Regulated Hydrogen Peroxide Production by Duox
in Human Airway Epithelial Cells
Radia Forteza, Matthias Salathe, Françoise Miot, Rosanna Forteza, and Gregory E. Conner
Department of Cell Biology and Anatomy, and Division of Pulmonary and Critical Care Medicine, Department of Medicine,
University of Miami School of Medicine, Miami, Florida; and IRIBHM, Faculté de Médecine, Université Libre de Bruxelles, Brussels, Belgium
Hydrogen peroxide (H2O2) is found in exhaled breath and is produced by airway epithelia. In addition, H2O2 is a necessary substrate
for the airway lactoperoxidase (LPO) anti-infection system. To investigate the source of H2O2 produced by airway epithelia, PCR was
used to screen nicotinamide adenine dinucleotide phosphate
(NADPH) oxidase expression in human airway epithelia redifferentiated at the air–liquid interface (ALI) and demonstrated the presence
of Duox1 and 2. Western blots of culture extracts indicated strong
expression of Duox, and immunohistochemistry of human tracheal
sections localized the protein to the apical portion of epithelial
cells. Apical H2O2 production was stimulated by 100 ␮M ATP or
1 ␮M thapsigargin, but not 100 ␮M ADP. Diphenyleneiodonium, an
NADPH oxidase inhibitor, and dimethylthiourea, a reactive oxygen
species scavenger, both inhibited this stimulation. ATP did not stimulate the basolateral H2O2 production by ALI cultures. ATP and
thapsigargin increased intracellular Ca2⫹ with kinetics similar to
increasing H2O2 production, and thus consistent with the expected
Ca2⫹ sensitivity of Duox. These data suggest that Duox is the major
NADPH oxidase expressed in airway epithelia and therefore a contributor of H2O2 production in the airway lumen. In addition, the
data suggest that extracellular H2O2 production may be regulated
by stimuli that raise intracellular Ca2⫹.
Keywords: Duox; hydrogen peroxide; calcium; purinergic
Hydrogen peroxide (H2O2) is present in exhaled breath condensate and airway secretions and is produced by airway epithelial
cells (1–4). We have shown that lactoperoxidase (LPO) is present
and active in airway secretions (5). This host defense enzyme
protects epithelial surfaces from colonization and infection by
using H2O2 to oxidize thiocyanate anions (SCN–) to hypothiocyanite, a strong antimicrobial agent (6). Thus, LPO requires H2O2
to make this antibacterial substance in airway secretions. The
enzymatic source for H2O2 production in human airway, however, remains unclear.
Phagocytes (neutrophils, eosinophils, monocytes, and macrophages) contain an equivalent host defense system (i.e., myeloperoxidase and eosinophil peroxidase) that uses H2O2 to oxidize
Cl– or SCN– to form HOCl and HOSCN, powerful anti-infection
agents (7). In phagocytes, the enzymatic generation of H2O2
is achieved by the reduced nicotinamide adenine dinucleotide
phosphate (NADPH) oxidase. This enzyme is a multicomponent
electron transport system anchored in the plasma membrane,
where the catalytic subunit, gp91phox, reduces the molecular
oxygen in an NADPH-dependent manner to form superoxide,
which dismutates to H2O2 (8, 9). Several homologs of the
gp91phox NADPH oxidase subunit of phagocytes have been
identified and form the Nox gene family (10). The Nox messenger
(Received in original form September 23, 2004 and in final form January 21, 2005)
Correspondence and requests for reprints should be addressed to Gregory E.
Conner, Ph.D., University of Miami School of Medicine, P.O. Box 016960 (R124),
Miami, FL 33101. E-mail: [email protected]
Am J Respir Cell Mol Biol Vol 32. pp 462–469, 2005
Originally Published in Press as DOI: 10.1165/rcmb.2004-0302OC on January 27, 2005
Internet address: www.atsjournals.org
RNAs are present in a variety of human tissues including kidney
(11), colon (12), vascular smooth muscle cells (13), osteoclast
(14), and thyroid (15), and their orthologs have been found in
rat and Caenorhabditis elegans (16). An evolutionary tree has
been constructed in which three subgroups have been proposed
to describe the Nox family members (17). One group comprises
Nox 1, Nox 2 (gp91phox), Nox 3, and Nox 4, all having in
common a similar molecular mass (ⵑ 65 kD). Another subgroup
consists of Dual oxidase 1 and 2 (Duox1, Duox2), the high
molecular weight homologs (ⵑ 180 kD) characterized by an
additional N-terminal peroxidase domain and two EF-hand
Ca2⫹-binding domains. Finally, Nox 5 is divergent from the other
members.
Although the predicted domain structure of Nox family members is well established, their functions in all tissues remain to
be elucidated. Different functions have been proposed in which
Nox proteins may participate in biological processes including
control of cell growth (18, 19), bone remodeling (14), control
of vascular tone (20), regulation of thyroid hormone biosynthesis
(21, 22), and acid secretion (23). Because airway LPO requires
H2O2 for activity, we investigated NADPH oxidase in human
airway epithelia that perhaps could provide a regulated substrate
source for LPO. Previous reports by us and others (16, 23–25)
have indicated the presence of Duox in the human respiratory
tract. Our data, described here and earlier in abstract form (25),
confirm that Duox 1 and 2 are the major NADPH oxidases
expressed in airway epithelia. The data described here also show
the production of extracellular H2O2 by airway epithelia that is
enhanced by stimuli that increase [Ca2⫹]i, consistent with the EF
hand domains present in Duox1 and 2.
MATERIALS AND METHODS
Source of Materials
TRIzol reagent, SuperScript First Strand Synthesis System for reverse
transcriptase–polymerase chain reaction (RT-PCR), and PCR reagent
System were purchased from Invitrogen Corp. (Carlsbad, CA). BCA
protein assay kit was purchased from Pierce (Rockford, IL); dithiothreitol (DTT) from Boehringer Mannheim Biochemicals (Indianapolis, IN);
7.5% Ready Gel Precast SDS-polyacrylamide gels and gelatin from
Bio-Rad (Hercules, CA); polyvinylidene fluoride (PVDF) Immobilon-P
transfer membrane from Millipore (Billerica, MA). Horseradish peroxidase (HRP)-conjugated Streptavidin, alkaline phosphatase–coupled
goat anti-rabbit IgG, rabbit nonimmune serum, and the affinity-purified
biotin labeled goat anti-rabbit IgG were purchased from KPL (Gaithersburg, MD). Normal goat serum was purchased from Chemicon
(Tamecula, CA); Endogenous Biotin Blocking kit, 10-acetyl-3, 7 dihydroxyphenoxazine (Amplex Red), pluronic acid F-127, and fura-2
AM from Molecular Probes (Eugene, OR); and thapsigargin from
Calbiochem (San Diego, CA). All other materials were purchased from
Sigma Chemical Co. (St.Louis, MO).
