mM MgCl2 and terminated by adding
an equal volume of 95% (vol/vol) formamide–0.1% xylene cyanol–0.1% bromophenol blue–10 mM EDTA. The kcat/Km values are derived from the equation ln
F/t 5 kcat/Km, where F is the fraction of uncleaved substrate at the end of the
reaction at time t.
RNA ligation-dependent PCR. A sample of 1 mg of in vitro-transcribed RNA
was incubated in 13 polynucleotide kinase buffer (NEB)–1 mM ATP–10 U of
polynucleotide kinase for 30 min at 37°C. The phosphorylated RNA was then
ligated to the 14-mer oligoribonucleotide 59ACGGUCUCACGAGC39, in 50
mM HEPES (pH 7.5)–10 mM MgCl2–1 mM ATP–20 mM dithiothreitol–1 mg of
RNase-free bovine serum albumin–10% dimethyl sulfoxide–6 U of T4 RNA
ligase (NEB) in a final volume of 20 ml. The reaction mixture was incubated
overnight at 15°C, the reaction was stopped by heating at 65°C and the products
were recovered by ethanol precipitation. Ligated RNA was reverse transcribed in
13 Vent DNA polymerase buffer (NEB) supplemented with 1 mM (each)
dNTPs in a volume of 20 ml with 50 pmol of the primer 1B and 50 U of Moloney
murine leukemia virus reverse transcriptase (NEB). The reaction was carried out
for 2 h at 37°C. The resulting cDNA was then amplified by using primer 1B and
the deoxyribonucleotide version of the oligoribonucleotide 14-mer used in the
ligation reaction. PCRs were carried out in a final volume of 100 ml with 1 U of
Vent DNA polymerase for 30 cycles at 94, 50, and 72°C. The PCR products were
cloned and sequenced.
RNA purification, Northern blotting, RT-PCR, and primer extension. Total
RNA was obtained by treatment of frozen worms previously powdered on dry ice
with 4 M guanidinium isothiocyanate, followed by phenol chloroform extraction
and ethanol precipitation. Then it was treated for 1 h with DNase I (Pharmacia),
1 U/mg of total RNA, in 40 mM Tris-HCl (pH 7.9)–6 mM MgCl2, at 37°C. For
Northern blots, the RNA was fractionated on 1.4% formaldehyde-agarose gels
and transferred to Hybond-N nylon membranes (Amersham) in 203 SSC (13
SSC is 0.15 M NaCl, 0.015 M sodium citrate [pH 7.0], and 0.1% SDS). Hybridization was performed by incubation of the membranes with 32P-labeled probes
(T7 Quickprime; Pharmacia Biotech Inc.) at 65°C in 7% SDS–0.25 M Na2HPO4
(pH 7.4)–1% bovine serum albumin (Gibco). The membranes were washed twice
at 65°C in 23 SSC for 10 min and once in 0.23 SSC for 30 min. For reverse
transcriptase PCR (RT-PCR), 1 mg of total RNA was incubated at 30°C for 30
min with 50 pmol of primer 1B in 20 ml of 13 Vent DNA polymerase buffer
(NEB) supplemented with 2 mM dNTPs. Then, 40 U of RNase-Guard (Pharmacia) and 54 U of Moloney murine leukemia virus reverse transcriptase was
added and the reaction was continued for 1 h at 37°C. The cDNA was amplified
by adding primers 1A and 1B (50 pmol of each), 2 U of Vent DNA polymerase,
and 13 Vent DNA polymerase buffer to make 100 ml. The PCR was carried out
for 30 cycles of 1 min each at 94, 55, and 72°C. The products were resolved by
SCHISTOSOME HAMMERHEAD RIBOZYME
3881
FIG. 1. Searching the GenBank database for hammerhead ribozyme RNA
domains. (Top) The secondary structure of the hammerhead domain with the
conserved nucleotides indicated. The part for which the descriptor was written is
shown in boldface. (Bottom) The descriptor used in the program RNAMOT (23)
was composed of the following features: s1 H1 s2 H1 s3. The s1 feature scans for
a 12-nucleotide (nt) sequence of the form NNNNNCUGANGA, the first 5
nucleotides of which are represented by N (any nucleotide) and which includes
the required sequence CUGANGA, which is part of the conserved catalytic core.
The feature H1, s2, H1 corresponds to the helix II region closed by a loop of 4
to 10 nucleotides (s2). The numbers 4:4 refer to a helix of 4 bp having zero
mismatches but allowing the wobble GU. In this helix, a GC pair is required at
the base. The s3 feature requires an 8-nucleotide sequence of the form
GAAASNNN, where S represents C or G. This feature contains the remaining
part of the conserved catalytic core and the variable nucleotides of the 39
recognition helix. In order to catalyze a cleavage reaction, RNA defined by this
descriptor must recognize a substrate RNA by base pairing. The sequence of a
possible substrate is represented, and the arrow indicates the cleavage site. The
numbering system is that of Hertel et al. (19).
agarose gel electrophoresis. Primer extension with 10 mg of total RNA was under
the conditions described elsewhere (35).