Cell Culture
Human airways were obtained from organ donors whose lungs were
not to be used for transplant from the Life Alliance Organ Recovery
Agency of the University of Miami. All tissues were obtained after
appropriate consent and according to local IRB-approved protocols.
Forteza, Salathe, Miot, et al.: Regulated Hydrogen Peroxide Production in the Airway
Airway epithelial cells were isolated, grown, and redifferentiated at the
air–liquid interface (ALI) on 24- or 6.5-mm Transwell-clear culture
inserts from Corning Costar Corporation (Cambridge, MA) and coated
with human placenta collagen Type IV as previously described (26, 27).
Fischer rat thyroid epithelial cells (FRTL-5) were a generous gift from
Dr. Robert B. Levy (Department of Microbiology and Immunology,
University of Miami School of Medicine). These cells were maintained
as previously described (28). The cells were trypsinized after 5–7 d of
culture and used for Western blot analyses.
463
for 1 h with an alkaline phosphatase–coupled goat anti-rabbit IgG. The
immune complex was detected using 0.16 mg/ml 5-bromo-4-chloro3-indoyl phosphate (BCIP) plus 0.32 mg/ml nitroblue tetrazolium (NBT)
in 100 mM Tris pH 9.5, 100 mM NaCl, and 5 mM MgCl2.
Immunohistochemistry
RT-PCR
RNA was extracted from ALI epithelial cells using TRIzol reagent.
RNA (2 ␮g) was reverse transcribed using the SuperScript First Strand
Synthesis System for RT-PCR. The final reaction mixture (0.025 ␮g/␮l
oligodT, 0.5 mM dNTPs, 1⫻ RT buffer, 5 mM MgCl2, 0.01 M DTT,
and RNase inhibitor) was incubated with SuperScript II reverse transcriptase (2.5 U/␮l) for 50 min at 42 ⬚C. The reaction was terminated
at 37 ⬚C for 20 min with RNase H. To control for genomic DNA contamination, additional RNA samples were processed without reverse transcriptase. First-strand cDNAs were amplified by PCR using Taq
polymerase (2.5 U/␮l) and the oligonucleotide primers described in
Table 1. Annealing temperatures were: primer sets 1 and 5 (Table 1),
55 ⬚C; set 2, 48 ⬚C; and set 3, 51 ⬚C. Amplification with primer sets 1–3
and set 5 were 30 cycles of 45 s denaturation at 94 ⬚C, 45 s annealing,
and 1 min extension at 72 ⬚C, followed by a final extended elongation
of 8 min at 72 ⬚C. The amplification using set 4 primers was performed
for 27 cycles of 15 s at 94 ⬚C, 30 s at 60 ⬚C, and 4 min at 68 ⬚C; followed
by an extended elongation of 10 min at 68 ⬚C using a thermal cycler
(Brinkmann Instruments Inc., Westbury, NY).
Normal human tracheal rings were fixed with 4% paraformaldehyde
and prepared for embedding in paraffin in a microwave Tissue Processor
(Microwave Materials Technologies Inc., Knoxville, TN) according to
the manufacturer’s protocol using a nonxylene method. Embedding and
sectioning were performed by the Histology Laboratory at University of
Miami Hospital and Clinic-Sylvester Comprehensive Cancer Center.
The sections were deparaffinized, rehydrated, and quenched for
endogenous peroxidase activity with 3% H2O2 in methanol for 45 min at
room temperature. Phosphate-buffered saline (PBS) containing 0.05%
Tween-20 (PBS-T) was used for washes. Sections were treated for
antigen retrieval using 10 mM citrate buffer (pH 6.0) for 15 min at
80 ⬚C and blocked with 5% normal goat serum diluted in PBS-T for
1 h at room temperature. Biotin background binding was reduced using
the Endogenous Biotin Blocking kit according to manufacturer’s instructions. Sections were incubated overnight at 4 ⬚C with either antiDuox1/ThOx1 antibody (1:200 dilution) or a rabbit nonimmune serum
as a negative control, both prepared in 1% normal goat serum/PBS-T.
Sections were then incubated for 45 min with an affinity-purified biotinlabeled goat anti-rabbit IgG (2.5 ␮g/ml), followed by an incubation for
30 min with HRP-conjugated streptavidin in 1% normal goat serum/
PBS-T (0.3 ␮g/ml). Immunoreactivity was visualized using the AEC
Chromogen kit (2.5 M acetate buffer, pH 5.0, 3-amino-9-ethylcarbazole
[AEC] in N,N-dimethylformamide and 3% H2O2) according to the
manufacturer’s instruction.
Western Blotting
Protein extracts from ALI cultures, FRTL-5 cells, and CHO cells were
obtained by lysis at 100 ⬚C in 1% SDS, 10 mM Tris pH 8.5, 0.1 M
EDTA, followed by sonication, and centrifugation at 14,000 ⫻ g. Total
protein was determined using the BCA protein assay. For each cell
type, 20 ␮g of protein extract were solubilized with 100 mM Tris pH
6.8, 4% SDS, 20% glycerol, and 200 mM DTT, separated by a 7.5%
SDS/polyacrylamide gel electrophoresis (SDS-PAGE) and transferred
electrophoretically to polyvinylidene fluoride (PVDF) membranes. The
membranes were then blocked at room temperature for 2 h with 1%
gelatin prepared in 20 mM Tris Cl, pH 7.5, 140 mM NaCl (TBS), and
containing 0.05% Tween-20 (TTBS). The membranes were incubated
overnight at 4 ⬚C with either a rabbit nonimmune serum prepared in
1% gelatin or a rabbit polyclonal antibody raised against the Arg618His1044 intracellular fragment of human Duox1/ThOx1 (15, 29) that
recognizes both Duox1 and 2. The membranes were then incubated
H2O2 Measurements
H2O2 was measured by two different approaches. First, ALI epithelial
cells were incubated with 500 ␮l Dulbecco’s PBS in the apical chamber
and culture media either alone or with 1 ␮M thapsigargin, 1 ␮M diphenyleneiodonium (DPI), or 1 ␮M of both thapsigargin and DPI in the
basolateral chamber. After 60 min of incubation at 37 ⬚C, samples were
collected from the apical chamber. Triplicates of each sample were
loaded in a 96-well microplate and mixed with 50 ␮M of 10-acetyl-3,7
dihydroxyphenoxazine (Amplex Red) combined with 0.1 U/ml of HRP
(30). For each experiment, the amount of apical H2O2 production was
determined using a H2O2 standard curve from 0–2 ␮M. The fluorescence
was read at Ex 530 nm/Em 590nm (9 nm bandwidth) using a SpectraMax
Gemini EM fluorometer (Molecular Devices, Sunnyvale, CA).
Alternatively, triplicates of ALI epithelial cells in 6.5-mm Transwellclear culture inserts were directly placed onto the SpectraMax Gemini
TABLE 1. OLIGONUCLEOTIDE PRIMERS
Primer Sequence
Set 1
F: cayccyttyacwytgacmtcygc
R: aarggkgtgaccccaakbcc
Set 2
F: tggatttywggmcctktg,
R: aakggagtkactccratscc
Set 3
F: ttctattggactcacttgtcc
R: cagaatggaagcaaagggggt
F: ggagacaagttgcagtcccgggctct
R: cataggtattgggccagggtctgat
F: ctctctggagtggtggcctatt
R: ggacctgcagacacctgtct
Set 4
Set 5
Gene
Accession No.
bp Position
Gp 91phox
NM_000397
1026…1048
1242…1261
Mox1
ThOx1/Duox1
ThOx2/ Duox2
Nox 3
NM_007052
NM_017434
AF 267981
NM_015718
Nox 4
Nox 5
AF 254621
AF 317889
Duox1
NM_017434
Duox2
AF 267981
911…929
1325…1344
664…684
1252…1272
61…86
5605…5581
2046…2067
2207….2226
Two sets of degenerate oligonucleotides (sets 1 and 2) and three sets of gene specific primers (sets 3, 4, and 5) were designed
to target different human NADPH oxidase homologues. Set 1 was complementary to gp91phox (Nox2), Nox1/Mox1, and Duox/
ThOx 1 and 2. Set 2 primers were complementary to Nox 3 and 4; and set 3 to Nox5. Set 4 primers were complementary to
sequences within the 5⬘UTR and 3⬘UTR of the human Duox1 forward and reverse sequences. Set 5 primers were complementary
to Duox2 in a region of low similarity compared with Duox1. The bp positions of forward (F) and reverse (R) primers within the
corresponding sequences are shown.
464
AMERICAN JOURNAL OF RESPIRATORY CELL AND MOLECULAR BIOLOGY VOL 32 2005
EM fluorometer (Molecular Devices). Instead of collecting samples,
the reaction mixture containing Amplex Red (50 ␮M) and HRP
(0.1 U/ml) in Dulbecco’s PBS was applied to the apical surface of the
ALI cultures, and 500 ␮l of Hanks’ Balanced Salt Solution (HBSS)
was added to the basolateral chamber. ALI cultures subjected to DPI
inhibition were preincubated for 30 min at 37 ⬚C with 20 ␮M DPI. Apical
fluorescence measurements (Ex 530 nm/Em 590 nm) were performed at
37 ⬚C every 20 s for 5 min to establish a baseline. ALI cultures were
then removed from the fluorometer and treated at the apical surface
with PBS alone or PBS containing: 100 ␮M ATP, 100 ␮M ATP plus
either 20 ␮M DPI or 40 mM dimethylthiourea (DMTU), 100 ␮M ADP,
or 1 ␮M thapsigargin. The fluorescence was read at 20-s intervals for
an additional 30 min at 37 ⬚C. Fluorescence was normalized to the last
recorded baseline value and plotted as Fx/F0 (NRFU). For basolateral
H2O2 production by ALI cultures, 50 ␮l of reaction mixture (sufficient
to fill the space between the membrane and the culture dish) containing
Amplex Red (50 ␮M) with HRP (0.1 U/mL) in HBSS supplemented
with Hepes (pH 7.4) was applied to the basolateral compartment and,
to the apical surface, 100 ␮M ATP in PBS or PBS alone was added.
Moreover, in combination with Amplex red/HRP solution in the basolateral compartment, we added either 100 ␮M ATP, 1 ␮M thapsigargin
or PBS. The basolateral fluorescence measurement was performed as
described above except the SpectraMax plate reader was set to bottom
read.
[Ca2ⴙ]i Measurements
Culture inserts (6.5 mm) of ALI epithelial cells were incubated with
the calcium indicator fura-2 AM (5 ␮M) supplemented with 0.1% pluronic acid (vol/vol) in the basolateral and apical chambers for 30 min at
37 ⬚C followed by 30 min at room temperature. The filters were then
washed three times with HBSS supplemented with 10 mM Hepes
(pH 7.4) in the basolateral and Dulbecco’s PBS in the apical compartments over a period of 30 min, after which filters were loaded onto the
SpectraMax Gemini EM fluorometer. Fura-2 fluorescence was recorded
at 510 nm using sequential excitation at 340 and 380 nm. Measurements
were repeated at 30-s intervals for the duration of the experiment.
After the baseline was established (5 min), cultures were stimulated
with 100 ␮M ATP or 1 ␮M thapsigargin, and readings continued every
30 s for another 30 min. Background fluorescence, determined in parallel cultures not incubated with fura-2, was subtracted from measured
values before calculating ratios.
Statistical Analysis
Data from the H2O2 production measurements were expressed as
mean ⫾ SE. The statistical significance of differences between means
was determined by ANOVA followed by the Tukey-Kramer honestly
significantly difference test using JMP software from SAS (Cary, NC).
P values ⬍ 0.05 were considered significant.
RESULTS
Duox mRNA in Human Airway Epithelial Cells
We previously demonstrated that LPO is a functional airway
host defense system using an in vivo sheep model (31) and that
LPO in human airway secretions actively kills bacteria in vitro
(5). LPO requires H2O2 as a substrate and our preliminary investigations showed that Duox homologs of the phagocytic NADPH
oxidase were expressed in human airway epithelial cells (25).
To confirm these data and the recent results of others (23, 24),
oligonucleotides were designed to be complementary to: (1 )
gp91phox, Nox1, and Duox/ThOx 1 and 2; (2 ) Nox 3 and 4; and
(3 ) Nox 5 based on available published sequences (Table 1).
Set 1 and 2 primers were degenerate. RT-PCR with set 1 primers
yielded a cDNA fragment of 248 bp as described in a previous
abstract (25), whereas the other oligonucleotide primers only
gave faint, nonspecific PCR products (Figure 1). When sequenced
and aligned, the 248-bp fragment was identical with human
Duox1, a large molecular weight NADPH oxidase homolog.
Sequence analysis of six different cDNAs that were weakly amplified by the Nox 3 and 4 and the Nox 5 primer sets showed
Figure 1. RT-PCR of NADPH oxidase homolog expression. RT-PCR of
mRNA of human ALI epithelial cells was performed using oligonucleotide
primers described in Table 1: primer set 1 (lanes 1 and 2 ), set 2 (lanes
3 and 4 ), and set 3 (lanes 5 and 6 ). RT-PCR using hGAPDH primers
gave a 250-bp band and served as a positive control (lanes 7 and 8 ).
Reactions without reverse transcriptase (lanes 2, 4, 6, and 8 ) served as
controls for DNA contamination. This broad screen of NADPH oxidase
expression generated a 248-bp cDNA fragment with set 1 primers, whereas
two other primer sets yielded nonspecific products that were unrelated
by sequence to the Nox gene family. The 248-bp RT-PCR product was
dependent on the presence of reverse transcriptase (lane 2).
that none was related to other NADPH oxidases. To further
confirm these results, gene-specific primers chosen within the
5⬘UTR and 3⬘UTR of human Duox1 (Genbank accession No.