Nucleotide sequence accession number. The nucleotide sequences reported
here have been assigned the following GenBank accession numbers: for S.
mansoni Sma, GenBank AF036739 to AF036756; for S. haematobium Sha,
GenBank AF036389 to AF036398; and for Schistosomatium douthitti Sda, GenBank AF036399 to AF036404.
RESULTS
Identification and cloning of hammerhead-containing repeats from S. mansoni. We have searched the DNA sequence
bank (GenBank, version April 1996) for putative hammerhead
ribozyme domains with a search engine known as RNAMOT
(23). This program screens sequences for potential secondary
and tertiary structural elements to uncover cryptic RNA motifs
undetected by primary sequence analysis. The descriptor used
to search for the hammerhead ribozyme is shown in Fig. 1. The
descriptor does not include the base-pairing requirements of
helices I and III of the consensus hammerhead domain because we wanted to leave open the possibility of finding a
domain that might act in trans; that is, the representation of the
two helices as single stranded is equivalent to defining them as
substrate recognition arms. This search not surprisingly found
the known hammerhead domains in plant viroids and their
3882
FERBEYRE ET AL.
FIG. 2. A family of repetitive sequences coding for self-cleaving transcripts in
S. mansoni. (A) General organization of Sma repeats into three regions: the 59
region, which has similarity to tRNA and contains boxes A and B, required for
transcription by RNA polymerase III; the middle region, encompassing the
hammerhead domain (HH); and the 39 region. Primers used for the experiments
reported here are indicated as 1A, 2A, 1B, and 2B, and their positions on the
map correspond to the parts of the sequence to which they are complementary.
(B) Alignment of the tRNA and hammerhead (HH) ribozyme domains of 18
different Sma clones. The tRNA sequence is that of the serine 3 tRNA from the
rat (accession no. K00371). In the tRNA domain, box A and B nucleotides are
indicated in boldface. In the hammerhead domain, nucleotides essential for
catalysis are indicated in boldface. (C) Summary of the hammerhead domain
sequences found in 18 different Sma clones. The cleavage site is denoted by cs.
Substitutions found in different isolates are denoted by arrows directed out of the
structure, insertions are denoted by arrows directed toward the structure, and
deletions are denoted by D.
satellite RNAs and in several newt species but unexpectedly
found them among the satellite DNA sequences from the human blood fluke S. mansoni as well (accession no. SCMRSLA).
The chance occurrence of this domain is one in 1013 nucleotides based on the descriptor used in the search. Moreover,
immediately downstream of this domain is a region complementary to the substrate recognition arms, fitting the substrate
requirements for this ribozyme.
To study this region, PCR primers were designed to bind to
the 59 and 39 ends of the repetitive unit (primers 1A and 1B
MOL. CELL. BIOL.
[Fig. 2A]), and amplifications with them were carried out on
genomic DNA from S. mansoni. Several amplification products, consisting mainly of a 335-bp fragment and multiples
thereof, were isolated. The 335-bp fragment band was cloned
into pBLUESCRIPT, and 18 independent clones were sequenced. The 18 clones possessed very similar sequences composed of three regions (Fig. 2A): (i) a tRNA-like region at the
59 terminus containing the RNA polymerase III promoter elements, boxes A and B (Fig. 2B); (ii) the hammerhead domain
(Fig. 2B and C); and (iii) a 39-terminal domain. Six of the 18
clones possessed a hammerhead domain containing all essential nucleotides and base pairing, including two adjacent GC
base pairs and an internal loop in helix I known to enhance the
catalytic activity of the newt hammerhead. These features fulfill all known criteria for hammerhead activity. The other 12
sequences exhibited a small number of nucleotide changes in
both single-stranded and helical regions, likely rendering them
catalytically inactive based on in vitro data.
Transcripts from the Sma family of satellite DNA selfcleave in vitro. Two of the cloned repeat sequences were chosen to characterize the cleavage properties of the hammerhead
domain: one corresponded to a canonical hammerhead (Sm1
[Fig. 2B]) and the other contained a G3C change at position
5 (Sm3). In vitro transcripts of the two clones were prepared
from the PCR-generated templates containing a T7 promoter
with T7 RNA polymerase. As demonstrated in Fig. 3A, the
repeat containing the canonical hammerhead domain cleaved
during transcription, while the repeat containing the mutated
hammerhead did not cleave.
The fragment of DNA containing the catalytically active
domain was then subjected to restriction enzyme digestion
prior to transcription in order to help define the catalytic
domain. Figure 3A shows that the length of the 39 cleavage
product varied directly with template length, as would be expected if the hammerhead domain was responsible for cleavage. The cleavage site itself was mapped by primer extension
analysis (shown in Fig. 4C) and RNA ligation-dependent PCR,
both with primer 1B (data not shown). Both techniques identify the C in the sequence ’CUG at the 59 end of the 39
cleavage product. In addition, the 39 cleavage product could be
labeled with radioactive phosphate by T4 polynucleotide kinase in the presence of [g-32P]ATP, indicating the presence of
a 59 hydroxyl group. Under the conditions used during in vitro
transcription, 58% of the transcripts were cleaved at 37°C and
37% were cleaved at 30°C. Cleavage required Mg21, the optimal concentration of which was 10 mM at pH 8. The kinetics
of cleavage, shown in Fig. 3B and C, were determined at 30°C.