NM_017434) were used for RT-PCR. This procedure generated
a single 5.5-kb cDNA sequence (Figure 2a), and its sequence
analysis showed that it was identical with human Duox1, previously identified in human thyroid cells under the name of
ThOx1 (15). Since Schwarzer and colleagues (23) have recently
shown that both Duox1 and 2 were present in airway epithelia,
we also designed specific primers for Duox2 and detected this
mRNA by RT-PCR as well (Figure 2b).
Duox Protein Expression in Airways
To investigate whether Duox protein is expressed in human
airway epithelial cells, fully redifferentiated ALI cultures were
solubilized in SDS and Western blot analysis was performed
using a rabbit polyclonal antibody raised against the intracellular
domain of Duox1, although this antibody recognizes both Duox1
and 2 and cannot differentiate between the two. An immune
complex was detected with an apparent molecular weight of
185 kD (Figure 3a). This was consistent with previous analyses
of thyroid tissue in which Duox proteins appeared between 164
and 190 kD, depending on the degree of glycosylation (15, 32).
No labeling was detected with a rabbit nonimmune serum (Figure 3b). FRTL-5 cells, previously used to detect Duox proteins
(15, 33), served as a positive control, but showed a weaker signal
for Duox consistent with reduced crossreactivity of the antibody
to rat Duox. Chinese hamster ovary (CHO) cells were used
as a negative control because none of the Duox proteins are
expressed in them (29); no significant labeling was detected.
These data suggest that Duox1 and/or 2 were major NADPH
oxidase homologs expressed at the mRNA and protein level in
human airway epithelial cells.
Forteza, Salathe, Miot, et al.: Regulated Hydrogen Peroxide Production in the Airway
465
Figure 2. RT-PCR of human Duox mRNA. Two sets of gene specific
primers (Table 1) designed to complement human Dual oxidase 1
(a ) and human Dual oxidase 2 (b ) were used to perform
RT-PCR with total mRNA of ALI epithelial cells. (a ) A cDNA
sequence of 5.5 kb corresponding to Duox1 was detected (lane
1), while no band was amplified in the absence of RT (lane 2).
(b ) A 181-bp cDNA fragment was identical with Duox2 (lane 1),
which was not detected in absence of reverse transcriptase (lane
2). In both panels, hGAPDH was also amplified in the presence
(lane 3, 250 bp), but not in the absence (lane 4), of RT.
Cellular Localization of Duox Protein in Human Airway Tissues
To localize Duox protein expression, we examined tissue sections
of human trachea by immunohistochemistry with the rabbit polyclonal anti-Duox antibody used for Western blot analysis. Positive labeling by the anti-Duox antibody was seen in the airway
epithelium (Figure 4a). The majority of the staining was observed
both in the apical plasma membrane and in the apical portion
of epithelial cells, the greater labeling being present in the latter.
No labeling was obtained when the tracheal tissues were incubated with a rabbit nonimmune serum (Figure 4b).
H2O2 Production at the Apical Surface of Airway
Epithelial Cells
The catalytic subunit of the phagocytic NADPH oxidase generates superoxide that rapidly dismutates to H2O2 (9). To test if
the Duox 1 and 2 being expressed in epithelial cells were the
source of the H2O2 generated by these cells, we investigated the
function of Duox protein in human ALI epithelial cells using a
quantitative fluorometric micro-assay based on HRP-catalyzed
H2O2 oxidation of Amplex Red (30). The assays examined the
release of H2O2 into the apical extracellular compartment during
a 1-h period by sampling PBS applied to the surface of the
culture.
Because previous studies on porcine and human thyroid
plasma membrane preparations demonstrated the existence of
Figure 3. Western blot analysis of Duox protein expression. Twenty
micrograms of each extract from human ALI cultures, and FRTL-5 and
CHO cells were separated by 7.5% SDS-PAGE. Immunoblot analyses
were performed using a rabbit polyclonal antibody raised against the
Arg618-His1044 fragment of Duox1 (a ) or a rabbit nonimmune serum
(b ). (a ) A single band of protein was detected in ALI epithelial cells
(lane 1) with an apparent molecular weight of 185 kD corresponding
to Duox1 and 2; only a fainter expression was seen in FRTL-5 cells (lane
2), and no expression was observed in CHO cell line (lane 3). (b ) No
labeling was detected using the rabbit nonimmune serum to blot the
membrane.
a Ca2⫹-dependent NADPH oxidase activity (34–37) and the predicted molecular structure of Duox1 and 2 showed two EF-hand
motifs forming the calcium-binding domain (38), we assessed
basal and Ca2⫹-stimulated H2O2 production in airway epithelia.
ALI cultures were stimulated for 1 h with thapsigargin (1 ␮M)
that has previously been shown to increase [Ca2⫹]i in our cultured airway epithelial cells (39). After thapsigargin treatment,
the apical H2O2 increased from a baseline value of 14.0 ⫾
3.75 pmoles/h/cm2 to 30.4 ⫾ 4.10 pmoles/h/cm2 (mean ⫾ SE,
n ⫽ 18, P ⬍ 0.05) (Figure 5). To confirm that this H2O2 production
was due to an NADPH oxidase–like activity, ALI cultures were
treated with thapsigargin in the presence of 1 ␮M of diphenyleneiodonium (DPI), an NADPH oxidase inhibitor. DPI treatment
blocked the thapsigargin-induced increase in apical H2O2 production (14.1 ⫾ 4.27 pmoles/h/cm2, n ⫽ 10, P ⬍ 0.05 compared
with thapsigargin treatment). However, 1 ␮M DPI alone did not
significantly reduce the baseline H2O2 production of unstimulated cultures (10.6 ⫾ 4.48 pmoles/h/cm2, n ⫽ 13, P ⬎ 0.05
compared with untreated control), suggesting that thapsigarginstimulated H2O2 production was due to NADPH oxidase activity.
Cultures grown and differentiated under identical conditions
contained 2–4 ⫻ 106 cells/cm2.
Continuous Measurement of H2O2 Production by Human
Airway Epithelia
The previous measurements were of samples from apically applied PBS after 1 h incubation, and thus any increase in [H2O2]
Figure 4. Localization of Duox protein in human airway tissues by immunohistochemistry. Immunostaining of human tracheal sections was
performed using a rabbit polyclonal anti-Duox1 antibody (a ) or a rabbit
nonimmune serum (b ), followed by incubation with an affinity-purified
biotin-labeled goat anti-rabbit IgG. The immune complex was then
identified using HRP-conjugated Streptavidin followed by AEC chromogen: Duox protein was localized both in the apical plasma membrane
and in the apical cytoplasm of epithelial cells (a ); no staining was
detected using the rabbit nonimmune serum (b ). Arrows indicate the
apical side of the epithelium and arrowheads indicate the basement
membrane. Bar ⫽ 20 ␮m.