The kcat of self-cleavage was 0.30 6 0.05 min21. Transcripts of
repeats 5, 7, 10, 12, and 20, which also contain consensus
hammerhead domains, have cleavage rates between 0.22 and
0.36 min21.
Sma repeats are expressed in vivo. The presence and high
conservation of the RNA polymerase III promoter elements
among different repeats of the Sma family suggested that the
repeat region is transcribed in vivo; however, the absence of
termination signals raised the issue of the length of such transcription products. We addressed these questions by the analysis of total cellular RNA by Northern blotting, RT-PCR, and
primer extension experiments. The autoradiogram obtained
from probing the Northern blot of total RNA from both female and male adult schistosomes and schistosomulas with an
Sm1 PCR fragment produced the band pattern shown in Fig.
4A. Since RNA quantities are approximately equivalent in
each lane, it would appear that these developmental stages
express the Sma repeats at virtually the same level. Also, the
size of the major band in all cases corresponds to that of the
VOL. 18, 1998
SCHISTOSOME HAMMERHEAD RIBOZYME
3883
FIG. 3. In vitro self-cleavage of the transcripts derived from Sma repeats. (A) Self-cleavage during in vitro transcription at 37°C of different Sma-derived templates.
Lane 1, transcription products of the Sm1 template. Lane 2, product after shortening of the Sm1 template by the restriction endonuclease ClaI. Lane 3, product after
shortening of the Sm1 template by restriction endonuclease NdeI. Lane 4, pattern obtained from the Sm3 template carrying a G5➛C base substitution. In vitro
transcription was less efficient on the templates treated with restriction endonucleases. Numbers at right indicate sizes in base pairs. (B) Kinetics of self-cleavage at 30°C
in 10 mM magnesium and at pH 8. Gel-purified full-length transcripts were incubated under the cleavage conditions described in Materials and Methods, and the
reaction was stopped at the indicated time. The products were resolved on a 6% acrylamide–8 M urea gel. Numbers at right indicate size in base pairs. (C) The
intensities of the bands in panel B were measured by densitometry, normalized to the background of degradation, and graphed on a semilog plot to calculate the rate
of the reaction. S, concentration of substrate at time t; So, initial substrate concentration.
unit repeat. Bands of greater length, corresponding to multiples of unit-length Sma, are also present and are more evident
after overexposure of the autoradiogram. These data suggest
that the major band arises after hammerhead processing of
long multimeric transcripts. However, the preponderance of
single-unit lengths in light of the large number (approximately
two-thirds) of putatively inactive forms requires that cleavage
take place at sites which are in trans or at least distal to the
catalytic domain unless only the active repeats are transcribed.
In the RT-PCR protocol, reverse transcription was performed with primer 2B (Fig. 2A), and primer 2A was added for
PCR. These primers were chosen because they would amplify
either multimeric transcripts or unit-length transcripts derived
from hammerhead processing of multimeric transcripts; in
contrast, they could not amplify single repeats of the unit as
defined in Fig. 2A. RT-PCR results (Fig. 4B) confirmed that
Sma repeats are expressed in both female and male adult
schistosomes. Sequences of these products were the expected
3884
FERBEYRE ET AL.
FIG. 4. Expression of the Sma family of repetitive DNA in vivo. (A) Northern blot analysis with total RNA from schistosomula (lane 1), adult males (lane
2), adult females (lane 3), and in vitro-transcribed Sma1 repeat (lane 4). The
quantity of RNA used in each analysis was judged equivalent by ethidium bromide staining of the gel and by comparison of the intensity of the rRNA bands
in each preparation. (B) Reverse transcription-PCR analysis using primers 2A
and 2B from Fig. 2A. Total DNA-free RNAs from adult males (lane 1) or adult
females (lane 2) were reverse transcribed with primer 2B. The cDNA was
amplified by Vent DNA polymerase (see Materials and Methods). In lane 3, a
mixture of both female and male RNA preparations was subjected to the same
treatments as were the preparations in lanes 1 and 2, except that reverse transcriptase was omitted. Lane 4 is the 123-bp ladder from Gibco. (C) Primer
extension analysis of in vivo transcripts from the Sma family of satellite DNA. In
vitro-transcribed Sm1 repeat (lane 1) and total RNAs from adult males (lane 2)
and adult females (lane 3) were annealed with primer 1B and reverse transcribed
with Superscript Kit II from Gibco at 42°C. The products were resolved on a 6%
acrylamide–8 M urea gel. Sequencing reactions performed with primer 1B on the
Sm1 template were run in the same gel. Numbers to the right of panel A and the
left of panels B and C indicate size in base pairs. The arrow on the right indicates
the positions of the expected cleavage products.
permutated versions of the sequences obtained from genomic
DNA with primers 1A and 1B.