466
AMERICAN JOURNAL OF RESPIRATORY CELL AND MOLECULAR BIOLOGY VOL 32 2005
Figure 5. H2O2 production
activity at the surface of airway epithelial cells during a
1-h incubation. ALI epithelial
cells were incubated for 1 h at
37 ⬚C with PBS at the apical
surface and either PBS, 1 ␮M
thapsigargin (T), 1 ␮M DPI,
or 1 ␮M of both thapsigargin
and DPI (T/DPI) in the basolateral medium. After 1 h, samples were collected from the upper chamber and the amount of apical
H2O2 determined using a quantitative fluorometric microassay based
on HRP-catalyzed H2O2 oxidation of Amplex Red. H2O2 values were
obtained by interpolation of the standard curve and are expressed as
mean ⫾ SE, n ⫽ 10–18.
over PBS control could only be due to stimulated appearance
in the apical compartment. To further investigate the calciumregulated apical H2O2 production, H2O2 was measured continuously by loading Amplex Red and HRP directly to the surface
of ALI cultures maintained at 37 ⬚C, and fluorescence was measured at 20-s intervals.
Our previous studies have shown that apically applied extracellular ATP was able to cause a rapid, large, and transient
increase in [Ca2⫹]i in these human airway epithelial cells via
activation of P2Y receptors (40, 41). Therefore, we tested the
effect of ATP, alone or in combination with DPI, on apical
H2O2-dependent and HRP-mediated oxidation of Amplex Red.
Fluorescence was measured before stimulation to establish baseline H2O2 production, and post-stimulation values were normalized to the last recorded baseline value (NRFU) after addition
of either ATP alone or ATP with DPI, ADP, thapsigargin, or
PBS control to the apical surface (Figure 6). Within the first
200 s after addition of ATP, H2O2 production showed a rapid and
significant increase (0.0096 ⫾ 0.0036 NRFU/s, n ⫽ 39, compared
with the control of 0.0022 ⫾ 0.0009 NRFU/s, n ⫽ 39, P ⬍ 0.05).
Figure 6. Continuous measurement of Duox activity. A reaction mixture
of Amplex red (50 ␮M) and HRP (0.1 U/ml) was loaded on the apical
surface of ALI cultures, which were then placed directly into the fluorometer at 37 ⬚C. Measurements were performed at 20-s intervals for 5 min
to establish a baseline. Cultures were stimulated with 100 ␮M ATP (filled
squares), 100 ␮M ATP combined with 20 ␮M DPI (triangles), 100 ␮M
ADP (open squares), 1 ␮M thapsigargin (open circles), or PBS (filled
circles), and the fluorescence was read for an additional 30 min at 20-s
intervals and normalized to the last prestimulation value. Cultures were
returned to the fluorometer at t ⫽ 0 s. Data were expressed as mean
values of Fx/F0 (NRFU) ⫾ SE, n ⫽ 24–39.
DPI inhibited this ATP-induced fluorescence increase (0.0036 ⫾
0.0009 NRFU/s, n ⫽ 33, P ⬍ 0.05). Moreover, the ATP-induced
increase in H2O2 production was specific, as ADP did not induce
a significant increase over baseline production (0.0032 ⫾ 0.0003
NRFU/s, n ⫽ 27, P ⬎ 0.05). Thapsigargin induced a slower
increase in NRFU compared with ATP, seen 400–600 s after
addition (0.0046 ⫾ 0.0003 NRFU/s, n ⫽ 24, compared with the
control 0.0022 ⫾ 0.0002 NRFU/s, n ⫽ 39, P ⬍ 0.05). DPI treatment
did not lower baseline production (0.0025 ⫾ 0.0002 NRFU/s,
n ⫽ 33, P ⬎ 0.05).
In addition, ALI epithelial cell cultures were apically stimulated with either ATP alone or ATP plus dimethylthiourea
(DMTU) (Figure 7A), a permeable chemical scavenger of reactive oxygen species (ROS) including H2O2, hydroxyl radicals,
and other hydroxylated products (42–44). DMTU significantly
reduced the ATP-induced increase in apical ROS production
within the first 200 s after addition (0.0067 ⫾ 0.0009 NRFU/s,
n ⫽ 9, compared with ATP alone 0.0115 ⫾ 0.0015 NRFU/s,
n ⫽ 9, P ⬍ 0.05) and ROS production remained lower than the
ATP-stimulated one throughout the experiment. However, DMTU
did not lower ROS production to control values (0.0038 ⫾ 0.0007
NRFU/s, n ⫽ 9, compared with ATP ⫹ DMTU, n ⫽ 9, P ⬍
0.05). The scavenging activity of DMTU on ATP-stimulated
ROS production was dose-dependent (data not shown).
To further confirm that the measured fluorescence was due
to H2O2 produced at the apical surface of ALI cultures, we performed the assay by omitting HRP during the ATP stimulation
(Figure 7B). The results showed a significantly smaller increase in
NRFU within the first 200 s after addition of ATP in absence of
HRP (0.0054 ⫾ 0.0009 NRFU/s, n ⫽ 9, compared with ATP in
the presence of HRP 0.0226 ⫾ 0.0053 NRFU/s, n ⫽ 9, P ⬍ 0.05).
There was no difference seen between the NRFU values after ATP
in absence of HRP and the control values where the cells were
unstimulated (0.0058 ⫾ 0.0005 NRFU/s, n ⫽ 9, P ⬎ 0.05).
To assess H2O2 production at the basolateral (BL) compartment of the ALI cultures, the fluorescence from Amplex Red
oxidation by H2O2 in the presence of HRP was measured at 20-s
intervals from the bottom side of the cultures as described above
for the apical side. Addition of ATP at the apical surface did
Figure 7. H2O2 dependent oxidation of Amplex Red. (A ) Triplicates of ALI epithelial cell cultures
were incubated at 37 ⬚C with a
reaction mixture of Amplex Red
(50 ␮M) and HRP (0.1 U/ml) in
the apical chamber. Fluorescence
measurements were performed
at 20-s intervals for 5 min to obtain a baseline. At t ⫽ 0, cultures
were stimulated with 100 ␮M
apical ATP (filled squares),
100 ␮M ATP plus 40 mM DMTU
(triangles), or PBS (filled circles)
and the fluorescence was read for
an additional 30 min at 20-s
intervals. (B ) Apical fluorescence
measurement of oxidized Amplex
Red was performed from ALI
cultures stimulated at t ⫽ 0 with
100 ␮M ATP in the presence (filled squares) or in the absence (open
squares) of HRP (0.1 U/ml). Control cultures were incubated with PBS
in the reaction mixture of Amplex Red/HRP (filled circles). The data
were expressed as mean values of Fx/F0 (NRFU) ⫾ SE, n ⫽ 9 for each
experimental condition.
Forteza, Salathe, Miot, et al.: Regulated Hydrogen Peroxide Production in the Airway
not increase the BL H2O2 production (0.0017 ⫾ 0.0009 NRFU/s,
n ⫽ 9, compared with the control 0.0016 ⫾ 0.0007 NRFU/s,
n ⫽ 9, P ⬎ 0.05) (Figure 8A). Moreover, when ATP (Figure 8B)
or thapsigargin (Figure 8C) was added to the BL compartment
along with Amplex Red/HRP, there was no increase of NRFU
compared with the control (ATP: 0.0016 ⫾ 0.0003 NRFU/s, n ⫽
9, compared with the control 0.0019 ⫾ 0.0004 NRFU/s, n ⫽ 9,
P ⬎ 0.05; thapsigargin: 0.0018 ⫾ 0.0004 NRFU/s, n ⫽ 9, compared
with the control 0.0019 ⫾ 0.0003 NRFU/s, n ⫽ 9, P ⬎ 0.05).
These data suggest that the Ca2⫹-regulated H2O2 production
measured by Amplex Red/HRP is restricted to the apical compartment of ALI epithelial cells.
To confirm that both ATP and thapsigargin raise intracellular
calcium concentration in ALI cultures under these conditions,
changes in [Ca2⫹]i were estimated using the calcium indicator
fura-2 after stimulation with ATP or thapsigargin (Figure 9). A
similar time course of changes in the fura-2 ratio and H2O2
production was observed upon addition of either ATP or thapsigargin. Addition of ATP induced a rapid transient peak increase
of the fura-2 ratio immediately after addition before decreasing
back toward baseline (Figure 9B). Thapsigargin induced a slower
increase of the fura-2 ratio during the first 200 s after its addition,
but maintained an increased fura-2 ratio (Figure 9C). DPI did
not inhibit ATP-mediated increases in the fura-2 ratio. Thus, DPI
does not block ATP-stimulated H2O2 production by blocking
increases in [Ca2⫹]i (data not shown).
The demonstration of DPI inhibitable apical H2O2 generation
under conditions that increase [Ca2⫹]i is consistent with the notion that Duox in airway epithelia catalyzes the formation and
release of H2O2 in the airway lumen.
DISCUSSION
Hydrogen peroxide is an essential substrate for the LPO antibacterial system found in human airways. The studies presented
Figure 8. Basolateral H2O2 production by human ALI epithelial
cells. ALI cultures were incubated
at 37 ⬚C with 50 ␮l of Amplex
Red (50 ␮M) plus HRP (0.1 U/ml)
in the BL compartment. Fluorescence measurements were made
from the BL side of ALI cultures
for 5 min to establish a baseline.
At t ⫽ 0, cultures were stimulated
for 30 min and fluorescence was
read every 20 s after addition of:
100 ␮M ATP (filled squares) or
PBS (open circles) to the apical
surface (A ); 100 ␮M ATP (filled
squares) or PBS (open circles) to
the basolateral compartment
(B ); 1 ␮M thapsigargin (triangles) or PBS (open circles) to the
basolateral compartment (C ).
Data were expressed as mean
values of Fx/F0 (NRFU) ⫾ SE, n ⫽ 9
for each experimental condition.
467
here were undertaken to identify the enzymatic source of H2O2
in the airway lumen that might provide this substrate for LPO.
The data showed that human airway epithelial cells express Duox
mRNA, confirming reports by us and others (16, 23–25), and
providing evidence of Duox protein expression in native airway
epithelial sections. Our immunohistochemistry studies showed
an apical localization of Duox in the tracheal surface epithelia
in agreement with previous studies of thyroid gland (29) and
isolated cultured airway epithelial cells (23). The assays, used
here, measured H2O2 released to the apical, extracellular space,
also suggesting that Duox is located on or close to the surface
of the epithelial cells. The data also show that extracellular,
apical H2O2 production, likely by Duox, is stimulated by ATP
and thapsigargin, both agents that increased [Ca2⫹]i. Because
Duox1 and 2 are highly related and of similar molecular size,
Western blot analysis does not adequately distinguish the two
forms; thus, we were not able to distinguish protein expression
and activity differences between these two forms.
Two independent lines of evidence suggested that Duox is
the major NADPH oxidase found in airway epithelia. First, RTPCR studies suggested that Duox mRNA is the most abundant
homolog. Second, airway epithelia increased H2O2 production
after stimulation with thapsigargin or ATP, which both increased
[Ca2⫹]i as shown by fura-2 fluorescence (40, 41). This stimulated
H2O2 production was DPI-sensitive. These data are consistent
with the known presence of EF-hand motifs in a Duox domain
predicted to be on the cytosolic face of the membrane (15).
Thus, it is probable, although not directly demonstrated, that
the observed DPI-sensitive H2O2 production in airway epithelia
reflects Duox activity. Significant oxidation of Amplex red was
not observed in the absence of HRP in the assay, suggesting
that Duox was not capable of oxidizing significant quantities of
the substrate and also suggesting that the assay measured H2O2.
Previous studies have suggested that H2O2 production inside
airway epithelia did not rise in response to thapsigargin-mediated
[Ca2⫹]i increases (45). These latter studies used changes in fluorescence of Rhodamine 123-loaded cells to assess increases in
Figure 9. Estimation of [Ca2⫹]i using fura-2 ratio measurements.
ALI cultures were loaded with
fura-2 AM. Changes in [Ca2⫹]i
were followed by measuring ratios
of fura-2 fluorescence emission at
340 and 380 nm excitations. After
measuring fura2 ratios for prestimulation values, cultures were
removed from the fluorometer,
stimulants were added and the
cultures returned to the instrument at t ⫽ 0 s. All measurements
were at 37 ⬚C. (A ) PBS control;
(B ) 100 ␮M ATP; (C ) 1 ␮M thapsigargin. Plotted ratios are means ⫾
SE, n ⫽ 5.
468
AMERICAN JOURNAL OF RESPIRATORY CELL AND MOLECULAR BIOLOGY VOL 32 2005
intracellular reactive oxygen species. In contrast, the studies reported here show that extracellular H2O2 production by airway
epithelial cells rises in response to thapsigargin. Our studies
measured changes in H2O2 released at the apical surface of
epithelia that would largely be undetected by the Rhodamine
123 method.
The presence of Ca2⫹-regulated H2O2 release at the apical
surface is consistent with the immunolocalization data showing
that Duox activity is on or near the surface of the cells. In
fact, Duox topology predicts the release of superoxide into the
extracellular compartment. Why Duox is not active inside thyroid and airway epithelia is not known. Other membrane proteins have been reported to coexist on the surface and in internal
structures (46) and to be regulated in part by altering the relative
amounts found on the surface.