The 59 end of Sma transcripts was also studied to determine
whether unit-length transcripts were generated by transcription alone or by transcription followed by cleavage. Normally,
the 59 terminus of the RNA would contain the polymerase III
promoter sequence; however, if the terminus of the unit-length
MOL. CELL. BIOL.
transcript is produced by cleavage of long transcripts, then the
59-terminal sequence should be the same as that produced by
in vitro cleavage. By using primer extension with primer 1B,
the two possibilities can be distinguished by the lengths of the
extension products. The data presented in Fig. 4C confirm that
the in vivo product is identical to the in vitro product and,
therefore, results from hammerhead cleavage.
trans cleavage of transcripts from the Sma family. The high
proportion of unit-length Sma transcripts despite the preponderance of repeats containing inactive hammerhead domains
indicates that simple self-cleavage is not the only processing
mechanism to which the Sm transcripts are subjected. Active
ribozymes from distant sites would have to recognize and
cleave a target sequence from a repeat containing a disabled
hammerhead in order to explain the data shown in Fig. 4A.
Active transcripts could first self-cleave and then go on to
cleave a repeat with an inactive ribozyme either in cis or in
trans (Fig. 5A). Note that, because of the polarity of cleavage,
a catalytic domain which had been involved in self-cleavage
could cleave only upstream in cis, whereas trans cleavage could
be accomplished at any site. Consider as well that trans cleavage implies the use of either the I/II format of the hammerhead (8) or the more familiar I/III format. In the I/II format,
the catalytic domain would provide the essential CUGACGA
sequence and the target would provide the conserved GAAA
sequence and the cleavage site GUC (Fig. 5A).
trans cleavage also raises the issue of cleavage of other cellular targets. A BLAST search of the known S. mansoni sequences in GenBank for the predicted substrate sequence produced one such target, the gene coding for a synaptobrevin-like
protein (accession no. SMU30291 [Fig. 5A]). The potential
target sequence is 97% identical to that of the Sma family and
is found in the only known intron for this gene whose entire
sequence is not yet available. Since there is no catalytic domain
in this target region, it would be provided presumably from a
self-cleaved Sma transcript (Fig. 5A).
In order to demonstrate the feasibility of the trans reaction,
we cloned a 650-bp fragment of the synaptobrevin-like protein
gene from S. mansoni by PCR and prepared substrate RNA
from it by in vitro transcription with T7 RNA polymerase.
Figure 5B shows that the 650-ribonucleotide fragment was
readily cleaved into fragments of 419 and 231 nucleotides in
the presence of cleavage products of the Sma repeat. The 59
product of cleavage alone also produces these bands (data not
shown). The cleavage site was finely mapped by RNA ligationdependent PCR, which permitted sequencing of the entire 39
cleavage product. This sequence corresponds to that expected
from the cleavage suggested in Fig. 5A. The cleavage rate of
the synaptobrevin-like protein RNA fragment was measured
under single-turnover conditions, where the ribozyme is in
large excess over the substrate so that the observed rate of
cleavage is independent of product release. The amount of
cleaved substrate increased linearly with ribozyme concentration (Fig. 5B and C), reaching 70 to 85% after 4 h of incubation
with a 64-fold molar excess of the ribozyme. The catalytic
efficiency of this hammerhead reaction is kcat/Km 5 500 M21
s21, which is comparable to the efficiency (10 to 500 M21 s21)
of artificially engineered hammerhead ribozymes against substrates of similar length (18).
The distribution of hammerhead-containing satellite DNA
in the Schistosomatidae family. Schistosomes have adult forms
in different vertebrates and larval stages in various molluscan
hosts. The species that parasitize humans have been classically
grouped with respect to egg morphology and snail host type
into African (S. mansoni and S. haematobium) and Asian (S.
japonicum) schistosomes, while the American species, Schisto-
VOL. 18, 1998
SCHISTOSOME HAMMERHEAD RIBOZYME
3885
FIG. 5. The Sma self-cleavage products as a trans-acting ribozyme. (A) A model of trans-acting ribozyme catalysis in the I/II format. The catalytic fragment is
produced from self-cleavage of an active Sma repeat, which is shown in boldface. The substrate is a transcript of the Sma family with a disabled hammerhead ribozyme
or the precursor mRNA of the synaptobrevin-like protein in the I/II format. The I/III format is shown in Fig. 1. (B) Cleavage kinetics of the trans hammerhead reaction
with synaptobrevin-like protein precursor mRNA, obtained by in vitro transcription from a cloned template. Different concentrations of gel-purified 59 and 39 cleavage
products from the self-cleavage reaction of Sma 1 transcripts (see Materials and Methods) were incubated in the cleavage conditions described in Materials and
Methods with in vitro-transcribed synaptobrevin-like protein RNA for 4 h at 37°C. The products were resolved on a 6% acrylamide–8 M urea gel. Numbers at right
indicate size in base pairs. (C) The intensity of the bands in panel B was measured by densitometry, normalized to the background of degradation, and graphed on a
semilog plot to calculate the rate of the reaction. S/t, ratio of substrate concentration per time unit.
somatium douthitti and H. americana, parasitize small mammals. The phylogeny of rRNA sequences confirms this morphogeographic classification separating African, American,
and Asian species (2).