Since ADP did not stimulate H2O2 production, it appears
that ATP stimulation of H2O2 production may be mediated by
a P2Y receptor. Pseudomonas aeruginosa flagellin binding to
bronchial epithelial cells has been shown to release ATP from
cells, and it has also been shown that the released ATP mediates
increased mucin transcription via P2Y receptors (47). P2Y receptors also mediate a variety of other epithelial host defense responses, e.g., increases in ciliary beating (27, 39, 48) and secretion
of mucus (49–51). P2Y receptor activation may also stimulate
H2O2 production thus complementing other aspects of airway
host defense. It is interesting that Duox also contributes to acidification of airway surface liquid (23). Because airway LPO activity increases with decreasing pH (48), stimulation of Duox
activity may increase LPO activity through multiple mechanisms.
LPO appears to be constitutively expressed and secreted by
human airways (5). Because it requires H2O2 for its activity, the
previously reported presence of H2O2 in airways (2–4) may reflect
the normal production of substrate for LPO. LPO is not expressed at measurable levels in these culture conditions, and
thus it was not possible to show a direct link between Duoxmediated H2O2 production and LPO activity in vitro. However,
increased airway H2O2 seen during stimulation by irritants or
allergens may serve in part to increase LPO-mediated host defense. Because Duox is the major NADPH oxidase in airway
epithelia and appears to respond to P2Y stimulation to release
H2O2 to the apical surface, it is an excellent candidate source
for LPO substrate needed for airway host defense.
Conflict of Interest Statement : R.F. has no declared conflicts of interest; M.S. has
no declared conflicts of interest; F.M. has no declared conflicts of interest; R.F.
has no declared conflicts of interest; and G.E.C. has no declared conflicts of
interest.
References
1. Dekhuijzen PN, Aben KK, Dekker I, Aarts LP, Wielders PL, van
Herwaarden CL, Bast A. Increased exhalation of hydrogen peroxide
in patients with stable and unstable chronic obstructive pulmonary
disease. Am J Respir Crit Care Med 1996;154:813–816.
2. Jobsis Q, Raatgeep HC, Schellekens SL, Hop WC, Hermans PW, de
Jongste JC. Hydrogen peroxide in exhaled air of healthy children:
reference values. Eur Respir J 1998;12:483–485.
3. Lansing MW, Ahmed A, Cortes A, Sielczak MW, Wanner A, Abraham
WM. Oxygen radicals contribute to antigen-induced airway hyperresponsiveness in conscious sheep. Am Rev Respir Dis 1993;147:321–326.
4. Kinnula VL, Adler KB, Ackley NJ, Crapo JD. Release of reactive oxygen
species by guinea pig tracheal epithelial cells in vitro. Am J Physiol
1992;262:L708–L712.
5. Wijkstrom-Frei C, El-Chemaly S, Ali-Rachedi R, Gerson C, Cobas MA,
Forteza R, Salathe M, Conner GE. Lactoperoxidase and human airway
host defense. Am J Respir Cell Mol Biol 2003;29:206–212.
6. Reiter N, Perraudin JP. Lactoperoxidase: biological function. In: Grisham
MB, editor. Peroxidases in chemistry and biology. Vol I. Boca Raton,
FL: CRC Press; 1991. pp. 143–180.
7. Babior BM. NADPH oxidase. Curr Opin Immunol 2004;16:42–47.
8. Cross AR, Segal AW. The NADPH oxidase of professional phagocytesprototype of the NOX electron transport chain systems. Biochim Biophys Acta 2004;1657:1–22.
9. Vignais PV. The superoxide-generating NADPH oxidase: structural aspects and activation mechanism. Cell Mol Life Sci 2002;59:1428–1459.
10. Lambeth JD, Cheng G, Arnold RS, Edens WA. Novel homologs of
gp91phox. Trends Biochem Sci 2000;25:459–461.
11. Cheng G, Cao Z, Xu X, van Meir EG, Lambeth JD. Homologs of
gp91phox: cloning and tissue expression of Nox3, Nox4, and Nox5.
Gene 2001;269:131–140.
12. Kikuchi H, Hikage M, Miyashita H, Fukumoto M. NADPH oxidase
subunit, gp91(phox) homologue, preferentially expressed in human
colon epithelial cells. Gene 2000;254:237–243.
13. Li WG, Miller FJ Jr, Zhang HJ, Spitz DR, Oberley LW, Weintraub NL.
H(2)O(2)-induced O(2) production by a non-phagocytic NAD(P)H
oxidase causes oxidant injury. J Biol Chem 2001;276:29251–29256.
14. Yang S, Madyastha P, Bingel S, Ries W, Key L. A new superoxidegenerating oxidase in murine osteoclasts. J Biol Chem 2001;276:5452–
5458.
15. De Deken X, Wang D, Many MC, Costagliola S, Libert F, Vassart G,
Dumont JE, Miot F. Cloning of two human thyroid cDNAs encoding
new members of the NADPH oxidase family. J Biol Chem 2000;275:
23227–23233.
16. Edens WA, Sharling L, Cheng G, Shapira R, Kinkade JM, Lee T, Edens
HA, Tang X, Sullards C, Flaherty DB, et al. Tyrosine cross-linking of
extracellular matrix is catalyzed by Duox, a multidomain oxidase/
peroxidase with homology to the phagocyte oxidase subunit gp91phox.
J Cell Biol 2001;154:879–891.
17. Lambeth JD. Nox/Duox family of nicotinamide adenine dinucleotide
(phosphate) oxidases. Curr Opin Hematol 2002;9:11–17.
18. Suh YA, Arnold RS, Lassegue B, Shi J, Xu X, Sorescu D, Chung AB,
Griendling KK, Lambeth JD. Cell transformation by the superoxidegenerating oxidase Mox1. Nature 1999;401:79–82.
19. Abid MR, Kachra Z, Spokes KC, Aird WC. NADPH oxidase activity is
required for endothelial cell proliferation and migration. FEBS Lett
2000;486:252–256.
20. Souza HP, Laurindo FR, Ziegelstein RC, Berlowitz CO, Zweier JL.
Vascular NAD(P)H oxidase is distinct from the phagocytic enzyme
and modulates vascular reactivity control. Am J Physiol Heart Circ
Physiol 2001;280:H658–H667.
21. Corvilain B, van Sande J, Laurent E, Dumont JE. The H2O2-generating
system modulates protein iodination and the activity of the pentose
phosphate pathway in dog thyroid. Endocrinology 1991;128:779–785.
22. Corvilain B, Laurent E, Lecomte M, Vansande J, Dumont JE. Role of the
cyclic adenosine 3⬘,5⬘-monophosphate and the phosphatidylinositolCa2⫹ cascades in mediating the effects of thyrotropin and iodide
on hormone synthesis and secretion in human thyroid slices. J Clin
Endocrinol Metab 1994;79:152–159.
23. Schwarzer C, Machen TE, Illek B, Fischer H. NADPH oxidase-dependent
acid production in airway epithelial cells. J Biol Chem 2004;279:36454–
36461.
24. Geiszt M, Witta J, Baffi J, Lekstrom K, Leto TL. Dual oxidases represent
novel hydrogen peroxide sources supporting mucosal surface host
defense. FASEB J 2003;17:1502–1504.
25. Ali-Rachedi R, Gelin M, Forteza R, Conner GE. Hydrogen peroxide
production in airway epithelial cells is catalyzed by Gp91phox homologs highly similar to Duox 1. Am J Respir Crit Care Med 2003;
167:A284.
26. Bernacki SH, Nelson AL, Abdullah L, Sheehan JK, Harris A, Davis
CW, Randell SH. Mucin gene expression during differentiation of
human airway epithelia in vitro. Muc4 and muc5b are strongly induced.
Am J Respir Cell Mol Biol 1999;20:595–604.
27. Nlend MC, Bookman RJ, Conner GE, Salathe M. Regulator of G-protein
signaling protein 2 modulates purinergic calcium and ciliary beat frequency responses in airway epithelia. Am J Respir Cell Mol Biol
2002;27:436–445.
28. Sigillito RJ, Miller S, Tokuda N, Levy RB. Rat thyroid epithelial cells
provide limited accessory function but fail to present allo antigens in
vitro. Reg Immunol 1989;2:275–284.
29. De Deken X, Wang D, Dumont JE, Miot F. Characterization of ThOX
proteins as components of the thyroid H(2)O(2)-generating system.
Exp Cell Res 2002;273:187–196.
30. Mohanty JG, Jaffe JS, Schulman ES, Raible DG. A highly sensitive
fluorescent micro-assay of H2O2 release from activated human leukocytes using a dihydroxyphenoxazine derivative. J Immunol Methods
1997;202:133–141.
Forteza, Salathe, Miot, et al.: Regulated Hydrogen Peroxide Production in the Airway
31. Gerson C, Sabater J, Scuri M, Torbati A, Coffey R, Abraham JW,
Lauredo I, Forteza R, Wanner A, Salathe M, et al. The lactoperoxidase
system functions in bacterial clearance of airways. Am J Respir Cell
Mol Biol 2000;22:665–671.
32. Caillou B, Dupuy C, Lacroix L, Nocera M, Talbot M, Ohayon R, Deme
D, Bidart JM, Schlumberger M, Virion A. Expression of reduced
nicotinamide adenine dinucleotide phosphate oxidase (ThoX, LNOX,
Duox) genes and proteins in human thyroid tissues. J Clin Endocrinol
Metab 2001;86:3351–3358.
33. Dupuy C, Pomerance M, Ohayon R, Noel-Hudson MS, Deme D, Chaaraoui
M, Francon J, Virion A. Thyroid oxidase (THOX2) gene expression
in the rat thyroid cell line FRTL-5. Biochem Biophys Res Commun
2000;277:287–292.
34. Virion A, Michot JL, Deme D, Kaniewski J, Pommier J. NADPH-dependent
H2O2 generation and peroxidase activity in thyroid particular fraction.
Mol Cell Endocrinol 1984;36:95–105.
35. Nakamura Y, Ogihara S, Ohtaki S. Activation by ATP of calcium-dependent
NADPH-oxidase generating hydrogen peroxide in thyroid plasma
membranes. J Biochem (Tokyo) 1987;102:1121–1132.
36. Dupuy C, Kaniewski J, Deme D, Pommier J, Virion A. NADPH-dependent
H2O2 generation catalyzed by thyroid plasma membranes. Studies
with electron scavengers. Eur J Biochem 1989;185:597–603.
37. Leseney AM, Deme D, Legue O, Ohayon R, Chanson P, Sales JP, Pires
de Carvalho D, Dupuy C, Virion A. Biochemical characterization
of a Ca2⫹/NAD(P)H-dependent H2O2 generator in human thyroid
tissue. Biochimie 1999;81:373–380.
38. Dupuy C, Ohayon R, Valent A, Noel-Hudson MS, Deme D, Virion A.
Purification of a novel flavoprotein involved in the thyroid NADPH
oxidase: cloning of the porcine and human cdnas. J Biol Chem 1999;
274:37265–37269.
39. Salathe M, Bookman RJ. Coupling of [Ca2⫹]i and ciliary beating in
cultured tracheal epithelial cells. J Cell Sci 1995;108:431–440.
40. Salathe M, Bookman RJ. Mode of Ca2⫹ action on ciliary beat frequency
in single ovine airway epithelial cells. J Physiol 1999;520:851–865.
41. Lieb T, Frei CW, Frohock JI, Bookman RJ, Salathe M. Prolonged in-
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
469
crease in ciliary beat frequency after short-term purinergic stimulation
in human airway epithelial cells. J Physiol 2002;538:633–646.
Curtis WE, Muldrow ME, Parker NB, Barkley R, Linas SL, Repine JE.
N,N’-dimethylthiourea dioxide formation from N,N’-dimethylthiourea
reflects hydrogen peroxide concentrations in simple biological systems.
Proc Natl Acad Sci USA 1988;85:3422–3425.
Fischer B, Voynow J. Neutrophil elastase induces MUC5AC messenger
RNA expression by an oxidant-dependent mechanism. Chest 2000;117:
317S–320S.
Krunkosky TM, Martin LD, Fischer BM, Voynow JA, Adler KB. Effects
of TNFalpha on expression of ICAM-1 in human airway epithelial
cells in vitro: oxidant-mediated pathways and transcription factors.
Free Radic Biol Med 2003;35:1158–1167.
Rochelle LG, Fischer BM, Adler KB. Concurrent production of reactive
oxygen and nitrogen species by airway epithelial cells in vitro. Free
Radic Biol Med 1998;24:863–868.
Widnell CC. Control of glucose transport by GLUT1: regulated secretion
in an unexpected environment. Biosci Rep 1995;15:427–443.
McNamara N, Khong A, McKemy D, Caterina M, Boyer J, Julius D,
Basbaum C. ATP transduces signals from ASGM1, a glycolipid that
functions as a bacterial receptor. Proc Natl Acad Sci USA 2001;98:
9086–9091.
Salathe M, Holderby M, Forteza R, Abraham WM, Wanner A, Conner
GE. Isolation and characterization of a peroxidase from the airway.
Am J Respir Cell Mol Biol 1997;17:97–105.
Chen Y, Zhao YH, Wu R. Differential regulation of airway mucin gene
expression and mucin secretion by extracellular nucleotide triphosphates. Am J Respir Cell Mol Biol 2001;25:409–417.
Lethem MI, Dowell ML, Van Scott M, Yankaskas JR, Egan T, Boucher
RC, Davis CW. Nucleotide regulation of goblet cells in human airway
epithelial explants: normal exocytosis in cystic fibrosis. Am J Respir
Cell Mol Biol 1993;9:315–322.
Davis CW, Dowell ML, Lethem M, Van Scott M. Goblet cell degranulation in isolated canine tracheal epithelium: response to exogenous
ATP, ADP, and adenosine. Am J Physiol 1992;262:C1313–C1323.