The presence of satellite DNA coding for the self-cleaving
repeats in the human parasite S. mansoni suggested that the
distribution of the Sma family among the Schistosomatidae as
a function of host type could be of interest. This idea led to the
PCR amplification of DNA from the schistosomes listed in
Table 1 with two sets of primers: 1A and 1B and 2A and 2B
(Fig. 2A). The latter set was useful because of its specificity for
the hammerhead ribozyme domain. Results of these PCR amplifications are presented in Table 1. In agreement with the
previous phylogenies, Sma repeats were readily amplified with
both sets of primers in S. haematobium but not in S. japonicum
or H. americana. In addition, the hammerhead-specific primers
allowed the amplification of a family of repeats from Schistosomatium douthitti. Amplification of DNA from B. glabrata, the
intermediate molluscan host of S. mansoni, as a control was
negative.
Several repeats from S. haematobium were cloned and sequenced. The Sha repeats (named in the same manner as the
Sma repeats in S. mansoni) were 92% identical to the Sma
family and had a similar three-domain organization including
the polymerase III promoter region and the hammerhead domain; however, unusual variations were found in the hammerhead domain (Fig. 6A). Most of the clones contained a three-A
insertion immediately after the putative self-cleavage site, like
3886
FERBEYRE ET AL.
MOL. CELL. BIOL.
TABLE 1. PCR screening for satellite DNA of the a family in
different species
Species
S. mansoni
S. haematobium
Schistomatium douthitti
S. japonicum
H. americana
B. glabrata
Mus musculus
Result for primer combinationa
1A-1B
2A-2B
1A-1C
1
1
6
2
2
2
2
1
1
6
2
2
2
2
NA
NA
1
2
2
2
2
a
6, amplification products were seen with the primer combination but did not
have the same size as the a repeats in S. mansoni. 2, no amplification products
were observed after several PCRs where the annealing temperatures varied from
45 to 55°C and template DNA concentrations varied from 0.05 to 1 mg. NA, not
applicable.
the Sma repeats Sm4, Sm14, and Sm18 presented in Fig. 2B. In
contrast to the Sma repeats, for which most sequence variations were found in the conserved hammerhead core, all Sha
sequences had an intact hammerhead ribozyme core; variations were often found in the adjacent helices.
The repeats amplified with primers 2A and 2B from Schistosomatium douthitti were also cloned, and the nucleotide sequences of 12 independent clones were 91% identical to the
Sma repeats. Comparison of these sequences with those of S.
mansoni showed a number of differences which were localized
in the region where primer 1B should bind, thereby explaining
why this primer in conjunction with primer 1A did not produce
the corresponding band. This new sequence, however, was
then used to design a new primer, 1C, which allowed amplification of the a satellite DNA from Schistosomatium douthitti
without predetermination of the hammerhead sequence by the
primers. Sequencing of the 340-bp amplification product revealed a novel hammerhead motif shown in Fig. 6B. Instead of
the ubiquitous GUC’ triplet 59 to the cleavage site, Sda repeats possess an AUC’ triplet. Also, nucleotide substitutions
that potentially disrupt the core of the hammerhead ribozyme
were found in two of six sequenced clones. The rate of selfcleavage for the active Sda transcripts was 0.02 min21, around
10 times lower than the rate calculated for the self-cleaving
transcripts from S. mansoni.
compared to that from the newt. Comparison of the secondary
structure models for both domains shows that stem III in
schistosomes could be more stable, because it contains 3 bp
compared with 2 in the newt. Also, the two organisms, newts
and schistosomes, are unrelated in terms of their phylogenetic
position. We conclude that the hammerhead-containing satellite DNAs in these two species are not evolutionarily related.
However, if ribozyme domains are present in many more repetitive sequences than is currently known, then the occurrence of the hammerhead domain in repetitive DNA may not
be completely coincidental.
To date, all naturally occurring hammerheads have been
found to cleave a GUC’ site, with two exemptions: GUA’ in
the lucerne transient streak virus (15) and AUA’ in the satellite RNA from barley yellow dwarf virus (27). Thus, the
AUC’ site found in Schistosomatium douthitti is unique and its
presence contrasts with data from previous reports indicating
that this site was not suitable for cleavage in the I/III trans
format (32). Surprisingly, AUC’ does seem to be a good
cleavage site in the I/II trans format (34), which could be the
format for the S. mansoni hammerhead (see below).
Functional implications of trans-acting self-cleaving transcripts. The apparent lack of function for repeated sequences
has given rise to the selfish DNA hypothesis to rationalize their
existence and propagation. According to this model, repeated
sequences are not useful to the host but are maintained because they have discovered sequence-specific replication and
amplification strategies. Elimination of these sequences would
thus require improbable multiple deletion events (11, 30). On
DISCUSSION
Comparison of hammerhead domains from repetitive
DNAs. The occurrence of the hammerhead domain in the Sma
family of repeated sequences of S. mansoni superficially resembles the case of a hammerhead domain in the Sat2 repeats
from the newt (17). Both contain adjacent GC base pairs and
a loop in helix 1, which are required for activity in the newt (14,
31). In addition, other characteristics of the newt hammerhead
are found in that of the schistosome, such as the spacing
between the internal loop in helix I and the cleavage site as
well as the identity of several nucleotides in the external loop
and the distal portion of helix II (43). Nevertheless, the two
occurrences of the hammerhead domain are likely unrelated
based on the facts that (i) there is little overall sequence similarity between the satellite DNAs from the two species, (ii)
repeats in the newt are transcribed by RNA polymerase II with
small nuclear RNA promoter elements (9) while in schistosomes polymerase III promoter elements seems to be implicated, and (iii) kinetic analysis of the hammerhead domain
from schistosomes demonstrates its greater catalytic activity
FIG. 6. Summary of sequences corresponding to the hammerhead domains
found in S. haematobium (A) and Schistosomatium douthitti (B). Substitutions
found in different isolates are denoted by arrows directed out of the structure;
insertions are indicated by arrows directed toward the structure. CS, cleavage
site.
VOL. 18, 1998
FIG. 7. A model for the propagation and function of the a satellite DNA in
schistosomes. Tandem repeats or monomeric a sequences are transcribed by
RNA polymerase III. The long transcripts are processed by two mechanisms: (i)
intrarepeat cleavage and (ii) interrepeat cleavage. The products of self-cleavage
reactions then act in trans on other multimeric transcripts of the a family or in
transcripts such as the one coding for the synaptobrevin-like protein gene or the
OZ.A retroposon. Reintegration in the genome of reverse transcripts from
cleaved repeats creates dead ends in the transposition process because these
sequences possess the polymerase III promoter at their 39 end. However, reintegration of nonprocessed multimeric transcripts creates new sites from which
further transcription of Sma repetitive elements can occur.
the other hand, some repeated sequences contain motifs for
transcriptional regulation (20, 33) and some regions of human
Alu repeats are immutable, suggesting a role for these repeats
in the evolution of primates (6). Copies of repetitive DNA, like
the Alu family, are thought to arise via an endonuclease-dependent integration of reverse transcripts into genomic DNA
(4). In some repeats of S. mansoni and most repeats of S.
haematobium, the presence of three adenines after the cleavage site also suggests a retrotranscription origin, since these
adenines could be derived from the polyadenylation of the
cleaved transcript. We have formulated a model for Sma dispersion in schistosomes (Fig. 7). Transcription of tandem repeats would yield long multimeric transcripts which self-process. Reverse transcription of the processed transcripts permits
dispersion of the unit to other sites in the genome. However,
incorporation of the processed transcripts at isolated sites is a
dead end for expansion, because polymerase III promoter elements are located at the 39 end of the processed transcripts.
There would be no such barrier to propagation of multimeric
transcripts. This scenario provides schistosomes with a method
of limiting the copy number of repetitive DNA. In the newt, a
similar function is suggested by the fact that monomeric transcripts are found predominantly in the ovaries while transcripts
in somatic tissues are mostly dimers and larger multimers (14).
In this case, cycles of self-amplification would be limited in the
germ line. Interestingly, when the Sma repeats were first
cloned, Spotila et al. noticed that some members of the family
lost the tRNA homology region as predicted in our model (38).
They suggested that transcripts from the repeats underwent a
processing reaction before reinsertion into the genome.
SCHISTOSOME HAMMERHEAD RIBOZYME
3887
As for the function of the schistosome repeats, we have
proposed that hammerhead-containing transcripts could act in
trans to cleave other RNAs. This possibility is supported by the
fact that a synaptobrevin-like protein mRNA has the required
elements of a substrate in either the I/II or the I/III configuration (Fig. 5A). In fact, this target sequence, which is 97%
identical to Sma repeats, might have originated from retrotransposition of a Sma fragment. It is of note that several
human genes (5% of cDNAs in the GenBank) also contain a
segment of an Alu sequence, in their 59 or 39 noncoding regions
or their coding region (26, 42). A role in RNA processing in
newts has also been advanced because the hammerhead-containing transcripts were found in 12S riboprotein particles (25).
Sex chromosome-specific, Sma-related sequences have been
isolated in schistosomes by representational difference analysis
(12). One of the isolated clones (OZ.A) codes for a femalespecific retroposon (accession no. SMU12442). This retroposon is 76% identical to members of the Sma family and therefore could be considered another target of the trans reaction.
We have found that the OZ.A retroposon also has sequence
similarity with the microcopia element dhMiF2 of Drosophila
hydei. An interesting parallel between the Drosophila microcopia retrotransposon and the Sma family is that both are enriched in the heterogametic sexual chromosome (the male
chromosome in the fruit fly). microcopia encodes a testis-specific antisense RNA complementary to the sequence of its own
reverse transcriptase gene (24). This antisense RNA could be
involved in controlling the germ line expression of transposonencoded proteins much as the trans-acting ribozymes in schistosomes could control propagation of repetitive sequences and
transposable elements.
The phylogenesis of self-cleaving repeats in schistosomes.
The distribution of hammerhead-containing repeats in members of the Schistosomatidae is limited and does not resemble
the distribution produced via a common ancestor. Horizontal
transmission between organisms in the same host, however,
may be possible. In the laboratory, cross-mating can readily be
accomplished between S. haematobium and S. mansoni when
they share a hamster host (22). These two species also coparasitize their human hosts in Africa. In a locality of Bahia, Brazil,
47% of wild rodents are infected with S. mansoni (36), a favorable situation for interspecies crosses between S. mansoni
and rodent schistosomes like Schistosomatium douthitti.
Concluding remarks. The function of genes is usually predicted by first translating open reading frames in the DNA and
then using the predicted protein sequence to find homologs in
the protein database. This paradigm dominates the field of
functional genomics emerging from genome sequencing efforts. One of the shortcomings of this strategy is that the
functionality of RNA sequences is completely ignored. The
fact that RNAs likely anteceded proteins in biological evolution (16) suggests that searching databases for RNA domains
could provide novel insights into the biology of organisms. The
unexpected finding of an active hammerhead domain in schistosome repetitive DNA reported here testifies to the potential
of the genomic study of RNA, that is, ribonomics. Perhaps
when a more detailed knowledge of functional RNA motifs
and domains has been achieved, a wide variety of functions
may be found encoded in what previously had been considered
junk DNA.
ACKNOWLEDGMENTS
We thank Véronique Bourdeau, who made the RNAMOT searches,
and the members of the sequencing unit of the Organelle Megasequencing Program (OGMP), especially Y. Zhu; Gary O’Neal of
Merck Sharpe for providing DNA from S. mansoni; and Scott Snyder
3888
FERBEYRE ET AL.
for providing specimens of Schistosomatium douthitti and H. americana.
R. Cedergren is Richard Ivey Fellow of the Canadian Institute of
Advanced Research. This work was supported by a grant from the
Medical Research Council of Canada.
REFERENCES
1. Balmain, A., R. Krumlauf, J. K. Vass, and G. D. Birnie. 1982. Cloning and
characterization of the abundant cytoplasmic 7S RNA from mouse cells.
Nucleic Acids Res. 10:4259–4277.
2. Barker, S. C., and D. Blair. 1996. Molecular phylogeny of Schistosoma
species supports traditional groupings within the genus. J. Parasitol. 82:292–
298.
3. Benslimane, A. A., M. Dron, C. Hartmann, and A. A. Rode. 1986. Small
tandemly repeated DNA sequences of higher plants likely originate from a
tRNA gene ancestor. Nucleic Acids Res. 14:8111–8119.
4. Boeke, J. D. 1997. LINEs and Alus—the poly A connection. Nat. Genet.
16:6–7.
5. Bratty, J., P. Chartrand, G. Ferbeyre, and R. Cedergren. 1993. The hammerhead RNA domain, a model ribozyme. Biochim. Biophys. Acta 1216:
345–359.
6. Britten, R. J. 1994. Evolutionary selection against change in many Alu repeat
sequences interspersed through primate genomes. Proc. Natl. Acad. Sci.
USA 91:5992–5996.
7. Bruening, G. 1989. Compilation of self-cleaving sequences from plant virus
satellite RNAs and other sources. Methods Enzymol. 180:546–558.
8. Clouet-d’Orval, B., and O. C. Uhlenbeck. 1996. Kinetic characterization of
two I/II format hammerhead ribozymes. RNA 2:483–491.
9. Coats, S. R., Y. Zhang, and L. M. Epstein. 1994. Transcription of satellite 2
DNA from the newt is driven by a snRNA type of promoter. Nucleic Acids
Res. 22:4697–4704.
10. Daniels, G. R., and P. L. Deininger. 1985. Repeat sequence families derived
from mammalian tRNA genes. Nature 317:819–822.
11. Doolittle, W. F., and C. Sapienza. 1980. Selfish genes, the phenotype paradigm and genome evolution. Nature 284:601–603.
12. Drew, A. C., and P. J. Brindley. 1995. Female-specific sequences isolated
from Schistosoma mansoni by representational difference analysis. Mol. Biochem. Parasitol. 71:173–181.
13. Epstein, L., and J. G. Gall. 1987. Self-cleaving transcripts of satellite DNA
from the newt. Cell 48:535–543.
14. Epstein, L. M., K. A. Mahon, and J. G. Gall. 1986. Transcription of a satellite
DNA in the newt. J. Cell Biol. 103:1137–1144.
15. Foster, A. C., and R. H. Symons. 1987. Self-cleavage of plus and minus RNAs
of a virusoid and a structural model for the active sites. Cell 49:211–220.
16. Gilbert, W. 1986. The RNA world. Nature 319:618.
17. Green, B., L. M. Pabon-Peña, T. A. Graham, S. E. Peach, S. R. Coats, and
L. M. Epstein. 1993. Conserved sequence and functional domains in satellite
2 from three families of salamanders. Mol. Biol. Evol. 10:732–750.
18. Heidenreich, O., and F. Eckstein. 1992. Hammerhead ribozyme-mediated
cleavage of the long terminal repeat RNA of human immunodeficiency virus
type 1. J. Biol. Chem. 267:1904–1909.
19. Hertel, K. J., A. Pardi, O. C. Uhlenbeck, M. Koizumi, E. Ohtsuka, S. Uesugi,
R. Cedergren, F. Eckstein, W. L. Gerlach, R. Hodgson, and R. H. Symons.
1992. Numbering system for the hammerhead. Nucleic Acids Res. 20:3252.
20. Hewitt, S. M., G. C. Fraizer, and G. F. Saunders. 1995. Transcriptional
silencer of the Wilms’ tumor gene WT1 contains an Alu repeat. J. Biol.
Chem. 270:17908–17912.
21. Jagadeeswaran, P., B. G. Forget, and S. M. Weissman. 1981. Short interspersed repetitive DNA elements in eukaryotes: transposable DNA elements
generated by reverse transcription of RNA pol III transcripts? Cell 26:141–
142.
MOL. CELL. BIOL.
22. Khalil, S. B., and N. S. Mansour. 1995. Worm development in hamsters
infected with unisex and cross-mated Schistosoma mansoni and Schistosoma
haematobium. J. Parasitol. 81:8–11.
23. Laferrière, A., D. Gautheret, and R. Cedergren. 1994. An RNA pattern
matching program with enhanced performance and portability. Comput.
Appl. Biosci. 10:211–212.
24. Lankenau, S., V. G. Corces, and D. H. Lankenau. 1994. The Drosophila
micropia retrotransposon encodes a testis-specific antisense RNA complementary to reverse transcriptase. Mol. Cell. Biol. 14:1764–1775.
25. Luzi, E., F. Eckstein, and G. Barsacchi. 1997. The newt ribozyme is part of
a riboprotein complex. Proc. Natl. Acad. Sci. USA 94:9711–9716.
26. Makalowski, W., G. A. Mitchell, and M. Labuda. 1994. Alu sequences in the
coding region of mRNA: a source of protein variability. Trends Genet.
10:188–193.
27. Miller, W. A., T. Hercus, P. M. Waterhouse, and W. L. Gerlach. 1991. A
satellite RNA of barley yellow dwarf virus contains a novel hammerhead
structure in the self-cleavage domain. Virology 183:711–720.
28. Milligan, J. F., D. R. Groebe, G. W. Witherell, and O. C. Uhlenbeck. 1987.
Oligoribonucleotide synthesis using T7 RNA polymerase and DNA templates. Nucleic Acids Res. 15:8783–8798.
29. Mkoji, G. M., J. M. Smith, and R. K. Prichard. 1988. Antioxidant systems in
Schistosoma mansoni: correlation between susceptibility to oxidant killing
and the levels of scavengers of hydrogen peroxide and oxygen free radicals.
Int. J. Parasitol. 18:661–668.
30. Orgel, L. E., and F. H. C. Crick. 1980. Selfish DNA: the ultimate parasite.
Nature 284:604–607.
31. Pabon-Peña, L. M., Y. Zhang, and L. M. Epstein. 1991. Newt satellite 2
transcripts self-cleave by using an extended hammerhead structure. Mol.
Cell. Biol. 11:6109–6115.
32. Perriman, R., A. Delves, and W. L. Gerlach. 1992. Extended target-site
specificity for a hammerhead ribozyme. Gene 113:157–163.
33. Piedrafita, F. J., R. B. Molander, G. Vansant, E. A. Orlova, M. Pfahl, and
W. F. Reynolds. 1996. An Alu element in the myeloperoxidase promoter
contains a composite SP1-thyroid hormone-retinoic acid response element.
J. Biol. Chem. 271:14412–14420.
34. Ruffner, D. E., G. D. Stormo, and O. C. Uhlenbeck. 1990. Sequence requirements of the hammerhead RNA self-cleavage reaction. Biochemistry 29:
10695–10702.
35. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a
laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, N.Y.
36. Silva, T. M., and Z. A. Andrade. 1989. Natural infection of wild rodents by
Schistosoma mansoni. Mem. Inst. Oswaldo Cruz 84:227–235.
37. Singer, M. F. 1982. SINEs and LINEs: highly repeated short and long
interspersed sequences in mammalian genomes. Cell 28:433–434.
38. Spotila, L. D., H. Hirai, D. M. Rekosh, and P. LoVerde. 1989. A retroposonlike short repetitive DNA element of the human blood fluke, Schistosoma
mansoni. Chromosome 97:421–428.
39. Uhlenbeck, O. C. 1987. A small catalytic oligoribonucleotide. Nature 328:
596–600.
40. Van Arsdell, S. W., R. A. Denison, L. B. Bernstein, A. M. Weiner, T. Manser,
and R. F. Gesteland. 1981. Direct repeats flank three small nuclear RNA
pseudogenes in the human genome. Cell 26:11–17.
41. Weiner, A. M. 1980. An abundant cytoplasmic 7S RNA is complementary to
the dominant interspersed middle repetitive DNA sequence family in the
human genome. Cell 22:209–218.
42. Yulug, I. G., A. Yulug, and E. M. Fisher. 1995. The frequency and position
of Alu repeats in cDNAs, as determined by database searching. Genomics
27:544–548.
43. Zhang, Y., and L. M. Epstein. 1996. Cloning and characterization of extended hammerheads from a diverse set of caudate amphibians. Gene 172:
183–190.